SCAR marker for detection of heterologous radish mitochondrial fragments in brassica oleracea ogura cytoplasmic male sterile lines

Abstract

The application belongs to the technical field of molecular breeding, and particularly relates to a SCAR marker for detecting a heterologous radish mitochondrial fragment in a Brassica oleracea Ogura cytoplasmic male sterile line. The application provides a SCAR marker for detecting a heterologous radish mitochondrial fragment in a Brassica oleracea Ogura cytoplasmic male sterile line, which comprises one or more or all of markers AC1-AC16; the nucleotide sequences of the AC1-AC16 are shown in SEQ ID NO: 1-16. The SCAR marker of the application has high specificity and good stability, and can accurately identify whether the corresponding heterologous radish mitochondrial fragment is contained in a to-be-tested Brassica oleracea cytoplasmic male sterile line and the relative content thereof, thereby being beneficial to early selection of the Brassica oleracea cytoplasmic male sterile line, improving breeding efficiency, and reducing breeding cost.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, specifically relating to SCAR markers, primers, and their applications for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of cabbage. Background Technology

[0002] Heading cabbage (Brassica oleracea L. var. capitalata) belongs to the genus Brassica in the family Brassicaceae and is a leafy vegetable widely cultivated worldwide. Cabbage is a typical cross-pollinated plant, exhibiting significant heterosis; F1 hybrids are significantly superior to their parents in traits such as growth vigor, yield, and disease resistance. The utilization of heterosis in Brassica crops mainly relies on two approaches: self-incompatible lines and male-sterile lines. In the mid-to-late 20th century, self-incompatible lines were dominant, while male-sterile lines have been widely used since the 21st century (Kitamoto et al., 2018). It is estimated that in recent years, over 80% of cabbage varieties are male-sterile.

[0003] Cytoplasmic male sterility (CMS) is a maternally inherited trait. CMS plants have normally developing pistils, but abnormal stamens that cannot produce viable pollen (Wang et al., 2020). Utilizing CMS allows for parental control, which is beneficial for intellectual property protection, and also ensures seed quality and purity. However, to date, no naturally occurring CMS has been found in Brassica oleracea crops, and the most widely used is Ogura CMS, introduced from radish through distant hybridization and asymmetric protoplast fusion (Yu et al., 2020).

[0004] Ogura CMS was first discovered in Japanese radish (Ogura, 1968). Bannerot et al. (1974) transferred radish Ogura CMS to cabbage through intergeneric hybridization by repeatedly open pollination combined with embryo rescue, obtaining the first generation of cabbage Ogura CMS material (Ogura CMSR1). Since the cytoplasm of Ogura CMSR1 is entirely derived from radish, it exhibits undesirable traits such as yellowing of seedlings at low temperatures (below 15°C) (Bannerot et al., 1977), low chlorophyll content (Rousselle, 1982), incomplete development of nectaries, or low nectar secretion (Mesquida & Renard, 1978). Walters et al. (1992) used a protoplast asymmetric fusion to obtain protoplast-fused plants of Ogura CMSR1 7642A and the cauliflower maintainer line NY3317. They successfully replaced the radish chloroplasts of Ogura CMSR1 with those of the maintainer line cauliflower, overcoming the problems of low-temperature yellowing and low chlorophyll content. This was subsequently transferred to cabbage to form OguraCMSR2. However, after several generations of backcrossing, the F1 hybrid vigor of Ogura CMSR2 weakened, with a higher number of deformed flowers and pods. It is speculated that these undesirable traits are due to the influence of mitochondrial genes from radish. In the 1990s, researchers modified the mitochondria of Ogura CMSR2 by asymmetric protoplast fusion of the broccoli inbred line BR206 and the male-sterile line Ogura CMS BR362, reducing the proportion of radish mitochondria while preserving the male-sterile trait (Cardi & Earle, 1997). The modified male-sterile source was then transferred to cabbage to obtain Ogura CMSR3, which exhibited no yellowing at low temperatures, normal plant vigor, and good flowering, fruiting, and combining abilities. Many excellent cabbage varieties have now been bred using this male-sterile source.

[0005] However, in recent years, breeders have discovered that Ogura CMSR3 suffers from severe bud death in the early flowering stage. Statistics show that the bud death rate on primary branches of Ogura CMSR3 reaches 30%, and on secondary branches, it reaches 50%. Furthermore, it is inferior to the dominant nuclear male-sterile source in terms of corolla diameter, bud diameter, nectary size, nectar quantity, and pod number, severely impacting the yield and quality of the hybrid (Wang Qingbiao et al., 2011). This phenomenon of poor performance of heterologous cytoplasmic male sterility obtained through distant hybridization or protoplast fusion has been observed in Solanaceae and other cruciferous crops (Sanchez-Puerta et al. 2015; Du et al. 2016; Kang et al. 2017; Arimura et al. 2018). Therefore, we speculate that although Ogura CMSR3 has undergone several improvements, its cytoplasm still retains many radish cytoplasmic components, and many undesirable traits may be due to the incoordination between heterologous cytoplasmic fragments and nuclear genes.

[0006] We used second-generation Illumina HiSeq combined with third-generation ONT sequencing technology to sequence and align the chloroplast and mitochondrial genomes of the cabbage Ogura CMSR3 cultivar CMSR302-12 and its maintainer line 02-12. We found that the mitochondrial genome of CMSR302-12 contains a 35,618 bp radish mitochondrial genome fragment, accounting for 13.84% of the mitochondrial DNA (mtDNA). Although high-throughput sequencing technology can accurately detect heterologous mitochondrial fragments in cabbage Ogura CMS materials, it suffers from drawbacks such as long sequencing cycles and high costs. Therefore, it is necessary to develop specific markers for heterologous mitochondrial fragments in cabbage Ogura CMS to rapidly and accurately identify the relative abundance of radish mitochondrial genome fragments in cabbage Ogura CMS materials, in order to better identify cytoplasmic male sterility sources in cabbage with lower heterologous cytoplasmic content. Summary of the Invention

[0007] The technical problem to be solved by this invention is how to rapidly, accurately and economically identify the presence, deletion and / or sequence of heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of cabbage (CMS).

[0008] To address the aforementioned technical problems, this invention provides a SCAR marker for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea, characterized in that it includes one or more or all of the markers AC1 to AC16; the nucleotide sequences of said AC1 to AC16 are shown in SEQ ID NO: 1 to 16.

[0009] The present invention also provides a primer set for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea, characterized in that it includes one or more or all of primer pairs AC1p to AC16p.

[0010] AC1p to AC16p are used to amplify heterologous radish mitochondrial fragments with nucleotide sequences as shown in SEQ ID NO: 1 to 16, respectively.

[0011] The sequence information of AC1p to AC16p is as follows:

[0012]

[0013]

[0014] The present invention also provides a kit for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of cabbage, characterized in that the kit contains the above-mentioned primer set.

[0015] Preferably, each primer in the primer set is individually packaged in liquid or powder form.

[0016] Preferably, the kit further includes universal reagents for PCR and / or gel electrophoresis.

[0017] The general reagents may include DNA polymerase, PCR buffer, TBE buffer, nucleic acid dyes, etc.

[0018] The application of the above-mentioned SCAR marker, primer set, or any of the above-mentioned kits in detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of cabbage is also within the scope of protection of this invention.

