Mortierella ramanniana f34, microbial agent and its application in promoting soil structure formation and crop growth

Abstract

The application belongs to the technical field of microbial inoculants, and particularly relates to a Mortierella sp. F34, an inoculant and application of the Mortierella sp. F34 in promoting soil structure formation and crop growth. The application provides the Mortierella sp. F34 with a preservation number of CGMCC No. 40122. Results show that the Mortierella sp. F34 can effectively promote soil aggregate formation and increase the average weight diameter of soil by producing extracellular polysaccharide, extracellular polysaccharide protein and extracellular polysaccharide humic acid under the addition of straw; the application of the Mortierella sp. F34 inoculant can regulate the hormone level of crop roots to promote the growth of corn, significantly promote the growth of the roots and the above-ground parts of wheat, effectively activate the microbial activity in soil, increase the carbon and nitrogen content of microbial amount in soil, and activate various forms of organic phosphorus and inorganic phosphorus in soil to improve the soil fertility.

Description

Technical Field

[0001] This invention belongs to the field of microbial inoculant technology, specifically relating to a strain of *Morchella* F34, an inoculant, and its application in promoting soil structure formation and crop growth. Background Technology

[0002] Early applications of *Mortierella* fungi were primarily in the fermentation of unsaturated fatty acids. In recent years, with increased research, their application in agriculture has been reported, making *Mortierella* a current research hotspot in the development of fungal microbial fertilizers. For example, Li Fang et al. isolated a *Mortierella* strain from sandy loam soil treated with long-term organic fertilizer application and found that it played a key role in promoting soil carbon, nitrogen, and phosphorus cycling and crop growth (Li F, Chen L, Redmile-Gordon et al., 2018. *Mortierella elongata*'s roles in organic agriculture and crop growth promotion in mineral soil. *Land Degradation & Development* 29, 1642-1651). Ning Qi et al. found that combined inoculation of two *Mortierella* strains significantly increased the content of available nitrogen and phosphorus in the soil and significantly altered the bacterial community structure in red soil (Ning Qi, Chen Lin, Li Fang et al., Effects of *Mortierella* on soil nutrient availability and straw degradation, *Acta Pedologica Sinica*, 2022). Chen Lin et al. isolated a strain of *Morchella* from saline-alkali soil and demonstrated that it could optimize the microbial community structure, promote soil phosphorus dissolution, and reduce the sodium-potassium ratio in wheat leaves on saline-alkali soil (*Morchella* strain and its application, Chinese Patent CN201911042908.8, Chen Lin, Zhang Jiabao, Li Hanfang et al., 2022). Aggregates are one of the basic properties of high-productivity soils. Aggregates can improve soil fertility by regulating soil water transport and nutrient cycling. Their porous structure provides a heterogeneous environment for soil microorganisms, which is beneficial for the sequestration of soil organic carbon and the penetrating growth of crop roots. Currently, there are no reports on *Morchella* promoting soil aggregate formation. Summary of the Invention

[0003] The purpose of this invention is to provide a strain of *Morchella* F34, which can effectively promote the formation of soil aggregates and increase the average weight diameter of soil.

[0004] To address the aforementioned technical problems, the present invention provides the following technical solution:

[0005] This invention provides a strain of Mortierella sp. F34, with accession number CGMCC No.40122.

[0006] This invention provides a fungal agent containing *Morchella F34* as described in the above-mentioned technical solution, wherein the number of active mycelia of *Morchella F34* in the fungal agent is ≥10. 6 cfu / g.

[0007] The present invention provides a method for preparing the microbial agent described in the above technical solution, comprising the following steps: after a first fermentation culture of *Morchella spp.* F34, a first fermentation mixture is obtained; the first fermentation mixture is inoculated into a second fermentation medium for a second fermentation culture to obtain the microbial agent; the first fermentation culture time is 7-10 days; the second fermentation culture continues until the *Morchella spp.* F34 mycelia completely cover the fermentation medium.

[0008] Preferably, the culture medium for the first fermentation culture is PD liquid culture medium, the temperature of the first fermentation culture is 25-30℃, and the rotation speed of the first fermentation culture is 120-180 rpm.

[0009] Preferably, the temperature for the second fermentation culture is 25–30°C.

[0010] Preferably, the culture medium for the second fermentation culture comprises the following components in parts by weight: 65-75 parts wheat bran, 2-3 parts sucrose, 0.08-0.12 parts humic acid, and 90-110 parts water.

[0011] Preferably, the volume ratio of the first fermentation mixture to the second fermentation medium during inoculation is (15-25) mL: 100 mL.

[0012] This invention provides the application of the above-described *Morchella spp.* F34 or the above-described fungal agent or the fungal agent prepared by any of the above-described preparation methods in one or more of the following (1) to (4);

[0013] (1) Promotes the formation of soil aggregates;

[0014] (2) Promotes the dissolution of tricalcium phosphate;

[0015] (3) Promotes plant growth;

[0016] (4) Promote the transformation of soil phosphorus.

[0017] Preferably, the plant includes wheat or corn.

[0018] Preferably, the microbial agent is applied to the soil, and the mass ratio of the microbial agent to the soil is 1:(200-1000).

