Application of stem cell exosomes in drugs for preventing or treating aging

Abstract

The present application relates to the use of stem cell exosomes in drugs for treating aging. The present application found through a senescent cell model that stem cell exosomes can return senescent cells that have cycle arrest to the cell cycle, even if the senescent cells divide and proliferate again. This discovery breaks the current doctrine that "cell aging is irreversible". Based on this, the present application provides the use of stem cell exosomes in drugs for treating aging and the use of stem cell exosomes in the preparation of products for restoring the cell cycle of senescent cells. Furthermore, it is provided that stem cell exosomes can be used to prevent and treat age-related diseases caused by cell aging.

Description

Technical Field

[0001] The present application belongs to the field of biomedicine, and specifically relates to the application of stem cell exosomes in drugs for preventing or treating aging. Background Art

[0002] Aging can be divided into several levels: individual aging, organ aging, and cell aging. The aging of individuals and organs is ultimately reflected in cell aging. Cell aging refers to the "permanent blockage of the cell cycle", which means that cell aging is irreversible. If cell aging can be reversed, it also means "reversing aging". With the improvement of human quality of life, the issue of aging has become increasingly concerned. The development of new anti-aging drugs has both great social significance and huge commercial value.

[0003] Stem cells are a type of cell that has the ability to self-renew, proliferate and differentiate indefinitely under certain conditions. They can produce daughter cells with the same phenotype and genotype as themselves, as well as specialized cells that make up the body's tissues and organs, and can also differentiate into progenitor cells. There are many ways to classify stem cells. Depending on the stage of development, stem cells can be divided into embryonic stem cells and adult stem cells. Among them, embryonic stem cells are a type of cell isolated from early embryos or primitive gonads, which have the characteristics of unlimited proliferation, self-renewal and multidirectional differentiation in vitro culture. According to different differentiation potentials, stem cells can be divided into totipotent stem cells, pluripotent stem cells and unipotent stem cells.

[0004] Exosomes (exo) refer to small vesicles secreted by cells with a diameter of 30nm to 150nm, containing complex RNA and proteins. In 1983, exosomes were first discovered in sheep reticulocytes, and Johnstone named them "exosomes" in 1987. A variety of cells can secrete exosomes under normal and pathological conditions, and exosomes exist naturally in body fluids, including blood, saliva, urine, cerebrospinal fluid and milk. Its morphology is a cup-shaped structure or a hemispherical shape with a concave side, and it has a distinct membrane structure. The membrane structure of exosomes is a phospholipid bilayer like the cell membrane. Transmembrane proteins, some lipids and ligands are distributed on the membrane, including CD9, CD63 and CD81, members of the 4-transmembrane protein family, and the vesicles contain very rich proteins, DNA and RNA. A large number of studies have shown that exosomes can mediate cell-to-cell communication. Then there are three main ways to mediate communication: First, exosome membrane proteins can bind to target cell membrane proteins, thereby activating signal pathways in target cells. Second, in the extracellular matrix, exosome membrane proteins can be cleaved by proteases, and the cleaved fragments can act as ligands to bind to receptors on the cell membrane, thereby activating intracellular signaling pathways. Third, the exosome membrane can directly fuse with the target cell membrane, non-selectively releasing the proteins, mRNA, and miRNA it contains. Exosomes have inherent disease treatment potential because they carry many proteins, nucleic acids, and lipids. In particular, exosomes derived from stem cells play an important role in angiogenesis, inhibition of apoptosis, immune signaling, and tissue regeneration. For embryonic stem cells, exosomes can not only exert a therapeutic effect comparable to that of stem cells but also avoid the ethical and tumorigenic issues of embryonic stem cells, so they have a relatively outstanding application value. Summary of the invention

[0005] Based on this, it is necessary for the present application to provide an application of stem cell exosomes in a drug for preventing or treating aging, wherein the drug can reverse the aging process and restore the cell cycle and proliferation ability of senescent cells.

