A Penicillium oxalicum engineering strain with the Fbx23 gene deleted and its application in cellulase production

Abstract

The present invention discloses a Penicillium oxalicum engineering bacterium with the Fbx23 gene deleted and its application in the production of cellulase, which relates to the technical field of microbial engineering. The Penicillium oxalicum engineering bacterium was deposited at the General Microbiology Center of the China Center for Type Culture Collection on December 14, 2022. The deposit address is No. 3, Courtyard 1, Beichen Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 40443. The present invention also provides the application of the Penicillium oxalicum engineering bacterium in the production of cellulase. By deleting the gene of the ubiquitin ligase E3 subunit Fbx23, the present invention constructs a Penicillium oxalicum engineering bacterium with the Fbx23 gene deleted, and the extracellular cellulase synthesis ability of the engineering bacterium is significantly improved.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial engineering, and particularly to a Penicillium oxalicum engineering strain with the Fbx23 gene deleted and its application in the production of cellulase. Background Art

[0002] Lignocellulose is a complex carbohydrate commonly present in plant bodies in nature. Filamentous fungi represented by Trichoderma, Penicillium, and Aspergillus are important decomposers and recyclers of lignocellulose in nature. Cellulase mainly contains three components: endo-β-1,4-glucanase (endo-1,4-β-glucanase, EG) (EC 3.2.1.4), also known as endocellulase, 1,4-β-cellobiohydrolase (CBH) (EC 3.2.1.91), also known as exocellulase, and β-D-glucosidase (BG) (EC 3.2.1.21), and has been widely used in the feed, biofuel, detergent, textile and other industries (Chandel AK, et al. The realm of cellulases in biorefinery development. Crit Rev Biotechnol. 2012 Sep; 32(3): 187-202. doi: 10.3109 / 07388551.2011.595385).

[0003] Penicillium oxalicum is a filamentous ascomycete that produces cellulase, and the cellulase it produces has been applied in the bioethanol and feed industries (Penicillium oxalicum Liu G, et al. Long-term strain improvements accumulate mutations in regulatory elements responsible for hyper-production of cellulolytic enzymes. Sci Rep. 2013; 3: 1569. doi: 10.1038 / srep01569). Further improving the yield of cellulase synthesized by Penicillium oxalicum is an important step in reducing the production cost of cellulase. Therefore, how to increase the yield of cellulase synthesized by Penicillium oxalicum has become a technical problem that needs to be solved urgently by those skilled in the art.

[0004] In recent years, the work of genetically modifying Penicillium oxalicum strains to improve their ability to synthesize cellulase has been gradually carried out, and some key transcription factors that regulate cellulase synthesis have been discovered. Enhancing the expression of transcription factors that positively regulate cellulase synthesis, or deleting the coding genes of negatively regulating transcription factors, can promote the transcription of cellulase coding genes, and ultimately improve the synthesis of cellulase (Li Z, et al. Synergistic and Dose-Controlled Regulation of Cellulase Gene Expression in Penicillium oxalicum. PLoS Genet. 2015 Sep11; 11 (9): e1005509. doi: 10.1371 / journal. pgen. 1005509). The research of the prior art mainly focuses on improving cellulase synthesis and secretion by promoting the transcription of cellulase coding genes, but these methods have limited effects on improving cellulase production. How to open up ideas and further improve the production of cellulase synthesized by Penicillium oxalicum is still a technical problem that needs to be solved urgently by those skilled in the art. Summary of the invention

[0005] The purpose of the present invention is to provide an engineered Penicillium oxalicum strain with a deleted Fbx23 gene and its application in producing cellulase to solve the problems existing in the above-mentioned prior art. The present invention constructs an engineered Penicillium oxalicum strain with a deleted Fbx23 gene by deleting the ubiquitin ligase E3 subunit Fbx23 gene. The engineered strain can weaken the ubiquitination of the enzyme protein, thereby preventing the cellulase protein from entering the proteasome degradation pathway, and ultimately improving the enzyme protein synthesis and secretion.