[0019] The beneficial effects of this invention: This invention provides a strain of *Mortierella sp.* F34, with accession number CGMCC No. 40122. *Mortierella sp.* F34 of this invention can effectively promote the formation of soil aggregates and increase the average weight diameter of soil cells. Application results show that, with the addition of straw, this strain of *Mortierella sp.* F34 effectively promotes the formation of soil aggregates and increases the average weight diameter of soil cells by producing extracellular polymeric polysaccharides, extracellular polymeric proteins, and extracellular polymeric humic acids; application of *Mortierella sp.* F34 inoculant can regulate crop root hormone levels to promote corn growth and significantly promote the root and aboveground growth of wheat; effectively activate soil microbial activity and increase the microbial biomass carbon and nitrogen content in the soil; effectively promote the activation of various forms of organic and inorganic phosphorus in the soil to improve soil fertility. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0021] Figure 1 Example 2: Growth of *Morchella esculenta* F34 on potato dextrose medium and *Morchella esculenta* F34 soil medium as described in Example 1; Figure 1 In the diagram, 'a' represents the front side of potato glucose medium, 'b' represents the back side of potato glucose medium, and 'c' represents soil medium.

[0022] Figure 2 This is a scanning electron microscope energy dispersive spectroscopy (SEM) image of *Morchella spp.* F34 grown on soil culture medium in Example 2. Figure 2 In the diagram, A represents extracellular polymeric substances (EPS) produced by hyphae, B represents the entanglement of hyphae on soil particles, C represents the growth of hyphae on the surface of mineral particles, and D represents the energy dispersive spectroscopy (EDS) analysis of hyphae growth on the mineral surface.

[0023] Figure 3 The effects of *Morchella hymexazol* F34 on wheat root growth in Example 3 and Comparative Example 4 are shown. Figure 3 The middle comparative example refers to comparative example 4, and the right-hand example refers to example 3;

[0024] Figure 4 The effects of inoculating maize with *Morchella esculenta* F34 in Example 5 and Comparative Example 5 on promoting maize growth were investigated. Figure 4 The two trees on the left are comparative example 5, and the two trees on the right are example 5;

[0025] Figure 5 The image shows the sequence with the highest alignment similarity in the ITS1 region of F34.

[0026] Biological Preservation Instructions

[0027] Mortierella sp. F34 was deposited on March 31, 2022, at the China General Microbiological Culture Collection Center, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 40122. Detailed Implementation

[0028] This invention provides a strain of Mortierella sp. F34, with accession number CGMCC No. 40122. Its ITS sequence is shown in SEQ ID NO: 1.

[0029] SEQ ID NO:1 Sequence:

[0030] CGAAGGTTTTCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTT

[0031] TTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTCAGTCGATC

[0032] TTCTTTATGGAGATTGGCCAAACATCAACCATATCTTTTAACTCTTTGTCT

[0033] GAAAAATATTATGAATAAACAATTCAAAATACAACTTTCAACAACGGATC

[0034] TCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGT

[0035] GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTC

[0036] TTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCAAA

[0037] GCTTTTGATTTTTTTTTGAAAGCTTTGGACTTGAGCAATCCCAACACCAAT

[0038] CTTTTTAGATTGGAGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACAT

[0039] TCTCCTGAGCTAAAAGCATATTCATTTAGTCCCGTCAAACGGATTATTACT

[0040] TTTGCTGCAGCTAACATAAAGGGAGTTTGACCGTATTGGCTGACTGATGC

[0041] AGGATTTCACAGGGGTCGGCAACGACGCTTGTTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA.

[0042] The present invention preferably employs the following method to identify F34:

[0043] 1) Take 5 μL of Lysis Buffer for Microorganism to Direct PCR into a sterile centrifuge tube.

[0044] 2) Use a sterile toothpick or pipette tip to pick up a single colony, place it in a centrifuge tube, stir it a few times, and then remove it.

[0045] 3) After heat denaturation at 80℃ for 15 minutes, remove the product from the middle and shake it rapidly to ensure sufficient heat denaturation. Centrifuge at 5000 rpm for 5 minutes.

[0046] 4) Use the supernatant after lysis as a template for PCR reaction. Use ITS1 / ITS4 primers to amplify the ITS1 and ITS2 regions of fungi. The PCR amplification system and procedure are shown in Table 1-1.

[0047] Table 1-1 PCR amplification system and amplification procedure

[0048]

[0049] 5) After amplification, samples were detected by 1.2% agarose gel electrophoresis. Samples that passed the detection were then subjected to routine sequencing.

[0050] 6) After manually removing the primer sequences from the sequenced data, nucleic acid BLAST was performed using the National Center for Biotechnology Information database to preliminarily determine the classification information of the strain and construct the phylogenetic tree of F34.

[0051] The method for constructing a phylogenetic tree is as follows:

[0052] The obtained M. thallus F34 sequence was entered into NCBI blast for alignment at https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome

[0053] The data used were internal transcribed spacer regions (ITS) from Fungi type and reference. The alignment optimization condition was selected as Highly similar sequences (megablast), and the other conditions were set to default.

[0054] Analysis of the results revealed that this sequence was highly specific, with similar sequences showing less than 97% similarity (the highest being only 96.82%, with a coverage of 91%), thus failing to meet the criteria for species identification. The alignment results for F34 are shown below. Figure 5 Based on the above analysis and identification of colony morphology characteristics, the applicant named the strain Mortierella sp. F34.

[0055] The *Mortierella* sp. F34 described in this invention was isolated and cultured from topsoil treated with long-term straw return during a national alluvial soil fertility and efficiency experiment in Yuanyang County, Henan Province. Originating from farmland soil subjected to long-term straw return, the *Mortierella* sp. F34 of this invention can achieve green and ecological agriculture, ensuring the quality and safety of food. This *Mortierella* fungus F34 exhibits long-lasting effects, can grow and reproduce spontaneously in the soil, achieving a stable ecological balance with the indigenous microbial community without the need for repeated addition. The *Mortierella* fungus F34 of this invention produces very few conidia.