[0006] The specific technical solutions are as follows:

[0007] In a first aspect, the present application provides the use of stem cell exosomes in drugs for preventing or treating aging.

[0008] The second aspect of the present application provides the use of stem cell exosomes in the preparation of a product for restoring the cell cycle of senescent cells.

[0009] The third aspect of the present application provides the use of stem cell exosomes in products for restoring or promoting the proliferation of senescent cells.

[0010] The fourth aspect of the present application provides the use of stem cell exosomes in products for preventing or treating diseases related to cell aging.

[0011] Compared with the prior art, this application has the following beneficial effects:

[0012] The present application found through the senescent cell model that stem cell exosomes can make senescent cells with cycle arrest return to the cell cycle, that is, the senescent cells divide and proliferate again. This discovery breaks the current theory that "cell senescence is irreversible". Based on this, the present application provides the use of stem cell exosomes in drugs for treating aging and the use of stem cell exosomes in the preparation of products for restoring the cell cycle of senescent cells. Furthermore, it provides that stem cell exosomes can be used to prevent or treat age-related diseases caused by cell senescence. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the result of flow cytometry sorting;

[0014] Figure 2 Detection of senescence of p21-YFP-Neo cell line Expression of p21-YFP under fluorescence microscopy;

[0015] Figure 3 This is the β-gal staining picture;

[0016] Figure 4 are the results of exosome identification, among which A is the result of transmission electron microscopy, B and C are the results of particle size analysis, and D is the result of immunoblotting identification;

[0017] Figure 5 is the cell doubling curve over time;

[0018] Figure 6 The results of Ki67 staining of cells; A is the immunofluorescence results of Ki67, P21, and DAPI of three groups of cells, and B is the enlarged picture of a single cell in Figure A;

[0019] Figure 7 The results of β-gal staining, A is the staining image, and B is the quantification image of A;

[0020] Figure 8 The live cell workstation tracks the proliferation of senescent cells treated with exosomes from embryonic stem cells, with each image taken 6 hours apart;

[0021] Fig. 9 is the transcriptome sequencing result;

[0022] Fig.10 The figure is the verification of the omics results; A is the qPCR result of aging markers; B is the qPCR result of inflammation-related indicators; C is the protein expression result of aging markers; D is the quantification graph of C;

[0023] Fig.11The results of cell cycle detection of senescent cells after treatment with embryonic stem cell exosomes. A is the flow cytometry graph, and B is the quantification graph of A.

[0024] Fig.12 This is a flow chart for the preparation of senescent cells of LO2-P21-YFP cells after Dox induction;

[0025] Fig.13 Sequencing cell cycle results for single cells;

[0026] Fig.14 To use the marker gene dimensionality reduction cluster analysis;

[0027] Fig.15 The proportion of cells in the three states was analyzed for annotation;

[0028] Fig.16 Results of gene enrichment analysis; A is a heat map of differentially expressed genes; B is a cell population; C is a KEGG analysis; D is genes specifically expressed in three cell populations and KEGG analysis; E is gene expression enrichment of aging cells (LO2-O), young cells (LO2-Y) and intermediate cells (LO2-M) in the three cell populations; F is a bubble map of differential gene expression in the three cell populations.

[0029] Fig.17 Schematic diagram of exosome therapeutic strategy;

[0030] Fig.18 The results are for the survival of mice;

[0031] Fig.19 Photos of 30-month-old mice in the embryonic stem cell exosome treatment group and the aging group;

[0032] Fig. 20 These are the results of the endurance (Figures A-B) and grip strength (Figure C) experiments;

[0033] Fig.21 is the urine spot result; A is the urine spot image, and B is the quantitative image of A;

[0034] Fig. 22 β-gal staining for multiple organs. The left picture is a characteristic picture. The right picture is a statistical picture of four organs. The bar graphs from left to right are Young group, Aging-pbs group, and Aging-Exos group.