[0006] The present invention discovers through research that the prior art's research on Penicillium oxalicum for synthesizing cellulase mainly focuses on promoting the transcription of cellulase-encoding genes to increase the synthesis and secretion of cellulase, but it fails to notice the problem that after a large amount of cellulase protein is synthesized intracellularly, it will be degraded by endogenous proteases. In cells, the massive synthesis of enzyme proteins will impose stress on the cells themselves, and excessive proteins will be ubiquitinated and then enter the degradation pathway. The ubiquitin-proteasome system (UPS) is the most important protein degradation pathway known in all eukaryotic organisms. The protein to be degraded is first ubiquitinated and then degraded by the proteasome. Ubiquitination involves a series of reactions of ubiquitin-activating enzyme E1, ubiquitin-conjugating enzyme E2, and ubiquitin ligase E3 (Pohl C & Dikic I. Cellular quality control by the ubiquitin-proteasome system and autophagy. Science. 2019 Nov 15; 366(6467):818-822. doi:10.1126 / science.aax3769). Ubiquitin ligase E3 generally serves as the last step of ubiquitination and is responsible for directly transferring ubiquitin to the lysine residue of the target protein. The subunit containing the F-Box domain in ubiquitin ligase E3, as the substrate adaptors of ubiquitin ligase E3, mediates the proteasomal degradation of the target protein (Nguyen KM & Busino L. The Biology of F-box Proteins: The SCF Family of E3 Ubiquitin Ligases. Adv Exp Med Biol. 2020; 1217:111-122. doi:10.1007 / 978-981-15-1025-0_8).

[0007] The Fbx23 protein, as a subunit of the ubiquitin ligase E3 SCF complex, is named because it contains an F-Box domain. After retrieval, there are only two literatures reporting on the function of the Fbx23 protein in filamentous fungi, which respectively report its participation in the development and secondary metabolism of Aspergillus nidulans (Meister C, et al. COP9 Signalosome Interaction with UspA / Usp15 Deubiquitinase Controls VeA-Mediated Fungal Multicellular Development. Biomolecules. 2019 Jun 18;9(6):238. doi:10.3390 / biom9060238), carbon catabolite repression, and endo-1,4-β-xylanase synthesis (de Assis LJ, et al. Regulation of Aspergillus nidulans CreA-Mediated Catabolite Repression by the F-Box Proteins Fbx23 and Fbx47. mBio. 2018 Jun 19;9(3):e00840-18. doi:10.1128 / mBio.00840-18). There is no literature reporting that the deletion of the Fbx23 protein can promote cellulase synthesis.

[0008] Based on this, the present invention provides the following solutions:

[0009] The present invention provides a Penicillium oxalicum engineering strain with the Fbx23 gene deleted. The Penicillium oxalicum engineering strain was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on December 14, 2022. The deposit address is No. 3, Courtyard 1, Beichen Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 40443.

[0010] The present invention also provides the application of the above-mentioned Penicillium oxalicum engineering strain in the production of cellulase.

[0011] The present invention also provides a method for constructing an engineering strain for producing cellulase, including the step of knocking out the Fbx23 gene of Penicillium oxalicum by gene knockout to construct a mutant strain with the Fbx23 gene deleted, and the mutant strain is the engineering strain.

[0012] Furthermore, the gene knockout is achieved by the protoplast transformation method, and the Fbx23 knockout cassette is transferred into the Penicillium oxalicum.

[0013] Furthermore, the Fbx23 knockout cassette includes homologous arms of the Fbx23 gene and the hph gene.

[0014] Furthermore, the Penicillium oxalicum is Penicillium oxalicum CGMCC5302.

[0015] The present invention also provides an engineered bacterium for producing cellulase constructed according to the above construction method.

[0016] The present invention also provides the application of the above-mentioned engineered bacterium for producing cellulase in the production of cellulase.

[0017] The present invention discloses the following technical effects:

[0018] The present invention finds through research that by deleting the gene of the ubiquitin ligase E3 subunit Fbx23, the synthesis and secretion of cellulase protein are ultimately improved. It is speculated that the deletion can weaken the ubiquitination of the enzyme protein, thereby avoiding the entry of the cellulase protein into the proteasome degradation pathway, and ultimately improving the synthesis and secretion of the cellulase protein.