[0056] This invention provides a fungal agent containing *Morchella F34* as described in the above-mentioned technical solution, wherein the number of active mycelia of *Morchella F34* in the fungal agent is ≥10. 6 cfu / g.

[0057] The number of active hyphae of *Morchella F34* in the fungal agent of this invention is ≥10. 6 cfu / g, more preferably 2×10 6 cfu / g.

[0058] The present invention provides a method for preparing the microbial agent containing the above-described technical solution, comprising the following steps: after a first fermentation culture of *Morchella esculenta* F34, a first fermentation mixture is obtained; the first fermentation mixture is inoculated into a second fermentation medium for a second fermentation culture to obtain the microbial agent.

[0059] The large-scale cultivation process of Mortierella sp. F34 of the present invention is simple, the cultivation cost is low, and the method for preparing it into a biological agent is also very simple and operable, making it suitable for widespread application in the agricultural field.

[0060] In this invention, a first fermentation mixture is obtained after the first fermentation culture of *Morchella spp.* F34. Preferably, *Morchella spp.* F34 is inoculated into the first fermentation medium for the first fermentation culture. The *Morchella spp.* F34 is preferably stored in PDA medium before inoculation into PD liquid medium. There are no special restrictions on the inoculation amount of *Morchella spp.* F34; conventional inoculation amounts in the art are sufficient. The first fermentation medium is preferably PD liquid medium; the PD liquid medium preferably comprises the following components in parts by weight: 180-220 parts peeled potato, 18-22 parts glucose, and 900-1100 parts water, more preferably 200 parts peeled potato, 20 parts glucose, and 1000 parts water. Preferably, the pH of the PD liquid medium is natural.

[0061] The preferred temperature for the first fermentation in this invention is 25–30°C, more preferably 26–29°C, and even more preferably 28°C. The preferred rotation speed for the first fermentation is 120–180 rpm, more preferably 140–160 rpm, and even more preferably 150 rpm. The preferred fermentation time is 7–10 days, and even more preferably 8–9 days. The first fermentation is preferably continued until a large number of white, bean-shaped mycelial balls appear in *Morchella hygroscopica* F34. The purpose of the first fermentation is to obtain more mycelial fragments and zygospores.

[0062] After obtaining the first fermentation mixture, the present invention inoculates the first fermentation mixture into a second fermentation medium for a second fermentation culture to obtain the inoculum. In the present invention, the volume ratio of the first fermentation mixture to the second fermentation medium during inoculation is preferably (15-25):100, more preferably (18-23):100, and even more preferably 20:100. The second fermentation medium of the present invention preferably comprises the following components in parts by weight: 65-75 parts wheat bran, 2-3 parts sucrose, 0.08-0.12 parts fulvic acid, and 90-110 parts water, with a natural pH. More preferably, it comprises the following components in parts by weight: 72 parts wheat bran, 3 parts sucrose, 0.1 parts fulvic acid, and 100 parts water, with a natural pH.

[0063] The second fermentation medium of the present invention is preferably prepared by the following method: humic acid and sucrose are first dissolved in water to obtain water containing humic acid and sucrose; wheat bran is then mixed with the water containing humic acid and sucrose for 30 minutes to obtain a mixture, which is the second fermentation medium. The wheat bran used in the present invention is preferably unmoldy, dried wheat bran. The second fermentation medium is preferably used after high-temperature sterilization, wherein the high-temperature sterilization conditions are sterilization at 121°C for 20 minutes.

[0064] The temperature for the second fermentation culture of this invention is 25–30°C, more preferably 26–28.5°C, and even more preferably 28°C; the second fermentation culture continues until the *Morchella hygroscopica* F34 mycelium completely covers the fermentation medium. The fermentation culture time for the second fermentation culture of this invention is preferably 10–15 days, more preferably 11–14 days, and even more preferably 12 days. The preferred method for the second fermentation culture of this invention is static culture. This invention does not limit the container for the second fermentation culture; conventional containers are acceptable. The preferred culture container for the second fermentation culture of this invention is a polyethylene square culture box.

[0065] This invention provides the application of the above-described *Morchella spp.* F34, the above-described fungal agent, or the fungal agent prepared by the above-described preparation method in one or more of the following (1) to (4);

[0066] (1) Promotes the formation of soil aggregates;

[0067] (2) Promotes the dissolution of tricalcium phosphate;

[0068] (3) Promotes plant growth;

[0069] (4) Promote the transformation of soil phosphorus.

[0070] The plant described in this invention preferably includes wheat or corn.

[0071] The microbial agent of the present invention is preferably applied to the soil, and the mass ratio of the microbial agent to the soil is preferably 1:(200-500), more preferably 1:350. When the microbial agent is applied in the field, the preferred application rate is a mass ratio of the microbial agent to the soil at a tillage depth of 0-15 cm of 1:1000.

[0072] The *Mortierella sp.* F34 of this invention promotes soil fertility by promoting the formation of soil aggregates, increasing the content of organic carbon and soluble carbon and nitrogen in the soil, and resisting pathogens. Soil phosphorus classification is crucial for understanding soil phosphorus transformation and crop phosphorus uptake. Current research has largely focused on changes in available phosphorus in the soil after *Mortierella sp.* inoculation, but studies on the effects on different active forms of phosphorus in the soil are scarce. After inoculation of *Mortierella sp.* F34 into the soil, the concentrations of available phosphorus, sodium bicarbonate-extractable phosphorus, sodium hydroxide-extractable phosphorus, and hydrochloric acid-extractable phosphorus in the soil all showed a significant increase, indicating that *Mortierella sp.* has a strong activating effect on inorganic phosphorus in the soil. From the grouping results of organic phosphorus, inoculation of soil with *Mortierella sp.* F34 significantly increased the concentrations of sodium bicarbonate and sodium hydroxide-extractable phosphorus in the soil.