[0035] Fig.23 Different cell populations of PBMC in the blood;

[0036] Fig.24 is the cell cycle ratio; A is the G1 / S / G2M percentage of the three samples in the Aging group and the Exos group; B is the statistical result;

[0037] Fig.25 The following are the results of single-cell sequencing of the skin, where A is the relative proportion of cells in a specific group of skin cells in the three groups; B is the number of up-regulated and down-regulated genes, and DEGs are differentially expressed genes; C is the different cell groups in skin tissue; D is the proportion of the overall cell cycle in the three groups of samples; E is the number of up-regulated and down-regulated genes in differentially expressed cell cycle-related genes (CCGS); F is the proportion of genes in different cell cycles, following a pseudo-temporal trajectory from the aging state (Sen) to the young state (You); H is the differentially expressed genes in different cell groups, monocle1 is a highly expressed gene in aging cells, and monocle2 is a highly expressed gene in young cells; I is a heat map of differential gene expression. DETAILED DESCRIPTION

[0038] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0040] The selection scope of the term "and / or" used in this application includes any one of two or more related listed items, and also includes any and all combinations of the related listed items, and the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. For example, "A and / or B" includes three parallel schemes of A, B and A+B. For another example, the technical scheme of "A, B, C, and / or, D" includes any one of A, B, C, and D, and also includes any and all combinations of A, B, C, and D, that is, including any combination of any two or any three of A, B, C, and D, and also includes a combination of four items of A, B, C, and D.

[0041] In this application, "multiple", "multiple", "multiple times", "multiple groups", etc., unless otherwise specified, refer to a number greater than or equal to 2. For example, "one or more" means one or greater than or equal to two. "More than" includes the number itself, for example, "more than two" includes two, three or more.

[0042] In the present application, “preferred” is only used to describe an implementation method or example with better effects, and it should be understood that it does not constitute a limitation on the scope of protection of the present application.

[0043] In the present application, "further", "further" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0044] In the present application, the terms "first", "second", "third" and "fourth" are used for descriptive purposes only and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third" and "fourth" only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0045] In the early stage of the research, the inventors constructed a LO2-P21-YFP positive cell line, used Doxorubicin to induce senescence of the LO2-P21-YFP cell line, and obtained a senescent cell model after flow cytometry sorting using YFP. Furthermore, the above senescent cell model was used to screen anti-aging drugs. The purpose of inserting the YFP gene fragment was to efficiently screen anti-aging drugs. Only by detecting YFP fluorescence, it can be determined whether the candidate drug can be used as an anti-aging drug. In the drug screening process, it was found that embryonic stem cell (ES) exosomes can reverse the aging process of senescent cells, restore senescent cells to re-enter the cell cycle, and restore their proliferation ability, which was further confirmed in animals.

[0046] Currently, senescent cells are defined as cells whose cell cycle is permanently terminated. However, this application found that senescent cells do not have a permanent cell cycle termination, but a temporary stop, and the cell cycle can be restored by exogenous factors. This discovery is a disruptive result that will bring new ideas and new potential drugs to aging, a major problem that needs to be solved urgently.

[0047] Therefore, one embodiment of the present application provides a use of stem cell exosomes in a drug for preventing or treating aging.

[0048] In a specific example, aging includes one or more of individual aging, organ aging, and cell aging.

[0049] In a specific example, the stem cell exosomes include at least one of embryonic stem cell exosomes, mesenchymal stem cell exosomes, and induced pluripotent stem cell exosomes.

[0050] In a preferred embodiment, the stem cell exosomes are embryonic stem cell exosomes.

[0051] In a specific example, the stem cell exosomes are mouse stem cell exosomes or human stem cell exosomes. Of course, in other examples, the stem cell exosomes can also be derived from other mammals, such as dogs, cats, etc.