[0019] This invention also provides a method for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea, characterized by comprising:

[0020] a) Extract genomic DNA from samples of the Ogura cytoplasmic male sterile line of cabbage to be tested;

[0021] b) Using the genomic DNA as a template, perform PCR using the primer pairs described above;

[0022] c) Detect the PCR products to determine whether the genomic DNA of the sample contains the corresponding heterologous radish mitochondrial fragment or the sequence of the contained heterologous radish mitochondrial fragment.

[0023] Preferably, PCR products are detected by gel electrophoresis or sequencing.

[0024] The gel electrophoresis can be agarose gel electrophoresis.

[0025] After gel electrophoresis, if a characteristic band of the corresponding size amplified by the primer pair appears, the genomic DNA of the sample contains the corresponding heterologous radish mitochondrial fragment; if no characteristic band of the corresponding size amplified by the primer pair appears, the genomic DNA of the sample does not contain the corresponding heterologous radish mitochondrial fragment. Furthermore, the sequence of the heterologous radish mitochondrial fragment contained in the genomic DNA of the sample can be determined by sequencing.

[0026] Preferably, the PCR system comprises: 1 μL each of 10 μmol / L forward and reverse primers, 10 μL of 2×PCR Mix, 7 μL of ddH2O, and 1 μL of genomic DNA; the PCR program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 15–60 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min.

[0027] Preferably, the detection of heterologous radish mitochondrial fragments is performed during the seedling stage of the Ogura cytoplasmic male sterile line of the cabbage to be tested.

[0028] This invention successfully developed SCAR markers AC1-AC16 for rapid and accurate identification of heterologous radish mitochondrial fragments in Ogura cytoplasmic male sterile lines of Brassica oleracea, as well as primer pairs AC1p-AC16p for amplifying AC1-AC16. Experiments showed that AC1p-AC16p amplified the target fragments in both the Ogura CMS variety “CMSR302-12” and the radish variety “RFRs,” both of which contain a known 35,618 bp radish mitochondrial genome fragment, but no amplification products were found in the inbred line of Brassica oleracea variety “02-12,” which does not contain the radish mitochondrial genome fragment. Testing 96 Brassica oleracea inbred lines using AC1p-AC16p yielded no amplification products. Testing 8 Ogura cytoplasmic male sterile lines of Brassica oleracea using AC1p-AC16p amplified all 16 SCAR markers from 7 lines and 7 SCAR markers from 1 line. Therefore, the markers and primers of this invention have the advantages of high specificity and good stability.

[0029] The method employs primer pairs AC1p–AC16p for the assisted identification of heterologous radish mitochondrial fragments in Ogura cytoplasmic male sterile lines of Brassica oleracea. This procedure is simple and easy to perform, enabling rapid identification of radish mitochondrial genome fragments in target lines during the seedling stage. This allows for targeted seedling selection, transplanting, and hybridization. The method of this invention eliminates the need to wait for a lengthy plant growth period and is unaffected by environmental conditions and human factors, significantly shortening the breeding cycle of Brassica oleracea cytoplasmic male sterile lines, improving breeding efficiency, and reducing breeding costs. Attached Figure Description

[0030] Figure 1 This section shows the amplification results of primer pairs AC1p–AC16p in the OguraCMS variety of cabbage “CMSR302-12”, which is known to contain a 35,618 bp heterologous radish mitochondrial fragment. Lane M is a 2000 bp DNA marker; lanes 1–16 represent the amplification products of primer pairs AC1p–AC16p, with sizes of 737 bp, 564 bp, 790 bp, 898 bp, 587 bp, 729 bp, 988 bp, 789 bp, 774 bp, 779 bp, 788 bp, 669 bp, 897 bp, 902 bp, 1019 bp, and 967 bp, respectively.

[0031] Figure 2 This chart shows the amplification of primer pairs AC1p–AC16p in radish varieties “RFRs”, which are known to contain a 35,618 bp heterologous radish mitochondrial fragment. Lane M is a 2000 bp DNA marker; lanes 1–16 represent the amplification products of primer pairs AC1p–AC16p, with sizes of 737 bp, 564 bp, 790 bp, 898 bp, 587 bp, 729 bp, 988 bp, 789 bp, 774 bp, 779 bp, 788 bp, 669 bp, 897 bp, 902 bp, 1019 bp, and 967 bp, respectively.

[0032] Figure 3 This shows the amplification results of primer pairs AC1p-AC16p in the Ogura cytoplasmic male sterile line "J34" of Brassica napus. Lane M is a 5000bp DNA marker; lanes 1-16 show the amplification results of primer pairs AC1p-AC16p, respectively.

[0033] Figure 4 This shows the amplification results of primer pairs AC1p-AC16p in the Ogura cytoplasmic male sterile line "J35" of Brassica napus. Lane M is a 5000bp DNA marker; lanes 1-16 show the amplification results of primer pairs AC1p-AC16p, respectively.

[0034] Figure 5 This shows the amplification results of primer pairs AC1p-AC16p in the Ogura cytoplasmic male sterile line "2177" of Brassica napus. Lane M is a 5000bp DNA marker; lanes 1-16 show the amplification results of primer pairs AC1p-AC16p, respectively.

[0035] Figure 6This shows the amplification results of primer pairs AC1p-AC16p in the Ogura cytoplasmic male sterile line "2183" of Brassica napus. Lane M is a 5000bp DNA marker; lanes 1-16 show the amplification results of primer pairs AC1p-AC16p, respectively.

[0036] Figure 7 This shows the amplification results of primer pairs AC1p-AC16p in the Ogura cytoplasmic male sterile line of cabbage "2185". Lane M is a 5000bp DNA marker; lanes 1-16 show the amplification results of primer pairs AC1p-AC16p, respectively.

[0037] Figure 8 This shows the amplification results of primer pairs AC1p-AC16p in the Ogura cytoplasmic male sterile line "2186" of Brassica napus. Lane M is a 5000bp DNA marker; lanes 1-16 show the amplification results of primer pairs AC1p-AC16p, respectively.

[0038] Figure 9 This shows the amplification results of primer pairs AC1p-AC16p in the Ogura cytoplasmic male sterile line "2147" of Brassica napus. Lane M is a 5000bp DNA marker; lanes 1-16 show the amplification results of primer pairs AC1p-AC16p, respectively.

[0039] Figure 10 This shows the amplification results of primer pairs AC1p-AC16p in the Ogura cytoplasmic male sterile line of cabbage, "2202". Lane M is a 2000bp DNA marker; lanes 1-16 show the amplification results of primer pairs AC1p-AC16p, respectively.

[0040] The DNA bands of the 2000bp DNA Marker are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0041] The DNA bands of the 5000bp DNA Marker are as follows: 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Detailed Implementation

[0042] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. It should be noted that the following embodiments are only some embodiments of the present invention, not all embodiments; and the following embodiments are only used to explain and illustrate the technical solution of the present invention, and are not intended to limit the scope of the present invention.

[0043] The biomaterials used in the following examples:

[0044] The cabbage “CMSR302-12” is a known cabbage Ogura CMS variety, which has been published in non-patent literature (Wang Qingbiao, Study on flowering and fruiting traits and heterologous cytoplasmic molecular differences in two types of male sterile cabbage lines, Master’s thesis of Chinese Academy of Agricultural Sciences, 2010).