[0073] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0074] Example 1: Experiment on the promotion of soil aggregate formation by *Morchella esculenta* F34

[0075] 100g of dry soil (passed through a 100-mesh sieve) was mixed with 0.5mg of straw powder (passed through a 60-mesh sieve) at a concentration of 5mg / kg and placed in a 1L Erlenmeyer flask. The flask was sealed with breathable sealing film and sterilized at 121℃ for 20 minutes. After cooling, it was sterilized again, and this process was repeated 3-4 times. The straw powder was used to help fungus F34 colonize and grow in the soil. Under aseptic conditions, the sterilized soil was spread evenly in 70mm diameter sterile petri dishes, with 15g of soil added to each dish. 5mL of sterile water was added, and then *Morchella hygroscopica* F34 was inoculated. Under aseptic conditions, a 0.8cm diameter agar block of the fungus was inoculated in the center of the soil culture medium.

[0076] After 20 days of dark culture at 25℃, soil aggregates were graded and extracellular polymeric substances (EPS) were extracted and measured from each aggregate level. The growth of *Morchella spp.* F34 on the soil culture medium is shown in [reference needed]. Figure 1 c. The scanning electron microscopy (SEM) energy dispersive spectroscopy (EDS) image of *Morchella pyrenoidosa* F34 grown on soil culture medium is shown in Figure [image missing]. Figure 2 .

[0077] Comparative Examples 1 and 2

[0078] Under aseptic conditions, sterilized soil was spread evenly into sterile petri dishes with a diameter of 70 mm, with 15 g of soil and 5 mL of sterile water added to each dish. A negative control (Comparative Example 1) was used without inoculation with *Morchella* fungus F34, and an unsterilized indigenous microorganism was selected as a positive control (Comparative Example 2). The mixture was incubated in the dark at 25°C for 20 days, with all other conditions the same as in Example 1.

[0079] Soil aggregates were graded and extracellular polymeric substances (EPS) were extracted and measured from the soils cultured in Examples 1 and 1 and 2.

[0080] The determination method is as follows

[0081] Four plates with good growth were selected and gently mixed to form a mixed soil sample. A total of five mixed soil samples were prepared. (1) to (5) were all carried out in a clean bench.

[0082] (1) Place the mixed soil sample on a 250μm sieve and submerge it for 5 minutes;

[0083] (2) Vibrate for 2 minutes, with an amplitude of 3 cm and a frequency of 30 times per minute;

[0084] (3) The soil on the sieve was transferred to a sterile petri dish, >250μm aggregates;

[0085] (4) The water-soil mixture was passed through a 53μm sieve. The soil on the sieve was transferred to a sterile petri dish and formed aggregates of >53μm and <250μm.

[0086] (5) The remaining water-soil mixture was kept in a food storage box and left overnight in a clean bench to absorb excess moisture. The mixture was then air-dried in the clean bench until the moisture content of the water-soil mixture was 20%. It was then collected in a food storage bag, divided into two parts, and stored at -80℃ for the determination of EPS content.

[0087] The EPS extraction method is as follows:

[0088] (1) Add 30 mL of 0.1 M CaCl2 solution to a 50 mL polypropylene centrifuge tube to remove soluble organic matter, and add 3 g of a water-soil mixture with a water content of 20%. Place the centrifuge tube on ice and vibrate at 120 rpm for 1 h. After centrifugation at 3200 g for 30 min, discard the supernatant and extract EPS from the remaining material.

[0089] (2) Add 15.98g CER and 25ml buffer to the precipitate. Vibrate at 120rpm for 2h, then centrifuge at 4000g for 30min.

[0090] (3) The buffer solution consisted of 2 mM Na3PO4·12H2O (0.760 g / L), 4 mM NaH2PO4·H2O (0.552 g / L), 9 mM NaCl (0.526 g / L), and 1 mM KCl (0.0746 g / L). The pH was adjusted to 7 with 1 M HCl, and the solution was pre-cooled at 4°C. The CER (Marathon C ion exchange resin, sodium form, strongly acidic, 20–50 mesh) was pre-washed twice in the buffer solution. The CER content was determined based on the requirement of 178 mg CER mg⁻¹ SOC for soils with the highest organic carbon content.

[0091] (4) Transfer the supernatant containing EPC to a new test tube, freeze it in liquid nitrogen, and store it at -80°C for the determination of EPS uronic acid, EPS protein and EPS humic acid.

[0092] Determination method of EPS uronic acid:

[0093] (1) Take 200 μL of supernatant containing EPC and add 1.2 mL of sodium tetraborate (0.0125 M, concentrated sulfuric acid as a crop solvent). Vortex for 45 s, bathe in a 100℃ water bath for 5 min, cool on ice for 3 min, then add 20 μL of m-hydroxybiphenyl solution (CAS#: 580-51-8), mix well, let stand for 4 min, and measure the absorbance at 520 nm.

[0094] (2) Preparation of the standard curve: A 25 μg / mL stock solution of D-glucuronic acid (CAS#: 6556-12-3) was prepared. 0, 4, 20, 60, 100, and 200 μl of the stock solution were taken and brought to a final volume of 200 μl with deionized water. Step (1) was then repeated to obtain the absorbance values ​​of different stock solutions, and a standard curve was prepared. The standard curve was: y = 0.0053x + 0.0812, R0 2 =0.9978, where y represents absorbance and x represents uronic acid concentration.