[0052] In one embodiment, treatment includes delaying, arresting, reducing, stopping and / or reversing the effects or process of aging.

[0053] One embodiment of the present application also provides the use of stem cell exosomes in preparing a product for restoring the cell cycle of senescent cells.

[0054] In a specific example, the product may include a preparation or a medicine, etc.

[0055] In one specific example, stem cell exosomes have the characteristic of promoting senescent cells to re-enter the S phase of the cell cycle.

[0056] In a specific example, the stem cell exosomes include at least one of embryonic stem cell exosomes, mesenchymal stem cell exosomes, and induced pluripotent stem cell exosomes.

[0057] In a preferred embodiment, the stem cell exosomes are embryonic stem cell exosomes.

[0058] In a specific example, the stem cell exosomes are human stem cell exosomes or stem cell exosomes derived from other mammals.

[0059] In a specific example, a method for isolating stem cell exosomes comprises the following steps: collecting stem cell culture supernatant; and extracting exosomes using a gradient centrifugation scheme.

[0060] Specifically, the cell culture supernatant was centrifuged in a low-speed low-temperature centrifuge for 3 to 6 minutes to remove dead cells; 1500g to 2500g, low-temperature centrifugation for 15 to 20 minutes to remove cell debris; 10000g low-temperature centrifugation for 20 to 30 minutes to further remove large vesicles; and then centrifuged at 100,000g, low-temperature centrifugation for 60 to 90 minutes. The precipitate after centrifugation was resuspended with PBS, and centrifuged again at 100,000g, low-temperature centrifugation for 60 to 90 minutes to purify exosomes, and an appropriate amount of PBS was added to resuspend the exosomes, filtered and sterilized, and the concentration was determined and packaged for low-temperature storage.

[0061] One embodiment of the present application also provides a use of stem cell exosomes in a product for restoring or promoting the proliferation of senescent cells.

[0062] In a specific example, the stem cell exosomes include at least one of embryonic stem cell exosomes, mesenchymal stem cell exosomes, and induced pluripotent stem cell exosomes.

[0063] In a preferred embodiment, the stem cell exosomes are embryonic stem cell exosomes.

[0064] One embodiment of the present application also provides the use of stem cell exosomes in products for preventing or treating diseases related to cell aging.

[0065] In a specific example, the related diseases caused by cell aging include, but are not limited to, one or more of skin aging, hair loss, hypertension, cardiovascular and cerebrovascular diseases, degenerative joint diseases, osteoporosis, diabetes, fatty liver and cirrhosis, gonadal atrophy, renal dysfunction, depression, Parkinson's disease, Alzheimer's disease, multiple organ function degeneration, cataracts, tooth loss and hearing impairment.

[0066] In a specific example, the disease associated with cellular senescence is skin aging and / or hair loss.

[0067] In a specific example, the stem cell exosomes include at least one of embryonic stem cell exosomes, mesenchymal stem cell exosomes, and induced pluripotent stem cell exosomes.

[0068] In a preferred embodiment, the stem cell exosomes are embryonic stem cell exosomes.

[0069] One embodiment of the present application also provides a drug for reversing aging, wherein the active ingredient of the drug is stem cell exosomes.

[0070] In a specific example, the drug can be used in combination with other drugs for treating aging, and the method of combined use includes encapsulating other drugs for treating anti-aging on the stem cell exosomes. Optionally, other drugs for treating aging include proteins or RNAs that inhibit aging, or inhibitors of proteins or RNAs that promote aging, and optional inhibitors include substances that can knock down or knock out protein or RNA expression or activity, such as siRNA or shRNA, and of course other substances with similar functions.

[0071] In a specific example, the drug further includes a pharmaceutically acceptable excipient.