[0045] The cabbage "02-12" is a known inbred line variety of cabbage, which has been published in non-patent literature (Wang Qingbiao, Study on flowering and fruiting traits and heterologous cytoplasmic molecular differences of two types of male sterile cabbage lines, Master's thesis of Chinese Academy of Agricultural Sciences, 2010).

[0046] Radish “RFRs” are known radish varieties and have been disclosed in non-patent literature (Ren Wenjing, Creation and Utilization of High Generation Backcross OguraCMS Fertility Restoring Material of Cabbage, Master's Thesis of Chinese Academy of Agricultural Sciences, 2021).

[0047] 96 inbred lines of cabbage: These are high-generation inbred lines of cabbage, created by our laboratory, and have been published in non-patent literature (Li Zhiyuan, KASP markers for the construction of fingerprint patterns and the identification of heterosis groups in cabbage, Master's thesis of Chinese Academy of Agricultural Sciences, 2018), see Chapter 2, 2.1.1 Test Materials.

[0048] Eight Ogura cytoplasmic male sterile lines of cabbage, namely “J34”, “J35”, “2177”, “2183”, “2185”, “2186”, “2147”, and “2202”, were all created in our laboratory and have been published in non-patent literature (Ren Wenjing, Creation and Utilization of High Generation Backcross OguraCMS Fertility Restoration Materials of Cabbage, Master's Thesis of Chinese Academy of Agricultural Sciences, 2021).

[0049] The above biological materials can be obtained from the Cabbage and Broccoli Research Group of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences.

[0050] The main reagents used in the following examples :

[0051] 2×Rapid Taq Master Mix, purchased from Nanjing Novizan Biotechnology Co., Ltd., product catalog number: P222-03.

[0052] Unless otherwise specified, all reagents used in the following examples are conventional reagents in the art, commercially available or prepared according to conventional methods in the art, and of laboratory purity. Unless otherwise specified, all experimental methods and conditions used in the following examples are conventional experimental methods and conditions in the art, and can be found in relevant experimental manuals, public literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0053] Example 1. Development of SCAR markers for detecting heterologous radish mitochondrial fragments in Ogura cytoplasmic male sterile cabbage lines

[0054] We used second-generation Illumina HiSeq combined with third-generation ONT sequencing technology to sequence and align the chloroplast and mitochondrial genomes of the Ogura CMS cabbage variety “CMSR302-12” and its maintainer line “02-12”. We found that the mitochondrial genome of CMSR302-12 contains a 35,618 bp radish mitochondrial genome fragment, accounting for 13.84% of the mitochondrial DNA (mtDNA). We then developed SCAR markers and designed primers targeting the heterologous radish mitochondrial sequence in the Ogura cytoplasmic male sterile cabbage line. Primers were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. We screened SCAR markers and primers using the known Ogura inbred line “02-12” (which does not contain the heterologous radish mitochondrial fragment) and the known Ogura CMS cabbage variety “CMSR302-12” and radish varieties “RFRs” (which contain the 35,618 bp heterologous radish mitochondrial fragment). The screening method is as follows:

[0055] Genomic DNA was extracted from leaves of three cabbage inbred lines: “02-12”, “CMSR302-12” (Ogura CMS), and “RFRs” (radish). The CTAB (hexadecyl trimethyl ammonium bromide) method was used. The genomic DNA extraction method is described in Murray MG and Thompson WF (1980), *Rapid isolation of high molecular weight plant DNA*. *Nucleic Acids Res 8*: 4321-4325. Using the genomic DNA as a template, PCR reactions were performed using the designed primers according to the following system and procedure.

[0056] PCR system (20 μL): 1 μL each of 10 μmol / L forward and reverse primers, 10 μL of 2×Rapid Taq Master Mix, 1 μL of genomic DNA, and 7 μL of ddH2O.

[0057] PCR program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min.

[0058] The PCR products were detected by electrophoresis using a 1% agarose gel at a constant voltage of 150V for 15 minutes, and photographed using a UV gel imaging system.

[0059] Sixteen specific SCAR markers, AC1–AC16, were ultimately selected for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea. Their details are shown in Table 1. These 16 SCAR markers were evenly distributed on the 35 kb heterologous radish mitochondrial fragment. The primer pairs used to amplify AC1–AC16 were AC1p–AC16p, and their sequence information is shown in Table 2. These 16 primer pairs amplified the target bands in plants possessing the heterologous radish mitochondrial fragment, but no amplification products were found in plants lacking the heterologous radish mitochondrial fragment.

[0060] Table 1. SCAR markers used to detect heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea.

[0061]

[0062]

[0063] Table 2. Primer pairs used to detect heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea.

[0064] AC1p GCAGGAATGCTGCACACTCTG GGACGTTCAGATTGCATACCAT AC2p CATGAATTAGAATAAAGTAAGGGAG CGCTTTTAGCAGTCTTCCGAAAT AC3p GCAGATTGAAGCATGATTGG GCAGAACTCCTAAGATTCCTTC AC4p TCAGACAGTCTTTTATGCCCTC TAAGATCATACTTGGTCGGGAA AC5p TAGTCTATGTGCCAGTTCAAATCT TAGAACCCATAGGCACCGGACT AC6p TGTGACAAAAGTGATTGGGATG CTTACTAGCCCACGGAACTCAT AC7p AGTCCTGACCTTCGTTACTAGAGC CCTTGACTTTCGTGTGTGTGCGTA AC8p GCATCTCCCACTCGCTTACTG CATCCACTAAACTTCTCAACGG AC9p TTGAGTTTCAGTGGCATAGGAC GGATTAGAATCAGTTCGGCGT AC1op GCGTCTGAATACCACTGTCCTC CAGAACATCCACCTACTTACGG AC11p TGAAAAAATCCACCCCCTAAC AAGATAAAACAGAGACGGAACC AC12p GAGTCCATACAGGGCTACACG ACCCGAGAGTTATTTTGGCTG AC13p TACCGAGGCTGATTGGTTTC CTTCAAGACCCAACCAGTACC AC14p CCATTCGCCCAGTCTATAAAC ATACCAGGAGGCGAACTATCTA AC15p GCTAGTTTAGAGTTCCTATCCTAGC TTGGTTGATTCATTTTCTTCCTG AC16p CTCTTTCTCTGTCTGACGCTCG CGTATTTAGAAGCCTGCTACCG

[0065] The results showed that primer pairs AC1p-AC16p produced no amplification products in the cabbage variety "02-12" which did not contain the heterologous radish mitochondrial fragment, but produced no amplification products in the cabbage Ogura CMS variety "CMSR302-12" which did contain the heterologous radish mitochondrial fragment. Figure 1 ) and radish varieties "RFRs" ( Figure 2The target fragment of the corresponding size was amplified in all samples. Furthermore, using primer pairs AC1p–AC16p, we tested 96 Brassica rapa inbred lines preserved in our research group using the same method, and no amplification products were found. Therefore, primer pairs AC1p–AC16p do not exhibit non-specific amplification in the Brassica rapa genome. The SCAR marker developed in this invention has strong specificity for heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica rapa.

[0066] Example 2. Identification of heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica napus using SCAR markers.