[0019] The present invention deletes the coding gene of the Fbx23 protein (GenBank: EPS33505.1) in the original strain Penicillium oxalicum (CGMCC No. 5302) by the method of gene homologous recombination. First, an Fbx23 knockout cassette with homologous arms of the Fbx23 gene sequence and the hygromycin resistance gene hph as a screening marker is obtained. By the method of preparing protoplast transformation, the Fbx23 knockout cassette is transferred into the original strain. Double crossover recombination occurs between the homologous arms at both ends of the Fbx23 knockout cassette and the homologous sequences corresponding to the target gene Fbx23 on the genome, and the hygromycin resistance gene hph replaces the original Fbx23 gene. Finally, a mutant engineering strain Dfbx23 with the Fbx23 gene deleted in the Penicillium oxalicum genome is obtained. Through experimental determination, the carboxymethyl cellulase (CMCase) activity (indicating endo-cellulase activity) of the Dfbx23 strain reaches up to 12.56 IU / mL at most, which is 3.7 times that of the original strain (3.41 IU / mL); the highest p-nitrophenyl cellobiosidase (pNPCase) activity (indicating exo-cellulase activity) reaches 2.05 IU / mL, which is 1.8 times that of the original strain (1.13 IU / mL); the highest filter paper enzyme activity (FPase) (indicating total cellulase activity) reaches 0.62 IU / mL, which is 2.1 times that of the original strain (0.30 IU / mL). The improvement of the above enzyme activities shows that the ability of the Penicillium oxalicum engineering strain Dfbx23 to synthesize extracellular cellulase is significantly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0021] Figure 1 Southern Blot verification of the gene deletion mutant Dfbx23 in Example 1; among them, A is the design strategy of Southern Blot verification; B is the Southern Blot verification result, lane 1: Fbx23 gene deletion mutant Dfbx23, lane 2: original strain, lane 3: DNA marker;

[0022] Figure 2 Determination results of the carboxymethyl cellulase activity (indicating endoglucanase activity) of the original strain and the mutant Dfbx23 in Example 1;

[0023] Figure 3 Determination results of the nitrophenyl cellobioside enzyme activity (indicating exoglucanase activity) of the original strain and the mutant Dfbx23 in Example 1;

[0024] Figure 4 Determination results of the filter paper enzyme activity (indicating total cellulase activity) of the original strain and the mutant Dfbx23 in Example 1;

[0025] Figure 5 Colony morphological characteristics of the mutant Dfbx23 on potato agar medium (cultured at 30 °C for 4 days);

[0026] Figure 6 The starting strain CX for high-yield cellulase in Example 2 C Determination results of the filter paper enzyme activity (indicating total cellulase activity) of the mutant CX-Df. Detailed implementation manners

[0027] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0028] It should be understood that the terms used in this invention are only for describing specific embodiments and are not intended to limit the invention. Additionally, for the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0029] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0030] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the specification of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of this invention are obvious to those skilled in the art. The specification and examples of this invention are merely exemplary.

[0031] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0032] Example 1

[0033] 1. Experimental materials

[0034] 1.1 Original strain

[0035] The original strain of Penicillium oxalicum was deposited with the China General Microbiological Culture Collection Center (CGMCC) on September 28, 2011, and the deposit number is CGMCC No. 5302.

[0036] 1.2 Reagents, culture media and experimental solutions

[0037] Reagents: Phanta Max Super-Fidelity DNA Polymerase and 2×Taq Master Mix from Nanjing Novoprotein Scientific Inc.; Lysing enzymes from Trichoderma from SIGMA; Plasmid extraction and agarose gel recovery kits from OMEGA; Goldview TM nucleic acid dye from Dingguo ChangSheng Biotechnology Co., Ltd.

[0038] Media:

[0039] Wheat bran medium (1000 mL): 100.0 g of wheat bran, add water and boil for 30 min, filter through eight layers of gauze to collect the filtrate, make up the volume to 1000 mL, dispense, add 2% agar powder, and sterilize at 121 °C under high pressure steam for 30 min.

[0040] Upper transformation medium (1000 mL): 20.0 mL of 50×Vogel’s salt, 20.0 g of glucose, 182.0 g of sorbitol, make up the volume to 1000 mL and then dispense, add 1% agarose, and sterilize at 115 °C under high pressure steam for 30 min.