[0072] In a more specific example, the pharmaceutical excipient or pharmaceutically acceptable excipient is selected from at least one of the following: solvent, propellant, solubilizer, cosolvent, emulsifier, colorant, binder, disintegrant, filler, lubricant, wetting agent, osmotic pressure regulator, stabilizer, glidant, flavoring agent, preservative, suspending agent, coating material, fragrance, anti-adhesive agent, integrator, penetration enhancer, pH regulator, buffer, plasticizer, surfactant, foaming agent, defoamer, thickener, inclusion agent, humectant, absorbent, diluent, flocculant, deflocculating agent, filter aid, release retardant.

[0073] According to the content of this application, for different needs in actual production applications, combined with conventional technical means in the field of drug preparation (for example, "Encyclopedia of Preparation Technology", "Drug Preparation Technology", etc.), technical personnel in this field can select and formulate the above-mentioned excipients, and prepare the drugs of this application into different dosage forms, such as oral liquid, powder, tablet, capsule, granule, decoction, pill, spray, inhalant, atomizer, injection, etc.

[0074] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0075] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0076] Example 1 Preparation of Cell Senescence Model by Doxorubicin-Induced LO2-p21-YFP Cell Line

[0077] In the early stage of the research, the inventor used CRISPR / Cas9 technology to perform gene editing with the help of Cas9, gRNA, and p21-YFP donor. Specifically, the YFP gene fragment was inserted into the position of the terminator codon of p21 in the LO2 cell line, and the LO2-P21-YFP positive cell line was screened.

[0078] Specifically, construct a CRISPR / Cas9 vector: construct a CRISPR / Cas9 vector using a gRNA sequence, wherein the sequence of the gRNA is GGCTTCCTGTGGGCGGATTA, SEQ ID No: 1.

[0079] Synthesis of p21-YFP donor plasmid: First, the sequence of the YFP coding gene (bases at positions 3536 to 4252 shown in SEQ.ID No.2) was inserted into the Venus-P2A-Neo plasmid to prepare the YFP-P2A-Neo plasmid. Using LO2 cell genomic DNA and the YFP-P2A-Neo plasmid as templates, the primers in Table 1 were used to amplify the Vector fragment, p21Upstream fragment, YFP-NeoR fragment, and p21 Downstream fragment, and the above four fragments were assembled into the p21-YFP donor plasmid (the donor plasmid sequence is shown in SEQ.ID No.2) using the Gibson reaction system. The above experiments were all performed by Sangon Biotech.

[0080] Table 1

[0081]

[0082] Furthermore, the CRISPR / Cas9 vector containing gRNA and the p21-YFP donor plasmid were co-transfected into LO2 cells to screen the LO2-P21-YFP positive cell line.

[0083] Furthermore, Doxorubicin was used to induce senescence of the LO2-P21-YFP cell line, and a senescent cell model was obtained after flow cytometry sorting using YFP.

[0084] P21 (cyclin-dependent kinase inhibitor p21, CDKN1A) is an important aging marker. P21 is the downstream CDKI of phosphorylated P53, which blocks the cell cycle from entering the G1 / S cell cycle by binding to CDK2. High expression of P21 is associated with aging.

[0085] Doxorubicin is a DNA topoisomerase inhibitor, commonly used in tumor treatment, and can induce cell senescence at a low concentration of 50nM. Due to the quinone-hydroquinone structure on the anthracene ring ligand in the Doxorubicin molecule, it has the ability to accept electrons and provide neutrons, inserting between adjacent base pairs of DNA to generate active free radicals, causing the DNA double helix to unwind, DNA chain to break, inhibiting the template activity of nucleic acids, interfering with the transcription process, and inhibiting mRNA synthesis. In addition, it may also cause cell membrane rupture and exhibit cytotoxic effects. It is a non-specific drug for the cell cycle and has an effect on cells in all phases, but is most sensitive to the early S phase, followed by the M phase, and least sensitive to the G1 phase, and has a delaying effect on the G1, S and G2 phases.