[0067] Genomic DNA was extracted from the seedlings of the cabbage materials to be tested using the CTAB method. Using primer pair AC1p-AC16p, PCR was performed using genomic DNA from the cabbage inbred line “02-12” (negative control), the radish variety “RFRs” (positive control), and eight cabbage Ogura cytoplasmic male sterile lines (“J34”, “J35”, “2177”, “2183”, “2185”, “2186”, “2147”, and “2202”) as templates, according to the following system and procedure.

[0068] PCR system (20 μL): 1 μL each of 10 μmol / L forward and reverse primers, 10 μL of 2×Rapid Taq Master Mix, 1 μL of genomic DNA, and 7 μL of ddH2O.

[0069] PCR program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min.

[0070] After the reaction, the PCR products were detected by 1% agarose gel electrophoresis at a constant voltage of 150V for 15 minutes, and photographed using a UV gel imaging system.

[0071] like Figures 3-9 As shown, primer pairs AC1p–AC16p amplified all 16 SCAR markers in seven Ogura cytoplasmic male sterile cabbage lines: “J34”, “J35”, “2177”, “2183”, “2185”, “2186”, and “2147”, indicating that they all contained a 35 kb heterologous radish mitochondrial fragment. Figure 10As shown, primer pairs AC1p–AC16p amplified only 7 SCAR markers in the Brassica oleracea Ogura cytoplasmic male sterile line “2202”, indicating that the heterologous radish mitochondrial fragments contained in this material are much smaller than 35 kb. Primer pairs AC1p–AC16p produced no amplification products in the Brassica oleracea inbred line variety “02-12”, but amplified all 16 SCAR markers in the radish variety “RFRs”. The PCR products from the eight Brassica oleracea Ogura cytoplasmic male sterile lines were sequenced, and the sequencing results were then compared with the nucleotide sequences of SCAR markers AC1–AC16, revealing 100% sequence identity between the PCR products and the SCAR markers.

[0072] Example 3. Preparation of a kit for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea.

[0073] 1. Reagent kit assembly

[0074] Package each primer (liquid or powder) from AC1p to AC16p (Table 2) individually and label it. Then, pack it into the kit along with the general PCR reagent and / or general electrophoresis reagent and the kit instructions. Label the kit casing.

[0075] 2. Kit Instructions

[0076] Detect heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of cabbage using the following steps:

[0077] (1) Genomic DNA was extracted from the Ogura cytoplasmic male sterile line of the cabbage to be tested;

[0078] (2) Using the genomic DNA as a template, PCR was performed using primer pairs AC1p to AC16p respectively;

[0079] The PCR system consisted of: 1 μL each of 10 μmol / L forward and reverse primers, 10 μL of 2×Rapid Taq Master Mix, 1 μL of genomic DNA, and 7 μL of ddH2O.

[0080] The PCR program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min.

[0081] (3) The PCR products were detected by agarose gel electrophoresis. If a characteristic band of the corresponding size of the primer pair amplification appeared (see Table 1), the genomic DNA of the sample contained the corresponding heterologous radish mitochondrial fragment; if no characteristic band of the corresponding size of the primer pair amplification appeared, the genomic DNA of the sample did not contain the corresponding heterologous radish mitochondrial fragment.

[0082] SCAR marker nucleotide sequences AC1–AC16

[0083] SEQ ID NO: 1

[0084] SCAR marker AC1 (737 bp) used to detect heterologous radish mitochondrial fragments in cytoplasmic male-sterile lines of Brassica napus.

[0085] GCAGGAATGCTGCACACTCTGCCGCAAAAGGGGACCACTTTCTTCCCCCGAAAAATGCCAATGCCAACATCAGGGCCCAGCAAGCGGCATAATGATGTTCCGATTCCAGCAACAGTAGTATATGGTTCAAAACGCCTTGTTCCATCCGGCGCGAATCCCCTCCATCACTAGTAAAGTGGAGGTGTTATTTGTATTGCAATAATGAATCAATGTACGAACACAAATAATGAGCAGACCTGCCCACTTTTCTATGTGGATTCATTTCATAATATATTATTTTTTGAATAAAGAAGCGCGCCCCTGTTAGTGTAACGTAGGTGTCTTTCTCGGTTGATGGATGGGATAAATGCCTATATCGCTTTGTAATGTTATTGTCATGTTGATGCTATTGCTATTATAAAGAATATAATCTTCTTTGCTTTAGTCCCATTCTTTATAATTGTCTTTCTCGTACTGTGTAAACGAACTTCAAGTCTTAATTGTGTACTCCCAGGAAGCGTCACAGCCTAGGTTTGGGCCACCTCCGATGTCGATCTGCAGTAAGAGTTTGTTTTCGAAAGTCGTTTTCCGAGGTAGGTTCTATTTTCACCTAGAGCGATTTGCCTGCGTCTTTCTAGGCTATAGTTTACCTGTATCATGCAAATGTCCAACACTTAGTTTCTAAGATCATCCTATATGAAAGATGTATGACATGTGTGGATAATGAATGACTTGCATGGTATGCAATCTGAACGTCC

[0086] SEQ ID NO: 2

[0087] SCAR marker AC2 (564bp) for detecting heterologous radish mitochondrial fragments in cabbage cytoplasmic male sterile lines

[0088] CATGAATTAGAATAAAGTAAGGGAGCACACCGATCGAAACCTGTTTACTTTCGAAAGTTGACCCGCCACCTACTACTTGTAGTCAACCAAAATTGCTTCGCTAGGAGTGTGCTATTAAAAGCTGTTGATCGGCCTATGGCACTTTACTAAACCTAGGAGAGGAGAACTGCTACTATCTATTGCATGGGTGCCTGCGTGTAAGAGGTGTAAGAGAAAGAAAGAAATTTCCGTCAACAGGATGAATCCCAGCGAAAAGAAGGCGGAAAGCCTATGAAAGGTGGAAAGCCCTAGCGGAGCAATCTTAAAGATGGAAAGCTCTTAAAGGTGGAAAGCCAGCACAAGCACACTACTGTGAAAGCTAAGAGTACTTCTATATTAGGAATTTTGCTAGTGGCGGATACGTACTATCTTCTTTATATTGACATTCTGCTACCCGGGAATCCAGTTCGTAAAACTCGGAGATATCAAACGGAAGTAAAAAAAAGCAGAGAAGGATTAAGACTAACCACTTTTTCGACATCCCTTCATGAAGCGCAGCAACATTTCGGAAGACTGCTAAAAGCG

[0089] SEQ ID NO: 3

[0090] SCAR marker AC3 (790bp) for detecting heterologous radish mitochondrial fragments in cabbage cytoplasmic male sterile lines