[0041] Lower transformation medium (1000 mL): 182.0 g of sorbitol, make up the volume to 1000 mL and then dispense, add 1.5% agarose, and sterilize at 115 °C under high pressure steam for 30 min.

[0042] Single spore medium (1000 mL): 1×Vogel’s salt, 20.0 g of glucose, make up the volume to 1000 mL, dispense, add 0.5‰ Triton X-100 and 1.5% agar powder, and sterilize at 115 °C under high pressure steam for 30 min. Mycelium growth medium (1000 mL): 1×Vogel’s salt, 20.0 g of glucose, sterilize at 115 °C under high pressure steam for 30 min.

[0043] Fermentation medium (1000 mL): 1×Mandel’s salt, 1 wt% wheat bran and 1 wt% microcrystalline cellulose as carbon sources, sterilize at 115 °C under high pressure steam for 30 min.

[0044] VMMG medium: 2 wt% 50×Vogel’s salt, 2 wt% glucose, sterilize at 115 °C under high pressure steam for 30 min, add 1 wt% agarose to obtain VMMG solid medium. Experimental solutions:

[0045] Trace element stock solution: 5.0 g of citric acid, 5.0 g of ZnSO4·7H2O, 1.0 g of Fe(NH4)2(SO4)2·6H2O, 0.25 g of CuSO4·5H2O, 0.05 g of MnSO4·H2O, 0.05 g of H3BO3, 0.05 g of Na2MoO4·2H2O. Make up to 100 mL with deionized water and store at 4°C.

[0046] 50× Vogel's salts: 125.0 g of Na3Citrate·2H2O, 250.0 g of KH2PO4, 100.0 g of NH4NO3, 10.0 g of MgSO4·7H2O, 5.0 g of CaCl2·2H2O, 0.25 mg of biotin, 5 mL of trace element stock solution. Make up to 1000 mL with deionized water and store at 4°C.

[0047] 10× Mandel's salts: 30.0 g of KH2PO4, 26.0 g of NaNO3, 5.0 g of MgSO4·7H2O, 5.0 g of anhydrous CaCl2, 10.0 g of peptone, 5.0 g of urea, 75.0 mg of FeSO4·7H2O, 25.0 mg of MnSO4·H2O, 36.0 mg of ZnSO4·7H2O, 37.0 mg of CoCl2·6H2O. Make up to 1000 mL with deionized water and store at 4°C.

[0048] Tris-HCl (1 M, pH 7.5): 121.0 g of Tris. Make up to 1000 mL with deionized water and adjust the pH to 7.5 with hydrochloric acid. Autoclave at 121°C for 30 min and store at 4°C.

[0049] Transformation solution S1: 2.72 g of KH2PO4, 43.72 g of sorbitol. Make up to 200 mL with deionized water and adjust the pH to 5.6 with NaOH. Autoclave at 121°C for 30 min and store at room temperature.

[0050] Transformation solution S2: 9.11 g of sorbitol, 0.368 g of anhydrous CaCl2, 0.5 mL of Tris-HCl (1 M, pH 7.5). Make up to 50 mL with deionized water. Autoclave at 121°C for 30 min and store at room temperature.

[0051] Transformation solution T1: 25.0 g of PEG6000, 0.555 g of anhydrous CaCl2, 1 mL of Tris-HCl (1 M, pH 7.5). Make up to 100 mL with deionized water. Autoclave at 121°C for 30 min and store at room temperature.

[0052] Normal saline: 0.9% NaCl, 0.05% Tween 80, autoclaved at 121°C for 30 min and stored at room temperature.

[0053] Genomic DNA extraction buffer: 0.2 M Tris-HCl (pH 8.5), 0.25 M NaCl, 0.025 M Na2EDTA·2H2O, 2% SDS, made up to 1000 mL with deionized water.

[0054] 7.5 M Ammonium acetate: 578.12 g of ammonium acetate, made up to 1000 mL with deionized water.

[0055] Preparation of DNS reagent: (1) Weigh 10 g of 3,5-dinitrosalicylic acid and dissolve it in 300 mL of deionized water. Gradually add 10 g of sodium hydroxide and dissolve it in a water bath at 50°C. (2) Weigh 200 g of potassium sodium tartrate and dissolve it in 400 mL of deionized water. Then add 2 g of redistilled phenol and 5 g of anhydrous sodium sulfite. After complete dissolution, mix the solutions from (1) and (2) and make up to 1000 mL. Store in a brown bottle and use after 7 days.