[0095] The Lowry method was used to determine the content of EPS protein and EPS humic acid.

[0096] Solution A: Dissolve 3.5g of copper sulfate pentahydrate in 100mL of water to obtain solution (1); dissolve 7.0g of sodium potassium tartrate in 100mL of water to obtain solution (2); dissolve 70g of sodium carbonate in 1L of 0.35N sodium hydroxide solution to obtain solution (3). Mix solutions (1), (2), and (3) in a volume ratio of 1:1:100 to obtain solution A.

[0097] Solution B: Deionized water, solution (2) and solution (3) can be mixed in a volume ratio of 1:1:100 to obtain solution B.

[0098] 1. Each sample was replicated 3 times. 50 μL of supernatant containing EPC was added to each well of plate A and plate B, and the volume was increased to 100 μL with PBS.

[0099] 2. Add 100 μL of solution A and mix thoroughly by pipetting. For the control, add 100 μL of solution B.

[0100] 3. Place both plates in the dark at room temperature for 10 minutes.

[0101] 4. Immediately add 100 μL of Folin-Phenol reagent to terminate the reaction.

[0102] 5. After 30 minutes, the absorbance was measured at 750 nm.

[0103] Folin-Phenol reagent: 2N Folinphenol reagent diluted 10 times with water.

[0104] The formulas for calculating EPS protein and EPS humic acid are as follows: where, Abs A Abs represents the absorbance of the plate with added solution A. B This represents the absorbance of the plate with added liquid B.

[0105] Abs 蛋白 =1.25*(Abs) A -Abs B );

[0106] Abs 蛋白 The standard curve is: y = 0.0009x + 0.0089, R0 2 =0.9965; x is the concentration of EPS protein, y is 1.25*(Abs) A -Abs B );

[0107] Abs 腐殖酸 =AbS B -0.2Abs 蛋白 ;

[0108] Abs 腐殖酸 =AbS B -0.2*1.25*(Abs A -Abs B );

[0109] The standard curve for Abs humic acid is: y = 0.0016x + 0.0732, R0 2=0.9943; x is the concentration of EPS humic acid, y is 0.2 * 1.25 * (Abs) A -Abs B ).

[0110] The results are shown in Tables 1-2 and 2.

[0111] Table 1-2 shows that inoculation with *Morchella esculenta* F34 significantly increased the proportion of aggregates >1 mm and 0.053–0.25 mm, while significantly decreasing the proportion of aggregates 0.25–1 mm and <0.053 mm. Overall, the average weight diameter of soil aggregates increased significantly, with an increase of 35%. Furthermore, the content of extracellular polymers in each particle size fraction of the aggregates was determined.

[0112] Table 1-2 Soil aggregate classification results of Example 1 and Comparative Examples 1-2

[0113]

[0114] Note: Different lowercase letters indicate significance at the p=0.05 level.

[0115] Table 2. EPS content in soil aggregates of different particle sizes in Example 1 and Comparative Examples 1-2

[0116]

[0117]

[0118] Note: The data in the table represent the mean (standard deviation), and the same applies below. NA indicates not detected. Different lowercase letters represent differences at the P=0.05 level.

[0119] Table 2 shows that inoculation with *Morchella esculenta* F34 significantly increased the EPS protein content in aggregates >1 mm and <0.053 mm, with increases of 4.95 times and 8.21 times, respectively. F34 inoculation significantly increased the EPS uronic acid content in all aggregate sizes in the soil, with the largest increase occurring in 0.25–1 mm aggregates (4-fold increase) and the smallest increase occurring in 0.053–0.25 mm aggregates (25% increase). Similarly, F34 inoculation significantly promoted the increase of EPS humic acid content in all aggregate sizes in the soil, with the largest increase in <0.053 mm aggregates (18-fold increase) and the smallest increase occurring in 0.053–0.25 mm aggregates (5.76-fold increase). In summary, the EPS protein secreted by *Morchella F34* mainly accumulates in aggregates of >1 mm and <0.053 mm size. The secreted EPS uronic acid accumulates in all aggregate sizes, with the highest concentration in aggregates of <0.053 mm size. The secreted EPS humic acid accumulates in all aggregate sizes, with the highest concentration in aggregates of 0.25–1 mm size.

[0120] Example 2: Determination of phosphorus-solubilizing ability of *Morchella F34* under pure culture conditions

[0121] Preparation method of F34 agar block spawn: In a clean bench, pick mycelia and place them in the center of a pre-prepared PDA plate culture medium. Incubate at 25°C in the dark for 5 days until the mycelia cover the entire plate, thus obtaining the agar block spawn. Use a punch of the appropriate size to make holes for inoculation.

[0122] The growth status of *Morchella esculenta* F34 in potato dextrose medium is shown in the figure. Figure 1 a and Figure 1 b.

[0123] Test method: Prepare a sufficient amount of clean and uniform straw, and cut it to 1cm with scissors. 3 Size. Each liter of culture medium contains 0.50g yeast extract, 20.0g straw, 5.0g tricalcium phosphate, 0.50g ammonium sulfate, 0.20g potassium chloride, 0.10g magnesium sulfate heptahydrate, 0.0001g manganese sulfate monohydrate, and 0.0001g ferrous sulfate heptahydrate. The pH is adjusted to 7.0, and the medium is sterilized at 121℃ for 20 minutes. After cooling, two 1cm diameter F34 agar blocks are inoculated into a 1L culture flask. After inoculation with F34 agar blocks, the medium is cultured on a shaker at 25℃ and 170rpm for 7 days.