[0091] GCAGATTGAAGCATGATTGGGCTCTCCGCTTCTCTTCAGATGGAACTTCGCCATGTCCATGTCCCTCGAGTACTGTTCCTAGAGTATAGTAGAGTACGGATCGATTGAACTGGTTTCTGTCGTACCCCTAACGGTACAGTTATGACCTAATGCGGGGTCTCTCTCAGGCAGAAGATCAACCGATGTACGATGTTGGACCTAATGAGAGGTCCTTCTCTGTCAGGGTTTATAGGTCAACTGGTTGCTTCGCTAGAGTAGGACCTAACCCATGTACTGTGAGTGTTGATTAGTCACCCTGATATCGAGTGAGCATTCGGGGGTGTAGACTTCACACTTTAACAGGTCATCTGTCTTTCGAAGTTTTCTGTAACACAGAGATGTAGTTGCAAGGCAAAGGTCAACTAGCTTGCTTCGCTAGGTTGCTTCGCTAGGGACTTAAGGAGAAGTGATTTTCTGTAGCACAGAGATGACTTTAGTAAGTTGCAAGGCGAAGGCCTCAACGATTGTGGTTAATCTATCTTGGTATCTTTGTGATGAGGTATGGCTTATCTGTGCTGGGGTGTGCTTGGGAGTCAAATGCTAGGGTCATGCGAAAAGTCCTATTTCCAATTCCGATCTCATATCTAAGGAACGGGAGTTCTTAACAGAAGAAAGGCCATAGACTCCGTTTGGTACGTATCTGATATGTGACAAATCCTAAATCTGCAAGGTATCTTATCTCTCTCAGTTATTAATATGGTGCTGGACTAGCGAAGCAACCCTTTTGAAGAAGGAATCTTAGGAGTTCTGC

[0092] SEQ ID NO: 4

[0093] SCAR marker AC4 (898 bp) for detecting heterologous radish mitochondrial fragments in cabbage cytoplasmic male sterile lines

[0094] TCAGACAGTCTTTTATGCCCTCTTTTAGGTTTGTTTTTTCCTTCCCCCAATTCTAGGATGCGTAGTAGCTCTAGTAAGTCCGTAGCTGGATCTGGCAGGATGCGGAGTTTGAGCTGCGGGGTGAGGGATGGGATAGACATAGCCATCTCTCCCTTCTCCGGCTCTTCTCTTATGGTCTCTAATGATGGCTTATCCACTACTACTTGCTTCCTTCCCTTTATCCTTCCTCACAACAACTTGCTCCTCTTCCTTATCATCTCTCACAACTGCCTCAATCAGTTTCCCTTTCTTCCCAGGTGCGCTTGATTGGGAAGAAAGATCTGGGGTGGGGAATCTATCAACTTGCAGCAGCCCCAGTCTTCCTTCTCCTTTGAGCACCGGCTTTTAATGGGTATGAAAGAACTAGATGGGAGGCCTTTTCCGGGTAAGAGAAATAGTAGTGAGAGGTAGTGAAAGCCCTTTCGTCCTTTATAACTAGTACATTTTATCGTGTAGATAACAGAGGCAAGCAGGACAGACGATCAATCCCTCTTCTAGTAATGGCACCACTCTTCTTAGGTTAGAACCCATTCCCATTGGCTTCCTACAGGTATAGTGAGATGTACAGGAAGACGGAGACCTTTTGAATTATAGACGACTAGTAGTGCGAAGCAATTCCATCCGATTTTCGAGAAAGAAAAGAGTGAGTTAGCTTATTTTTACGTCGGATGAAAGAGATAATTCTAACTAGCCGGAGACAGAGATATAGAAAGTTTGCAGTGCGGTATCGCCCATGACCTTCTGCGAGAGTGAGATAGAAAGCTGGAAGGTTGGATTGAATCGGATTATCCATTGAGCTAGTCCGTTTTCCTAGTAATGTAAAAAAATAACAAAAGATTCCCGACCAAGTATGATCTTA

[0095] SEQ ID NO:5

[0096] The SCAR marker AC5 (587 bp) was used to detect heterologous radish mitochondrial fragments in a cytoplasmic male-sterile line of Brassica napus.

[0097] TAGTCTATGTGCCAGTTCAAATCTGTGGCGAGTCGCTCACCCGCCTACGATTGATTGGAGACTTATTCAATAGGTCCTCCTTCCCGAATTCTAGGGCGTCTAGCTTAGATCGCATTTGATTTCCCTTACTCTTGAATAGTGAAAGA TTGAGCTCCTTCGGACCCTCTTCTAAGAAATGATAGGTAAAGCGCTCTAACCGGGGGCTCAATTTTCCTTCAAACTGACTTTGTCTTTTCCTTTGCTTCTTTATCCATCCAAGCATTGAGTGATCAAAGAATCTCTCCTTGAAGCT CAATGTACCCTCCTTCCTCATAGAAATGGTCCCTATACTATAGTAGGAATAGTCTCTATTCTATTCTGCTTGGAGCTGCCCTACATAGGATAAAGGAGGGGGAGCGACTTCTTTTTCTTTCTTTTTTGAGCTCTCACCTTTAGCCGAT CTTATTCAATGGATTGTGACTTTCTCAGCTTTAGTTTTCTATCGAATTTCCATTTGGGCTCATTGGACTCTTCTATCTAAGCTTGAGCCCGAAGCGAGTGAAACTCGTCCTTCATTTCATACCTCAGTCCGGTGCCTATGGGTTCTA

[0098] SEQ ID NO: 6

[0099] The SCAR marker AC6 (729 bp) was used to detect heterologous radish mitochondrial fragments in a cytoplasmic male-sterile line of Brassica napus.

[0100] TGTGACAAAAGTGATTGGGATGCCCATCTTTGGTCCAGAAGGGGTTCTCCATGAAAAGAGTTTCCACCTTTCTCTACTCGAGAAGCCCTATCTAAAAGGGCTTGTCTGGATGAATGCAGTGTCGGAAGCCGTGATCACATAGTAACTTCCGCCCACAGTGCTATTACGACGGCAGGTCACCGGGAGTGAAGTAAACTCGGCTCCTGATGTAGCATTCATTCGGACCATTCGACGTTTGATTCTTTTTATCAGGGATACCGATGACTCTGTGAGAGGTGTTCCTCGGCCAAGTTTCCCATGACGGGTTACCCGGTTCAAGGCTTTTCTATATAATGAGAAATACTACTTTCTTTCTAGCTTAAGTGTTCACGTAGGTAAAATAGCTTCTATAGCTCCATCCAATAGTAATCAACGGAGATAATAGAGTCCAGCGGTTCAACCAACGCTTCTAAGGAGAGCGGGGCAAGCAAGAAAGCAGGCAAAGTCATTGAGCCTATTCTATTCCGAAAGTTCAACTGCTGGATAAACAACGAAAGCCGTCGGCATTCTTCTCCTACTGTAGCTGCTACAATTGCTTTAGCGCGAGCAGCAAGGAGGAGGCAGCTCTTACTAAAAAAGCAAAAAGGGAAGGGCATGACAGAAGGGAGATAGACCTCCTATTAAGCATTACTCTCTTTTGAGGTAACTTACTTGCTTACTCTGATATGATGAGTTCCGTGGGCTAGTAAG

[0101] SEQ ID NO: 7

[0102] SCAR marker AC7 (988 bp) for detecting heterologous radish mitochondrial fragments in cabbage cytoplasmic male sterile lines