[0056] 10× SDS-PAGE electrophoresis buffer: 30.3 g of Tris, 187.7 g of glycine, 10.0 g of SDS, made up to 1000 mL with deionized water and stored at room temperature.

[0057] SDS-PAGE staining solution: 200 mL of methanol, 100 mL of glacial acetic acid, 2.5 g of Coomassie Brilliant Blue R-250, made up to 1000 mL with deionized water and stored at room temperature.

[0058] SDS-PAGE destaining solution: 100 mL of methanol, 100 mL of glacial acetic acid, made up to 1000 mL with deionized water and stored at room temperature.

[0059] 1.3 Experimental instruments

[0060] PCR instrument (BIO-GENER); high-speed refrigerated centrifuge (Eppendorf); agarose gel ultraviolet imaging system (MajorScience); stacking shaking incubator (Minquan); ultra-micro spectrophotometer (Quawell); heating magnetic stirrer (EMS-9A); electrothermal constant temperature water bath (DK-8D); pH meter (Sartorius); electrophoresis apparatus (DYY-11B); microplate spectrophotometer (BioTeK); autoclave (Deqiang Instruments); electrothermal blast drying oven (GFL-125); circulating water multi-purpose vacuum pump (Tuohe Electromechanical Technology), etc.

[0061] 2. Methods

[0062] Constructing the Fbx23 gene knockout strain (Dfbx23) in the original strain of Penicillium oxalicum using fusion PCR method:

[0063] 2.1 Construction of the Fbx23 gene knockout cassette

[0064] Using the genome of the original strain of Penicillium oxalicum CGMCC No.5302 as a template, the upstream homologous arm of the Fbx23 gene was amplified using primers DFbx23-UF / DFbx23-UR. The downstream homologous arm of the Fbx23 gene was amplified using primer pairs DFbx23-DF / DFbx23-DR. The hygromycin resistance gene hph was amplified from the plasmid pSilent1 template using primer pairs hph-F / hph-R as a marker gene. The obtained upstream homologous arm, hph gene, and downstream homologous arm were fused by overlap PCR and then amplified using nested primer pairs DFbx23-CSF / DFbx23-CSR to obtain the DFbx23 gene knockout cassette.

[0065] DFbx23-UF: GGAAGAAAGGGACAGTCGCG (SEQ ID NO.3);

[0066] DFbx23-UR: CCTTCAATATCAGTTAACGTCGCCGCGCGGGCGACGATCCCG (SEQ ID NO.4);

[0067] DFbx23-DF: CGTCACCAGCCCCTGGGTTGTCTTCAGTTCTACGATGTGATTTG (SEQ ID NO.5);

[0068] DFbx23-DR: CAACGTGAGACCTGGCTTCG (SEQ ID NO.6);

[0069] hph-F: CGACGTTAACTGATATTGAAGG (SEQ ID NO.7);

[0070] hph-R: CGTCACCAGCCCCTGGGTTG (SEQ ID NO.8);

[0071] DFbx23-CSF: CACTAGAGTGGCCGAAACCCTG (SEQ ID NO.9);

[0072] DFbx23-CSR: GCCTCATTTTCAGGAGCGAC (SEQ ID NO.10).

[0073] 2.2 Preparation, transformation of protoplasts and isolation and purification of Fbx23 gene knockout mutants

[0074] (1) Pour the bran medium into an appropriate amount of petri dishes. After solidification, lay a piece of glass paper on it. Uniformly coat 100 μL (1×10 7 spores / mL) of the fresh spore suspension of the original Penicillium oxalicum strain on the glass paper, and place it in an incubator at 30 °C for 10 h.

[0075] (2) Prepare the protoplast lysis solution with transformation solution S1. Dissolve 0.03 g of lyticase in 10 mL of transformation solution S1.

[0076] (3) Place the glass paper into new petri dishes in sequence. Add 3 mL of protoplast lysis solution for each piece, and place it in an incubator at 30 °C for 2 h for lysis.