[0086] Specifically, the steps of Doxorubicin inducing senescence of p21-YFP-Neo cell line include the following:

[0087] (1) 0.3x10 6 LO2-p21-YFP cells were seeded into 35 mm laser confocal cell culture dishes and cultured for 12 hours.

[0088] (2) After the cells adhered, the medium was changed and culture medium containing 50 nM Doxorubicin was added.

[0089] (3) After 24 hours, replace the culture medium with normal culture medium.

[0090] (4) After 4 days of culture, YFP was used for flow cytometry sorting to observe the expression of p21-YFP in the sorted cells.

[0091] (5) Perform senescence-related β-galactosidase staining.

[0092] Wherein, the β-galactosidase staining method comprises the following steps:

[0093] Dilute 10X Fixative Solution to 1X, and thoroughly dissolve Staining Solution in a 37°C water bath and dilute to 1X; dissolve 20 mg of X-gal in DMF and store at -20°C away from light; prepare staining solution, add 1 mL of staining solution to each well of a 6-well plate, 930 μL 1X Staining Solution, 10 μL 100X Staining Solution A, 10 μL 100X Staining Solution B and 50 μL 20 mg / mL X-gal to make 1 mL of staining solution, and adjust the pH to 6.0; remove the cell culture supernatant, add PBS to wash twice, add 1 mL 1X Fixative Solution to each empty space of the 6-well plate and fix at room temperature for 15 minutes; remove the fixative, wash once with PBS, add staining solution, and place in a carbon dioxide-free incubator at 37°C for staining for 12 hours; place the culture dish under a microscope to observe the staining.

[0094] By setting the gate with FITC fluorescence, YFP-positive cells were selected for sorting. The results are as follows: Figure 1 shown.

[0095] The sorted cells were plated and 0.3 x 10 6 The cells were seeded in 35 mm cell culture dishes and imaged by fluorescence microscopy. Figure 2 As shown, Doxorubicin can induce the expression of p21-YFP.

[0096] β-galactosidase staining results Figure 3 As shown, the addition of Doxorubicin can induce senescence of the LO2-p21-YFP cell line, indicating that the cell senescence model was successfully constructed.

[0097] Example 2 Isolation and identification of embryonic stem cell exosomes

[0098] 1. Embryonic stem cell (ES) culture:

[0099] Human embryonic stem cell h9 cells were plated in a culture dish coated with matrigel, and the culture medium was hESC-ncTarget. The medium was changed every day, and when the cells were full, EDTA cell passage working solution was added to digest the cells, and the cells were passaged at a ratio of 1:8.

[0100] 2. Exosome extraction:

[0101] (1) Collect the culture supernatant for exosome extraction.

[0102] (2) Gradient centrifugation was used to extract exosomes. The cell culture supernatant was centrifuged at 300g and 4°C for 5 minutes to remove dead cells; 2000g and 4°C for 20 minutes to remove cell debris; 10,000g and 4°C for 30 minutes to further separate vesicles; and then ultracentrifuged at 100,000g and 4°C for 90 minutes.

[0103] (3) The pellet after ultracentrifugation was resuspended in 50 ml of PBS and ultracentrifuged again at 100,000 × g and 4°C for 90 min to further purify the exosomes.

[0104] (4) Add an appropriate amount of PBS to resuspend the exosomes, filter and sterilize using a 0.22 μm filter, measure the concentration using the BrandFord method, and then aliquot and store at -80°C.

[0105] 3. Exosome identification:

[0106] Transmission electron microscopy was used to observe the morphology of exosomes. Figure 4 As shown in A, the extracted ES exosomes are typical double-membrane vesicles with a clear cup-shaped structure.

[0107] The particle size analysis results are as follows Figure 4 As shown in Figure BC, the average particle size of ES exosomes was 133.161 nm, and was mainly distributed in the range of 50 to 200 nm, showing a relatively normal distribution.