[0103] AGTCCTGACCTTCGTTACTAGAGCACAGAAAAAGCAACAGTGTGCTGTACAGAGAACTTGCTTCGATAGGAAAAGAAAAGCTGTATTTCTAAGCTGGGAATGTTGGGTAAGAGTCCGCCTATTACCTCTAAAAAGTGGAGGAGGTGAGATCCCTGTTGGAGTCAACTTTTGAATTTACCGGCTTTGGAGAAACCTTTTCAGTTGCTTAGTGCGAATCCCACGTTTCGAGGGTGGGTAAGGTCTCAGTACCTCGGATATAGCACAGAAAGGCCTATAGCATCCAATACCACTTTTCAGGTTACTTCCTTGTGAGCTTGTCAGACAAAGTAGGCGACGGTGTGCTGCACTACATCTCCTCAGCAGTTGATCGGTCAGGTTCCTTGCCTTGCTTAACCCAGCTCGAGTATTATTCGAAACGAGGAATATCCTTACTCTAGAAGCTCAGAGTTAAGAGTTAAGGGAAGGTGTTAGCTAAGGAATTAGGTCTTCCTCTTCGAAAGGAGAACTCTAGTCTACCGTGGTGGGTAGTAGCTACTCCCAGTACATCTATCATCCGTGACATCCATGGCAACTACTACTTTTCATTGCTGTGCTGTTTAATCGATCGAACAAAACTCCTAAGGTAGAGATCTTAAGAAGAGGACGAGCTCAACTCCCGATTGTTCAAGCTTAGATACCTCTTTGATTTGGGATTGACGAAACAGTATAAACCTTTCTAATAGGCCTATTTTGTGCGTTTAATCACCTTTCTTTCATCTCTGAGCCAGCTATCCTTTCAGAATAGGGCTTTCCGCTTTCTTTTAAGGTGAGGAATCTTAGGAGTTCAGCTTTTTCGATTAAACGAAGAATTCTGTCATTTCAGATGGGATTCCAAAGCAAGGCTAGTTATCTATGTTAGCTTCATTCCTGTGAAGTTGGTTTCTAGTTTTGATCTTTGAGTTGGCAGTAACATGACTAGCAGCATAGTACGCACACACGAAAGTCAAGG

[0104] SEQ ID NO: 8

[0105] SCAR marker AC8 (789 bp) for detecting exogenous radish mitochondrial fragment in cabbage cytoplasmic male sterile line

[0106] GCATCTCCCACTCGCTTACTGGCAGAAGGTCTGCAAGCCTAGCCCCTTCTCTTTATCGAGGGCAACTCATGCTTATAGGGCACTCCCGGGATGGAACCAGCGATAATTACTTCCACTCAAAGGGATCGGATTATGAACCACTCCTAGCTGCTTTCTTTCAAACCTTTCCATCTGAAGTTGATTCTATAGGTGCAGTTGCAGTTCTAGCTCTTTCTTTAGTTGCTGGAGATGTAATACGACTAGCATCAAGCCTTCCTTCTTCAGTAATAGTTCCAGTGGAGGAAGAAGAAGAGCAGATCGCTTTAGACTGCCTCCCTTACTAAACAAGATAGGCTCGCTTCATCTGAGCCGTCGCCCCTTTCAATAGGTGTAGGCATCGGGCCGATTCTCCTTTGCCTATCTTCCTGCTCTGCCAGTATACCTCCTTGCAAACCTCCCTTCCCTTAGCTTTCAATCTGTCTTGTGCCACTCCAGCTTTCACTCAAGCCATTCTTTGAACATACTTTATAGGGGCGACCTTCACTCTTCTTCTCGCTTCCTAACCCTAAAAGCTCACTTCTTTTGGTGTTGCTCCACGATCTTAAAGTGGAACTACGAGATAAATAAGCGGCGGGCTGATCTGACCTGCGCGTCTGCCTTCCTTTCGTCACTACGACTTGGTTTCGAAAGAAGGAATGAGCGCTAGCCTAGCTAACTAGCATACCTTTCCTTGCCTCTTGCTCCGTAAAATGCTATCACATTTTGATTCCAATCATCTCATCTTTGTCCCGTTGAGAAGTTTAGTGGATG

[0107] SEQ ID NO: 9

[0108] The SCAR marker AC9 (774 bp) was used to detect heterologous radish mitochondrial fragments in a cytoplasmic male-sterile line of Brassica napus.

[0109] TTGAGTTTCAGTGGCATAGGACCTTCGATCAACCATGGGGCGGAGGAACCTAGCTTCTTCAGCGAAGCTGGAAGAACCCCTCTGTTGAATCTATCTCTCCGTTCGATGGGAATTCCTAGGCATGGTGGGATCAGTTGGTAGCTTCCAGTCTGATTCCTGGGATTGCATGGCGAAGCGGAGGAACCCCTTACTT CGTTCATCTATTGAAGCGTAACGTAAAAAGCTCTTTCTCATGTTGCATTTCTTTGGTTTTGATTGAATTGGAAGAACTCTTCTTTTCTCATCCAGGATGAAGACTTCGATGTCAAATCCACCGTTCCAACGAGACAACTCTCCACCGCTAGTGAATAAGTTTATCGATCTCAGGTCAGGCTGAGCTGTAGCAC TGATCGTTGAGTGATCACATAGCTGACGTCAACAGATCTTTTCCTTTTGTTTGGGAACCCTCTTTCGACTCCCCTAAAACGGTTTTGTTTCTACGACTACTTTCCTTACTGAACTGCTCACTGGAACTACTTGACCTTCACTTACTAAAGCGGGACAACAAAGCAGGAGGTCCGAAGGACTGTGTTCAAAGGT TGGATTGCCTTCTCCTTGGTACTCTATCTTTAGTAAGGAGGGATCTTCCAACTCGGCAATTCTCCGAGTCATTGGATGGAAAAGAATAGTTCCTTCTGTCTTTCCCAACTAAGCTTGTTAAAAGCCTTTATTAAGTTTAGTAAGGACTTCTTACGAACCGACTTCCCGGAACGCCGAACTGATTCTAATCC

[0110] SEQ ID NO: 10

[0111] The SCAR marker AC10 (779 bp) was used to detect heterologous radish mitochondrial fragments in a cytoplasmic male-sterile line of Brassica napus.

[0112] GCGTCTGAATACCACTGTCCTCGGAAGGTAGAAGTCCCAGGTACCTATCCGCTTCTTCTTTTCTGACCTCGATACATCCGTCGTGTAAAACCATCAAAAGGTTAAGGAAGATCTACCGACCCGTGTCCGTACGAGGGTTCGGCCCTTGAAAGTCCTTCTATCTTTCTTACAACAACAGAAGTGATAGCAGGCGCTTTATACCCACCTAGATCAACAAACTCTTTTACAGCAAGCCCTCGTCCTTACTCATCTGCTTGACTCGACTTTCTTCTAGTATGGGAAGGAAGGCCGCTACTCACTTCCATTTCTCCGTCATAGCTATAAGGATGTTTCCTGGCCATACCCTTACCAATACCCTTTCCTGGTCGAGATAGCCCGGGTGAGGAACACTTGAATTACCTTTCGGTGAGTGGCTTTTTCCTTCCTTTACAGGGATTGACCTTTCTTACGAATCAGACACTTCACTTTCTTACCCTGAGGAATCAAAGACTTCTCTTTCTACGTTAGCACACCTATCAGCCTTCCGCTCCTCCACCATCTTCATCGGAGTCTCCTCGGGGGTATAGAGGTCGTGCTGTTCCTTGAGCTAGGCAGTTGGGGCTGCCATTCCAGCAAAGTACTCATCTCAGTTGGGACTGCCATCCTAGTGTATAGCCTGACTTCTACCCTACACCTTGAAGCTACACCTGTAGCCTCCCTTCCATTGGACACATTAGCGGATTCGGTTAATCTAAGGAAGAGATAAGTGAGGGGCGGACCGTAAGTAGGTGGATGTTCTG