[0124] Comparative Example 3

[0125] Preparation method of blank agar blocks: Pour the prepared PDA medium into a petri dish, and after solidification, you will get an agar block with a thickness of 0.3 cm. Incubate the PDA plate petri dish in the dark at 25℃ for 5 days to obtain blank agar blocks. When using, punch holes with a hole punch of the corresponding size.

[0126] Comparative Example 3 was inoculated with blank agar blocks, and the other conditions were the same as in Example 2.

[0127] After culturing for 7 days in both Example 2 and Comparative Example 3, the culture medium was allowed to stand for 60 minutes, and then the clear culture medium from the culture flasks of Example 2 and Comparative Example 2 was collected to determine the concentration of reducing sugars. The reducing sugar was determined using the DNS method (dinitrosalicylic acid method), and the steps are as follows:

[0128] DNS solution preparation method: Weigh 3.25g of 3,5-dinitrosalicylic acid and dissolve it in a small amount of water. Transfer the solution to a 500mL volumetric flask, add 162.5mL of 2M sodium hydroxide, then add 22.5g of glycerol. Shake well and make up to 500mL. Store in a refrigerator at 4℃ in the dark for later use.

[0129] Accurately pipette 0.5 mL of the clarified culture medium into a 10 mL glass test tube, add 1.5 mL of DNS, boil in a water bath for 5 min, immediately cool on ice, develop color at room temperature for 20 min, and measure the color using an ELISA reader at 540 nm.

[0130] Preparation of the standard curve: Dry 2g of glucose at 98℃ for 2 hours until constant weight. Accurately weigh 1.0000g of the dried glucose and bring the volume to 1L. Set different concentration gradients: 0, 0.1, 0.3, 0.5, 0.7, and 0.9 mg / mL. Incubate in a boiling water bath for 5 minutes, then immediately cool on ice for 5 minutes. Develop the color at room temperature for 20 minutes, and measure the color at 540nm. The standard curve is y = 0.2713x, R0. 2 =0.9935; where x is the OD absorbance and y is the reducing sugar concentration.

[0131] The methods for determining soluble phosphorus in the culture media of Example 2 and Comparative Example 3 are as follows:

[0132] Accurately pipette 1 mL of the culture medium from Example 2 and Comparative Example 3 into 25 mL volumetric flasks, then accurately add 12.5 mL of distilled water using a burette, followed by 2.5 mL of molybdenum antimony reagent using a pipette. Shake well, let stand for 30 min, then bring to volume, shake well, and perform colorimetric analysis at a wavelength of 700 nm.

[0133] Molybdenum-antimony resistant reagent: Weigh 10.0g of ammonium molybdate and dissolve it in 250mL of water at 60℃, cool and dilute to 300mL; slowly pour 181mL of concentrated H2SO4 (analytical grade) into 800mL of water, cool, then pour dilute sulfuric acid into the molybdenum acid solution and stir well; weigh 0.3g of potassium antimony tartrate, add it to the ammonium molybdate dilute sulfuric acid solution, and dilute to 2L with water. This solution is called molybdenum-antimony resistant reagent, which can be stored in a brown bottle for long-term preservation.

[0134] The standard curve used for the determination of soluble phosphorus is y = 1.3935x, R0. 2 =0.9959, where x is the absorbance value and y is the concentration of orthophosphate in the system.

[0135] The straw in the 1L culture bottles of Example 2 and Comparative Example 3 was sieved and washed. A small amount of mycelium on the surface was removed with tweezers. The straw in the culture bottles was dried at 50°C to constant weight for 12-24 hours. After drying, the straw was weighed and the straw degradation rate was calculated by the drying difference method.

[0136] Table 3 shows that inoculation with *Morchella esculenta* F34 had no significant effect on the straw degradation rate, but significantly increased the content of available phosphorus in the culture medium of Example 2. This indicates that *Morchella esculenta* F34 has a strong promoting effect on the dissolution of tricalcium phosphate, and the tricalcium phosphate component in the culture medium is insoluble in water. Due to the absorption and utilization of reducing sugars by *Morchella esculenta* F34, the reducing sugar concentration in the culture medium of Example 2 was significantly lower than that of Comparative Example 3.

[0137] Table 3. Phosphate-soothing effect, degradation rate, and reducing sugar content in culture medium of *Morchella F34*

[0138]

[0139] Note: "**" indicates that the difference is significant at the P=0.01 level, and "*" indicates that the difference is significant at the P=0.05 level.

[0140] Example 3: Growth experiment of *Morchella esculenta* F34 on wheat root system during seedling stage

[0141] 80g of nutrient soil (refined nutrient soil purchased from Henan Fengwo Agricultural Materials Co., Ltd.) was placed in a 1L Erlenmeyer flask, and the moisture content was adjusted to 30%. After sealing with breathable sealing film, the flask was sterilized at 121℃ for 20 minutes. After the nutrient soil cooled, wheat seeds were sown into the nutrient soil under aseptic conditions at a depth of 1cm. At the same time, three pieces of F34 agar block inoculum prepared in Example 2 were inoculated at a depth of 1cm. After sealing, the flasks were cultured in a biochemical incubator. Two days after emergence, the seedlings were removed under aseptic conditions, leaving one seedling per flask. The seedlings were then cultured under light at 25℃ for 16 hours and under darkness at 15℃ for 8 hours, for a total of 15 days.