[0077] (4) Gently scrape off the mycelium on the glass paper with forceps, then rinse it in another petri dish containing S1, and finally gently pipette and mix it well with the tip of a pipette. Filter the mixed bacterial solution through a funnel wrapped with four layers of lens cleaning paper. Centrifuge at 2000 rpm at 4 °C for 10 min, pour off the supernatant, add 5 mL of transformation solution S2 and pipette and mix well. Centrifuge again, pour off part of the supernatant, and retain 200 μL for resuspending the protoplasts. Then observe the protoplast concentration and quality under a microscope.

[0078] (5) Transformation system: Add 12 μL of the Fbx23 gene knockout cassette with a concentration greater than 200 ng / μL to 200 μL of protoplasts, quickly add 60 μL of transformation solution T1, pipette and mix well, and incubate on ice for 20 min.

[0079] (6) Add 2 mL of transformation solution T1, pipette and mix well, let it stand at room temperature for 5 min, and add 4 mL of transformation solution S2 to terminate the transformation.

[0080] (7) Pour the transformation lower layer medium into a petri dish in advance and let it cool and solidify.

[0081] (8) Add the transformation system to 30 mL of melted transformation upper layer medium, mix well and add 150 μg / mL hygromycin, mix well and pour it onto the petri dish containing the solidified transformation lower layer medium in step (7). After solidification, place it in an incubator at 30 °C until transformants grow out.

[0082] (9) Circle the transformant colonies with a pen. After counting, take the same number of 1.5 mL centrifuge tubes, and add 200 μL of normal saline to each tube.

[0083] (10) Dip the inoculation loop into the spore dilution saline to form a water film and gently touch the colony spores, then put it back into the centrifuge tube and shake well.

[0084] (11) Dip an inoculation loop into the well-mixed spore suspension, streak and purify it on a single-spore medium supplemented with the corresponding antibiotic, and then place it in an incubator at 30 °C for static culture.

[0085] (12) Pipette 50 μL of the spore suspension into 600 μL of VMMG, place it on a shaker at 30 °C and 200 rpm for 24 h. After mycelia grow, extract the genome and perform Southern Blot verification to determine whether the Fbx23 gene has been completely deleted.

[0086] Genome extraction method:

[0087] (1) Inoculate 5 μL of the spore suspension into a 1.5 mL centrifuge tube containing 600 μL of VMMG, incubate at 30 °C and 200 rpm for 20 h. After the spores germinate and mycelia are visible to the naked eye, it is okay.

[0088] (2) Centrifuge, discard the supernatant culture medium, add 500 μL of genome extraction buffer and a small amount of quartz sand, shake vigorously at level 7 in a homogenizer for 1 min, and then place it in a water bath at 65 °C for 10 min.

[0089] (3) Then add 200 μL of 7.5 M ammonium acetate, invert and mix well, and incubate on ice for 10 min.

[0090] (4) After a white precipitate appears, centrifuge at 4 °C and 12,000 rpm for 10 min. Transfer the supernatant to a new centrifuge tube, add 350 μL of isopropanol, invert and mix well, and place it in a -20 °C refrigerator for 10 min.

[0091] (5) Centrifuge at 4 °C and 12,000 rpm for 10 min, pour off the supernatant, wash the precipitate once with 1 mL of 75% (v / v) ethanol, centrifuge at 10,000 rpm for 3 min, discard the supernatant, air-dry and then dissolve the genome by adding 20 μL of pure water.

[0092] 2.3 Southern Blot verification of the gene deletion mutant Dfbx23:

[0093] The strategy for Southern Blot verification is referred to Figure 1 A in. Use the primer pair fbx23-Sou-F / fbx23-Sou-R to amplify the probe. Perform Southern Blot experiment according to the DIG DNA Labeling and Detection Kit (Roche). The specific method refers to the kit instruction manual.

[0094] fbx23-Sou-F: CACGAGAGAATCACGCCGAATC (SEQ ID NO.11);

[0095] fbx23-Sou-R: GACCACAACAAACGGCACGTC (SEQ ID NO.12).