[0113] SEQ ID NO: 11

[0114] SCAR marker AC11 (788bp) for detecting heterologous radish mitochondrial fragments in cabbage cytoplasmic male sterile lines

[0115] TGAAAAAATCCACCCCCTAACTAGACTATAGAAGATCTTCTCGTTTTGGCTAAACGGATCTTCCCTGTACTGTAACAGGGTCAACACCGCCTTTTGAGGTTGGTGTCCGAGCTTTCCGCCCAGCTTTCTTCGATCGTATGCCACGAACTATGTCTTAGATACGTAAGGGCCCCTGTCCAAGTTTGGCTTTCTTAGTACATTGCCTTTGTACTGGAAGCTGGATCATACGAACCAGCAATGGCCTGAAGCTTTCTTGCAGCAAGATGATCAGTCCGAGAGTGCTGGGTATTCATCTCTAGCTTTTACAATGGTTATTTCATTTGCCGGATATTCACCAAAAGAAAGTGCTCGCTAGCCATAAGCGGAATGACTTTCTTGATATGGACCGATCGAAGCCCTTAAGGATAGCTTACTATGGTAAATAGCTAGACCCCGAACCTATTCCCAGTTTCCGAGTAACTATCATTGGTCAGTTTCCTGTTTCCTATGGTCTATCATTGGTCCGGTCCTTCAGAGGCAGGAGAAGTACAAGATGCAAGCTCATAAACGAGACAGTAGGATGGCGCTAATGCCAGTCGATCATTCGACTTCGGCTAATGGAAAGTGGAACTTAGAAATAGCTTCTTAAGAAACAGATATATAGTAGTGCTTCCCCCTCCTTAGAATGGTAATGGTTCGTTCTTCGCCAGGATCATCTCCAGGTAGTGCTGCTCCGTCTTCGCCTTGACCTTGTGCTGGCCGCTTTTGTACAGCATGAAGGGGGGAAGGTTCCGTCTCTGTTTTATCTT

[0116] SEQ ID NO: 12

[0117] SCAR marker AC12 (669 bp) for detecting heterologous radish mitochondrial fragments in cabbage cytoplasmic male sterile lines

[0118] GAGTCCATACAGGGCTACACGTGGCGAAGCGTATTTGGGCGGCGTTTTCTCGATTGCTTTCCAACTGGAATGAAAATCTTCTTATATACGTATTATTCCAAGGAGGATCAACATCCCATTCCATTACAAATGGTTAAACAGCTATCCCTTACCATACATCTCTTCCCGCTACGCGCCTCACAGCCGGTATTGGCCCTTGCTGTGCTCCCCCTGGAACTGTAGTTCACTCCCGTAGGGAGCTGCAGCTATCCTCCCAACAATCAACTACCCAATCTTGTTGCTAATGTGCATGAAGTTGAAGCAGGTGTTGCGAAGCTGCCCTGCTGCTTTGATTGCGTAGCTACCTCCCGCAGGGAAATGCAGCTAACTCCTTAAAAAGAGTAAACAGTTTGTTAGTAGGTATGAGTTGCAAGGAAGTGTTGCGTAGCTGCCCGGCTCCTTAATAAGCACGGGAACCCTCCCGCAGGGAGCTGTAGCTAGCTCCTTATTAACAACTCCCTTGCTTGTTTTGCCTAAGCATGAGTAGTTCAGTTCGAAAATGGATCCTCAATAAAAAAAATGGAATATCTGTGCGGATATGTTCAGCTTTGGGTGGAAAGGTAAGGAATTTGACTCCGACTAAGATTATTGTCCATGGTGTAACAGACACAGCCAAAATAACTCTCGGGT

[0119] SEQ ID NO: 13

[0120] SCAR marker AC13 (897bp) for detecting exogenous radish mitochondrial fragment in cabbage cytoplasmic male sterile line

[0121] TACCGAGGCTGATTGGTTTCCTTTGCCATCGCATCTGCCCCTCGTCGTAGCCTCTGTTTAAGCTCTTCCCAACTGTTTGGTGGATCTCTATCCCTCAGTTCCGAAATCCAAATCCCTGTTGGTCCCTCGAGACAGAGGTACACAACCGGCTCTCTCTGATTCTCTTGGATGTGATACTCCCAGAAATATGATTCCAGATGGTTGATCCATTTTTCCAGGACTGTCCCTGAGCAGCCCGAAATCTTATACCCAGTATTCACTCTCCTGTCTCGTTCTCTACCAGCTGAGAGGGATCCTTATTACTCCATGTAATCCTGTTCTGTGAAGCTAACTGTCTCCATTCTGCTATCACCCCTGTGTTTCGAATCCGTTTGTCTCCACCAGACCTGTTCAGGAGGTCAGTTTCTTCCCAAGCTCTATCAGATCTGGTCCAGTCCATGGCTCCTCTTTCGAGCCAGCTCTCTCCGCCTGAATCGAGACATCAAACCCATGACGGAGTGTCGGATCTCGGGATGGAGTTCTAGAATCCACCGACGCAGTAGGGGATCTAGATTACCATGTTTCACAAATGGTCGTGCCACTTCAGCACCGAGTGATCTGAGAGAAGAGGAGTCCGAGCCCTTTCCTAGAATGCAAACTTTCTCTTTATATATCAGGAAAAGTTAGCAATCCTATTTTCCTTCGTAAGAGGACAGTAGGAATCCAAACCTTTCCTTTCTAGAACGGAAGGCACCAGTCTTAACGGTAAACGTCGGCAGAAGTGAAAGTGATCCCGGGCAAGGGGGAGCAGCTTTCCAGATCTAAATACGAAGAGAATGCAGCTATGCTACTACGATTCCATAGAGTTGCACGGAAATGGGACCATAAGAAAGGTTCGGTACTGGTTGGGTCTTGAAG

[0122] SEQ ID NO:14

[0123] SCAR Marker AC14 (902bp) for Detecting Exogenous Radish Mitochondrial Fragments in Cabbage Cytoplasmic Male Sterile Lines

[0124] CCATTCGCCCAGTCTATAAACTCAGTGGATAGAGTAGATCAGTGAGATCCGACCATCTTCCACGCCCTCATCCACTAGGCCAACTCCAGTCTCAGATTAACTCGGAACTACTTTCCTTATTCTGGTCAAACTCTCTATTGGGAAAAAACAACCTTTGTGACAAGTGGTCAAAAGAAGAGAATATAGAGACCTTGATGAGCTGACGCAGGCTCTTACGTCCATTCCTGATAAGGAATAGGATAAGGACTTTAGGAACCAACATAGCTTCATCTCAATGAAGAACATTCCCAGAACGAGATGAGAAAGAGATCGTACCAATGTCTGAAATAGAGAGTGGGGTGTGGTTACCGGCTTCGCGAGCCCATATAGGACTACTCTTGGCTAAGCAACTTTGGGCGGTGGTTTATCGATTGCTTTCTAACTGGAATGAGAATCTTCTTATATATCTATTTTTATGTGAGGATATCTAATGTACTCCTACTCGGTAACTGTTATTCTTTCTCTAACGAATAAGAGTTCCACATTCTTACTTAAAGTCTATTTAGAGTTCGCGGAAAAGAGGCACTCGGGGATATTCACTGCCTGTCATCTTGTGTGGTATAGCCAAATTCCTTCTGTCTTCGAATTTTTAAGAGAGCCGTTTCCTTGATATAACCCGAATTAGCTTGCTTTTTGCCGACCTTCAATGCCTTCGATTAGAACTTTCGGGGAATCGAAAGTGTGGCGTAGGTCAAATGTTGCTTAACATCCTACGAACCTTCCTTCCATCCTTCCTTGGCTTCCTATGGTGATAGTTATAGGTCTTCCTCTTCCTATGGTTCATTGGCTTACTTCCTTGGTTATTAGTACATGCGCACACACGTACACACACGTTCTTTAATAGATAGTTCGCCTCCTGGTAT

[0125] SEQ ID NO: 15

[0126] The SCAR marker AC15 (1019 bp) was used to detect heterologous radish mitochondrial fragments in cytoplasmic male-sterile lines of Brassica napus.