[0142] Comparative Example 4

[0143] Comparative Example 4 was inoculated with three blank agar blocks prepared in Comparative Example 2, and the other conditions were the same as in Example 3.

[0144] The experiment was completed after 15 days of cultivation. Photographs were taken using a root scanner of the wheat seedlings in Example 3 and Comparative Example 4 after 15 days of cultivation. The results are shown in Table 4. Figure 3 According to Table 4 and Figure 3 It can be seen that inoculating the nutrient soil with *Morchella esculenta* F34 can significantly promote the growth of wheat roots and aboveground parts. The number of root crowns, number of intersections, total root length, total root area, and total root volume of wheat in Example 3 were significantly higher than those in Comparative Example 4.

[0145] Table 4. Root parameters of wheat seedlings in Example 3 and Comparative Example 4

[0146]

[0147] Note: "**" indicates that the P=0.01 level is significant, and "*" indicates that the P=0.05 level is significant.

[0148] Example 4: Preparation of *Morchella F34* inoculant

[0149] 1. Inoculate the vigorous growth of *Morchella esculenta* F34 mycelial blocks on PDA medium that has been cultured at 25–28°C for 5–7 days into PD liquid medium, and culture in a constant temperature shaker at 28°C and 220 rpm for 7 days to obtain a fermentation mixture;

[0150] 2. Under aseptic conditions, add 10 mL of the fermentation mixture prepared in step 1 to 20 g of fermentation medium (wheat bran-sucrose-humic acid medium) and shake immediately; incubate at 28℃; when the mycelium has fully grown on the surface and inside the medium, break it up with a glass rod to obtain the *Morchella* F34 inoculum. The number of active mycelia in the inoculum is 2 × 10⁻⁶. 6 cfu / g.

[0151] The PD liquid culture medium used consisted of 200g peeled potato, 20g glucose, and 1000mL water, with a natural pH.

[0152] The fermentation medium (wheat bran-sucrose-humic acid medium) consists of: 70g wheat bran, 2g sucrose, 0.1g humic acid and 90g water. First, dissolve the sucrose and humic acid in water, then add them to the wheat bran and mix well. The pH should be natural. Pour the mixture into a 500mL Erlenmeyer flask, sterilize at 121℃ for 20min, and then shake the medium while it is still hot.

[0153] Example 5

[0154] 1. Accurately weigh 20g of the fresh mycelium prepared in Example 4, with an active mycelium concentration of 2 × 10⁻⁶. 6 The inoculum has a concentration of CFU / g and a moisture content of 15%. Add it to 7 kg of moist sandy soil, mix thoroughly, and then fill planting pots. Bury 10 g of dried, accurately weighed straw 15 cm from the rim of the pot. The straw should be placed in a 150-mesh double-layer nylon bag. To ensure the survival of the inoculum, immediately water with 1 L of water after filling the pots and burying the straw.

[0155] After thorough watering, plant the corn (Denghai 605) in planting pots. Thin the seedlings to the three-leaf stage, leaving one plant per pot. Cultivate the corn in the planting pots in an artificial climate chamber under the following conditions: 14 hours of light (28℃), 10 hours of darkness (20℃), and a relative humidity of 70%. Water the corn as needed during the growing period and weed regularly.

[0156] Comparative Example 5

[0157] 1. Accurately weigh 20g of the sterilized wheat bran-sucrose-humic acid culture medium from Example 4, add it to 7kg of moist sandy soil, mix thoroughly, and then fill the pot. After filling the pot with soil and burying the straw, immediately water it with 1L of water.

[0158] 2. After thorough watering, plant the corn (Denghai 605) seedlings, thinning to one plant per pot at the three-leaf stage. Cultivate the corn in an artificial climate chamber. The cultivation conditions are 14 hours of light (28℃), 10 hours of darkness (20℃), and a relative humidity of 70%. Water and weed as needed during the corn growing period.

[0159] In Example 5 and Comparative Example 5, the soil nutrient and phosphorus composition were determined during the tasseling stage of maize. At the same time, the biomass of maize plants and the content of maize root hormones were also measured.

[0160] The aboveground biomass of maize plants was determined by blanching at 105℃ for 30 minutes and drying at 80℃.

[0161] The straw degradation rate was determined using the drying difference method, the same as in Example 2.

[0162] The contents of maize root hormones indoleacetic acid, abscisic acid, gibberellin, and zeatin nucleoside were determined by enzyme-linked immunosorbent assay (ELISA), using kits from Shanghai Enzyme-Linked Biotechnology Co., Ltd.

[0163] Neutral phosphatase was measured using a kit from Shanghai Keming Biotechnology Co., Ltd. The definition of a neutral phosphatase activity unit is: 1 nmol of phenol released per gram of soil per day at 37℃ is defined as one unit of enzyme activity.

[0164] The O2 and CO2 contents in the soil were measured using a soil oxygen sensor SO-110 and a soil CO2 sensor from eosGP.

[0165] Soil phosphorus grouping method was based on the paper (Tian, ​​J., Boitt, G., Black, A., Wakelin, S., Condron, LM, Chen, L., 2017. Accumulation and distribution of phosphorus in the soil profile under fertilized grazed pasture. Agriculture Ecosystems & Environment 239, 228-235). The extraction sequence was 0.5M sodium bicarbonate, followed by 0.1M NaOH. -1 1M hydrochloric acid, followed by 0.1M NaOH -2 The mixture contains 0.5M sodium bicarbonate and 0.1M NaOH. -1 The extracted phosphorus is in a readily soluble state, using 1M hydrochloric acid and NaOH. -2 The extracted material is insoluble soil phosphorus.