[0096] 2.4 Determination of extracellular cellulase activity

[0097] The extracellular cellulase activities of the original strain of Penicillium oxalicum and Dfbx23 were determined respectively. The determination method was as follows: Inoculate 1 mL (1×10 7 spores / mL) of fresh spore suspension into 100 mL of VMMG liquid medium, culture at 30 °C and 200 rpm for 24 h, then vacuum filter the mycelium, transfer 0.3 g of the filtered mycelium to 50 mL of fermentation medium, and ferment and culture at 30 °C and 200 rpm. Take the fermentation broth at different culture time points. After centrifuging the fermentation broth at 8000 rpm for 3 min, take the supernatant as the enzyme solution and measure various enzyme activities in the enzyme solution.

[0098] Among them, the method for determining filter paper activity (FPA) was as follows: Add 50 mg of Whatman No. 1 filter paper into an enzyme-labeled tube. Add 1.5 mL of acetic acid-sodium acetate buffer solution with pH 4.8, add 250 μL of enzyme solution and 250 μL of ddH2O, and react at 50 °C for 1 h. Use the DNS method to measure the enzyme activity. After the reaction, add 3 mL of DNS, and then add an equal amount of enzyme solution to the control. Boil in a water bath for 10 min and cool in ice water. Then add 20 mL of distilled water and make up the volume to 25 mL. After mixing, take 200 μL and measure the OD 540 reading.

[0099] The method for determining endocellulase activity was as follows: Add 1.5 mL of 1 wt% carboxymethyl cellulose sodium (CMC-Na) as the substrate into an enzyme-labeled tube. Add 100 μL of enzyme solution and 400 μL of ddH2O to the experimental group, and react at 50 °C for 30 min. Use the DNS method to measure the enzyme activity.

[0100] The method for determining exocellulase activity was as follows: Add 50 μL of (1 mg / mL) p-nitrophenyl cellobioside (pNPC) as the substrate into a 1.5 mL centrifuge tube. Add 100 μL of the enzyme solution diluted 200 times to the experimental group and react at 50 °C for 30 min. Add 150 μL of 10 wt% Na2CO3 to terminate the reaction. After mixing, take 200 μL and measure the OD 420 .

[0101] One enzyme activity unit was defined as the amount of enzyme that could convert 1 μmol of substrate within 1 min under the determination conditions.

[0102] 3. Results

[0103] 3.1 Southern Blot Verification of the Gene Deletion Mutant Strain Dfbx23

[0104] The results of verifying the Dfbx23 strain using the Southern Blot method showed that the Fbx23 gene was completely deleted in the strain Dfbx23 ( Figure 1 in B).

[0105] 3.2 Results of Extracellular Cellulase Activity Assay

[0106] The carboxymethyl cellulase (CMCase) activity (indicating endo - cellulase activity) of the Dfbx23 strain reached a maximum of 12.56 IU / mL, which was 3.7 times that of the original strain (3.41 IU / mL) (see Figure 2 ); the maximum p - nitrophenyl cellobiosidase (pNPCase) activity (indicating exo - cellulase activity) reached 2.05 IU / mL, which was 1.8 times that of the original strain (1.13 IU / mL) (see Figure 3 ); the maximum filter paper enzyme activity (FPase) (indicating total cellulase activity) reached 0.62 IU / mL, which was 2.1 times that of the original strain (0.30 IU / mL) (see Figure 4 ).

[0107] The above - mentioned increase in enzyme activity indicated that the ability of the Dfbx23 strain to synthesize cellulase extracellularly was significantly improved. When the Dfbx23 strain was cultured in a potato dextrose agar (PDA) medium at 30 °C, it was initially a white colony. After 2 days of culture, green spores appeared on the surface of the mycelium. After continuing to culture for 2 more days, the colony turned green ( Figure 5 ).

[0108] The Dfbx23 strain was deposited in the China General Microbiological Culture Collection Center on December 14, 2022. The deposit address is No. 3, Courtyard 1, Beichen Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 40443.