[0127]

[0128] SEQ ID NO:16

[0129]

[0130] References:

[0131] 1.Kitamoto N, Nishikawa K, Tanimura Y, Urushibara S, Matsuura T, Yokoi S, Takahata, Y, Yui S.Correction to: Development of late-bolting F1 hybrids of Chinese cabbage(Brassica rapa L.)allowing early spring cultivation without heating.Euphytica.2018;214(2):30.

[0132] 2.Wang Y, Wang Q, Hao W, Li J, Qi M, Zhang L.Mitochondrial genome sequencing reveals orf463a may induce male sterility in NWB cytoplasm of radish.Genes(Basel).2020;11(1):74.

[0133] 3.Yu HL, Li ZY, Ren WJ, Han FQ, Yang LM, Zhuang M, Lv HH, Liu YM, Fang ZY, Zhang YY.Creation of fertility-restored materials for Ogura CMS in Brassica oleracea by introducing Rfo gene from Brassica napus via an allotriploid strategy.Theor Appl Genet.2020;133(10):2825-37.

[0134] 4.Oaura H.Studies on the new male sterility in Japanese radish withspecial reference to theUtilization of this sterility towards the practicalraising of hybrid seeds.Mern Fac.Agri.Kagoshima University,1968,6(2):39-78.

[0135] 5.Bannerot H,Boulidard L,Canderon Y,Tempe J.Transfer of cytoplasmicmale sterility from Raphanus sativus to Brassica oleracea.Eucarpia CrueiferaeNewsletter,1974,1:52-54.

[0136] 6.Bannerot H,Boulidard L,Chupeau Y.Unexpected difficulties met withradish cytoplasm in Brassica oleracea.Eucarpia Crueiferae Newslett,1977,2:16.

[0137] 7.Rousselle P.First results in a programme of introduction of Oauramale sterility from radish to rape.Agronomie,1982,2:859-864.

[0138] 8.Mesquida J,Renard M.The entomophilous pollination of male sterilestrains of winter rapeseed(Brassica napus L.)and a preliminary study ofalternating devices.In:Caron TA(ed)IVth Syrup Intern on Pollination,Washington,Maryland,USA,1978,49-57.

[0139] 9. Walters TW. Mutschler MA, Earle ED. Protoplastfusion-derived Oguramale sterile cauliflower with cold tolerance. Plant Cell Rep. 1992; 10(12): 624-8.

[0140] 10. Cardi, T., Earle, E. Production of new CMS Brassica oleracea by transfer of `Anand′cytoplasm from B. rapa through protoplast fusion. Theor ApplGenet 94, 204-212 (1997).

[0141] 11. Wang Qingbiao, Fang Zhiyuan, Zhang Yangyong, Liu Yumei, Yang Limei, Zhuang Mu, Sun Peitian. Comparative study on the morphology of floral organs and fruit-bearing characteristics of two types of male-sterile lines of cabbage. Journal of Horticulture, 2011, 38(01): 61-68.

[0142] 12. Sanchez-Puerta MV, Zubko MK, Palmer JD. Homologous recombination and retention of a single form of most genes shape the highly chimericmitoehondrial genome of a cybrid plant. New Phytol. 2015; 206(1): 381-96.

[0143] 13.Du K, Liu Q, Wu X, Jiang J, Wu J, Fang Y, Li A, Wang Y. Morphological structure and transcriptome comparison of the cytoplasmic male sterility linein Brassica napus (SaNa-1A) derived from somatic hybridization and itsmaintainer line SaNa-1B. Front Plant Sci. 2016; 7: 1313.

[0144] 14.Kang L, Li P, Wang A, Ge

[0145] 15. Arimura SI, Yanase S, Tsutsumi N, Koizuka N. The mitochondrial genome of an asymmetrically cell-fused rapeseed, Brassica napus, containing a radish-derived cytoplasmic male sterility-associated gene. Genes Genet Syst. 2018;93(4):143-8.

[0146] 16. Wang Qingbiao. Study on flowering and fruiting traits and heterologous cytoplasmic molecular differences in two types of male-sterile cabbage lines [D]. Chinese Academy of Agricultural Sciences, 2010.

[0147] 17. Ren Wenjing. Creation and utilization of high-generation backcross Ogura CMS fertility restorer materials of cabbage [D]. Chinese Academy of Agricultural Sciences, 2021.

[0148] 18. Li Zhiyuan. KASP markers for constructing fingerprint maps and identifying heterosis groups in cabbage [D]. Chinese Academy of Agricultural Sciences, 2018.

[0149] 19. Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980 Oct 10; 8(19): 4321-4325.

Claims

1. A SCAR marker for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea, characterized in that, The SCAR markers are all of AC1 to AC16; the nucleotide sequences of AC1 to AC16 are shown in SEQ ID NO: 1 to 16.

2. A primer set for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea, characterized in that, The primer set includes primer pairs AC1p to AC16p; AC1p~AC16p were used to amplify heterologous radish mitochondrial fragments with nucleotide sequences as shown in SEQ ID NO: 1~16, respectively. The sequence information of AC1p to AC16p is as follows: 。 3. A kit for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea, characterized in that, The kit comprises the primer set as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, Each primer in the primer set is individually packaged in liquid or powder form.

5. The reagent kit according to claim 3, characterized in that, The kit also contains universal reagents for PCR and / or gel electrophoresis.

6. The use of the primer set according to claim 2 or the kit according to any one of claims 3-5 in detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica oleracea.

7. A method for detecting heterologous radish mitochondrial fragments in the Ogura cytoplasmic male sterile line of Brassica napus, characterized in that... include: a) Extract genomic DNA from samples of the Ogura cytoplasmic male sterile line of cabbage to be tested; b) Using the genomic DNA as a template, perform PCR using the primer pair described in claim 2; c) Detect the PCR products to determine whether the genomic DNA of the sample contains the corresponding heterologous radish mitochondrial fragment.

8. The method according to claim 7, characterized in that, PCR products can be detected by gel electrophoresis or sequencing.

9. The method according to claim 7, characterized in that, The PCR system contains: 1 μL each of 10 μmol / L forward and reverse primers, 10 μL of 2× PCR Mix, 7 μL of ddH2O, and 1 μL of genomic DNA; The PCR program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 15-60 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min.

10. The method according to any one of claims 7 to 9, characterized in that, The detection of heterologous radish mitochondrial fragments was performed on the seedling stage of the Ogura cytoplasmic male sterile line of cabbage.

Images