[0166] For methods of determining soil soluble carbon and nitrogen and microbial biomass carbon and nitrogen, refer to the paper (Wu, J., Joergensen, RG, Pommerening, B., Chaussod, R., Brookes, PC, 1990. Measurement of soil microbial biomass C by fumigation--extraction--an automated procedure. Soil Biology & Biochemistry 22, 1167-1169.).

[0167] The method for determining total phosphorus in plants is consistent with that in Example 2.

[0168] Leaf SPAD was measured using a SPAD meter (Aopgee MC-100).

[0169] The measurement results of Example 5 and Comparative Example 5 are shown in Tables 5-8. Figure 4As shown, the soil microbial biomass carbon and nitrogen in the *Morchella* F34 inoculation treatment increased by 14% and 87%, respectively. Soluble nitrogen in the soil of Example 5 increased by 8%. Neutral phosphatase activity in the soil of Example 5 showed no significant change. Regarding the inorganic phosphorus grouping results, inoculation with *Morchella* F34 significantly increased the concentrations of available phosphorus, sodium bicarbonate-extractable phosphorus, sodium hydroxide-extractable phosphorus, and hydrochloric acid-extractable phosphorus in the soil, indicating that *Morchella* F34 has a very strong activating effect on inorganic phosphorus in the soil. Regarding the organic phosphorus grouping results, inoculation with *Morchella* F34 significantly increased the concentrations of sodium bicarbonate and sodium hydroxide-extractable phosphorus.

[0170] Inoculation with *Morchella esculenta* F34 increased maize biomass by 11%, while the total phosphorus content of the plants did not increase significantly, possibly due to the dilution effect of the increased biomass. Inoculation with *Morchella esculenta* F34 had a highly significant effect on the content of root hormones in maize. Specifically, the contents of auxin, gibberellin, and zeatin nucleoside increased significantly, while the content of abscisic acid decreased significantly.

[0171] Table 5. Results of soil index determination for Example 5 and Comparative Example 5

[0172]

[0173]

[0174] N = 4. * indicates significance at the p < 0.05 level, and ** indicates significance at the p < 0.01 level.

[0175] Table 6 shows the content of various forms of inorganic phosphorus in the soil of Example 5 and Comparative Example 5.

[0176]

[0177] N = 4. * indicates significance at the p < 0.05 level, and ** indicates significance at the p < 0.01 level.

[0178] Table 7. Content of various forms of organic phosphorus in soil of Example 5 and Comparative Example 5.

[0179]

[0180] N = 4. * indicates significance at the p < 0.05 level, and ** indicates significance at the p < 0.01 level.

[0181] Table 8. Results of maize index measurements in Example 5 and Comparative Example 5.

[0182]

[0183]

[0184] N = 4. * indicates significance at the p < 0.05 level, and ** indicates significance at the p < 0.01 level.

[0185] In summary, the *Morchella* F34 provided by this invention effectively promotes the formation of soil aggregates and increases the average weight diameter of soil by producing extracellular polymeric polysaccharides, extracellular polymeric proteins, and extracellular polymeric humic acids. Application of *Morchella* F34 inoculant can regulate crop root hormone levels to promote corn growth and significantly promote the root and aboveground growth of wheat. It effectively activates soil microbial activity, increases the microbial biomass carbon and nitrogen content in the soil, and activates various forms of organic and inorganic phosphorus in the soil to enhance soil fertility.

[0186] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of *Morchella* ( Mortierella sp.)F34, characterized in that, The *Morchella* F34 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 40122.

2. A fungal agent containing *Morchella F34* as described in claim 1, characterized in that, The number of active hyphae of *Morchella F34* in the inoculum is ≥10. 6 cfu / g.

3. A method for preparing a fungal agent of *Morchella F34* as described in claim 2, characterized in that, The process includes the following steps: a first fermentation mixture is obtained after the first fermentation culture of *Morchella spp.* F34; the first fermentation mixture is then inoculated into a second fermentation medium for a second fermentation culture to obtain the inoculum; the first fermentation culture time is 7-10 days; the second fermentation culture continues until the *Morchella spp.* F34 mycelia completely cover the fermentation medium.

4. The preparation method according to claim 3, characterized in that, The culture medium for the first fermentation culture is PD liquid culture medium, the temperature of the first fermentation culture is 25~30℃, and the rotation speed of the first fermentation culture is 120~180rpm.

5. The preparation method according to claim 3, characterized in that, The temperature for the second fermentation culture is 25~30℃.

6. The preparation method according to claim 3 or 5, characterized in that, The culture medium used for the second fermentation culture includes the following components by weight: 65-75 parts wheat bran, 2-3 parts sucrose, 0.08-0.12 parts humic acid, and 90-110 parts water.

7. The preparation method according to claim 3, characterized in that, During inoculation, the volume ratio of the first fermentation mixture to the second fermentation medium is (15~25) mL: 100 mL.

8. The use of the *Morchella* F34 according to claim 1, or the fungal agent according to claim 2, or the fungal agent prepared by the preparation method according to any one of claims 3 to 7, in one or more of the following (1) to (4); (1) Promotes the formation of soil aggregates; (2) Promotes the dissolution of tricalcium phosphate; (3) Promotes plant growth; (4) Promote the transformation of soil phosphorus.

9. The application according to claim 8, characterized in that, The plant in question is either wheat or corn.

10. The application according to claim 8, characterized in that, The microbial agent is applied to the soil, and the mass ratio of the microbial agent to the soil is 1:(200~1000).

Images