[0109] In this example, the nucleotide sequence of the knocked - out Fbx23 gene:

[0110]

[0111] The protein sequence corresponding to the Fbx23 gene (UniProt: S7ZS07; GenBank: EPS33505.1):

[0112] MEEQTGPDSSSCPALKLQATSFSGYTATTLSPAFRLDEGYSDDTRSPADKDLPVEGSMSLPEWVLAQSEADRAALAYTILRSLPTATLAGIVEHLTPLLHMDPVVKLPPELTFQIFSYLEPRQLLTASLASRSWRSRILDSGLWRVLYINEGWRVDVRAIRNFEQEQSEALSPQTRRARPQCSDPDLSEPKQKKRVPMSWYDTRTADDTLSSNGKAEPDDEGDHHMVDASERTTQLARERPRLESPTPALNSASLLQPPLRSSLVVRMPNGSARINWMHLYKQRRRLEANWHHGRFTNFQLPHPSHPEDAHQECVYAIQFEGKWLVSGSRDRTVRVWDLETKRLWYRPLVGHAKSVLCLQFDPSPEEDIIISGSSDRSVIMWRFSTGQRIHHIANAHADSVLNLKFDHRFLVTCSKDRTVKVWNRHDLLPTHEDYPRIFKGGAASYPSYIIDLNENAPSLLEASIANGQIKALKAYSLLMTVEGHGAAVNAMQLDGDEIVTASGDRMIKVWNIRNGTCVKTLMGHEKGIACVQSDSRRIISGSNDNTVRIYDHISGAEVACLRGHNNLVRTVQAGFGDPPGADEALRLEALEVDTAFWRAQQEGVPVDLGPGVSRRPGYTSNTAGSRNPRDIRAIGAKIPPGGGGSMWGRIVSGSYDQSILIWHKDRDGAWSIGHRLLQSDAAANAARGTLSAAARAAIQTQVRHLQAAQAPGPATPAAQNATADQRSSHSTELQPQGNTPGSQEGNAAAVAGPSTMPGSANGTDPTSINGSAQILQQPPSASPIPPATPATVTPAAAAAIAAVAIPGNPPQMAPARQIHQLHRNRAPAPTSRVFKVQFDSRKIVCASVDPRIVGWDFACGDEEILEACRFFQGL(SEQ ID NO.2).

[0113] Example 2

[0114] Using the genetically engineered high cellulase-producing Penicillium oxalicum strain CX C strain (Gao L, etal. Constitutive Expression of Chimeric Transcription Factors Enables Cellulase Synthesis under Non-Inducing Conditions in Penicillium oxalicum. Biotechnol J. 2017 Nov;12(11). doi.org / 10.1002 / biot.201700119) as the starting strain, referring to the strain construction method of Example 1, the Fbx23 gene was knocked out to obtain a mutant strain lacking the Fbx23 gene in the CX C strain, named CX-Df.

[0115] The extracellular cellulase activities of Penicillium oxalicum strains CX C and CX-Df were measured respectively (the detection method was the same as that in Example 1). The results showed that compared with CX C , the filter paper enzyme activity of the mutant strain CX-Df lacking the Fbx23 gene was increased. Taking the 5th day of fermentation as an example, the filter paper enzyme activity of CX-Df was increased by 67.8% compared with that of CX C (see Figure 6 ).

[0116] The above embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. An engineered strain of Penicillium oxalicum with the Fbx23 gene deleted, characterized in that, The engineered Penicillium oxalicum strain was deposited at the General Microbiological Center of the China Center for Type Culture Collection on December 14, 2022. The deposit address is No. 3, Courtyard 1, Beichen Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 40443.

2. Use of an engineered Penicillium oxalicum strain according to claim 1 in the production of cellulase.

3. A method for constructing an engineered bacterium for producing cellulase, characterized in that, It includes the step of gene knockout of the Fbx23 gene of Penicillium oxalicum to construct a mutant strain with the Fbx23 gene deleted, and the mutant strain is the engineered strain; The Penicillium oxalicum is Penicillium oxalicum CGMCC No. 5302; The nucleotide sequence of the Fbx23 gene is as shown in SEQ ID NO.

1.

4. The construction method according to claim 3, characterized in that, The gene knockout is achieved by protoplast transformation to transfer the Fbx23 knockout cassette into the Penicillium oxalicum.

5. The construction method according to claim 4, characterized in that, The Fbx23 knockout cassette includes homologous arms of the Fbx23 gene and the hph gene.

6. An engineered strain for producing cellulase constructed by the construction method according to any one of claims 3-5.

7. Use of an engineered strain according to claim 6 in the production of cellulase.

Images