[0108] Immunoblotting was used to identify exosome markers Calnexin (negative), TSG101, and CD63. Figure 4As shown in D, the isolated ES exosomes expressed exosome marker proteins CD63 and TSG101, while the negative protein Calnexin was not expressed.

[0109] Example 3 Embryonic stem cell exosomes induce LO2 senescent cells to regain proliferation ability

[0110] Dox-induced senescent cells were screened by flow cytometry according to Example 1. Senescent cells were plated and 3×10 5 Cells, 10 μL of 2 mg / mL Exos was added to each well of the Dox-Exos group and treated for 1 day; 10 μL of PBS solution was added to each well of the Dox-PBS group and treated for 1 day, and the LO2 normal cell group (Con) was set as a control, and cells were collected for cell proliferation detection. After ES exosomes, it was unexpectedly found that the number of senescent cells increased with the culture time, see Figure 5 , indicating that senescent cells may have proliferated. Further testing of proliferation signals revealed Figure 6 As shown in the figure, in addition to the decrease in P21 fluorescence intensity, a large number of cells in the Dox plus exosome group were Ki67 positive, that is, the signal of proliferation marker increased, while the expression of P21 as a senescence marker decreased. Furthermore, β-gal staining was performed, as shown in Figure 7 As shown, the proportion of senescent cells in normal LO2 cells was less than 5%, while more than 80% of the cells in the senescent cell group were senescent. About 15% of the cells in the group adding ES exosomes were senescent, which significantly reduced the proportion of senescent cells.

[0111] To further verify whether the addition of ES exosomes to senescent cells resulted in proliferation, we used a high-content laser confocal cell imaging analysis system (Opera Phenix, PerkinElmer Enterprise Management Co., Ltd.) to track the long-term changes of single cells. Figure 8 As shown, the proliferation of single cells added with ES exosomes was tracked. The definition of cell senescence is a permanent cell cycle termination state, which also means that the definition of senescent cells will be rewritten, that is, senescent cells are not permanently terminated in the cell cycle, but temporarily stopped, and the cell cycle can be restored by exogenous factors.

[0112] Furthermore, we performed transcriptome sequencing of the three groups of cells, and the results were as follows: Fig. 9 As shown in Figure 2, the key genes with the largest differences are directly related to the cell cycle, such as TP53 / MYC / PCNA / P21, etc. Further, we verified the expression of some of these key genes, and the results are shown in Figure 2. Fig.10 As shown. Fig.10Figure A shows the qPCR results of aging markers P16, P21, and P53. It can be seen that the expression of aging markers in the aging group was significantly increased, and the expression of aging markers in the ES exosome group was significantly restored. Fig.10 Figure B shows the qPCR results of inflammation-related indicators. The expression of inflammation-related indicators in the aging group was significantly increased, and the inflammation-related indicators in the group with ES exosomes were also significantly restored. We further detected the expression of aging markers P16 and P21 protein levels. Fig.10 As shown in CD, consistent with the RNA level, the aging group was significantly upregulated, and the group with ES exosomes added significantly restored.

[0113] Wherein, the amplification primers of P16, P21, and P53 are as follows:

[0114] p53:

[0115] F-CCTCAGCATCTTATCCGAGTGG, SEQ ID NO.11,

[0116] R-TGGATGGTGTACAGTCAGAGC, SEQ ID NO. 12;

[0117] p16:

[0118] F-CTCGTGCTGATGCTACTGAGGA, SEQ ID NO.13,

[0119] R-GGTCGGCGCAGTTGGGCTCC, SEQ ID NO.14;

[0120] p21:

[0121] F-AGGTGGACCTGGAGACTCTCAG, SEQ ID NO.15,

[0122] R-TCCTCTTGGAGAAGATCAGCCG, SEQ ID NO. 16.

[0123] Further, we performed a cell cycle assay. Specifically, the cells were digested with a trypsin substitute and centrifuged at 1000xg for 5 min. The cells were washed with 1 mL of pre-cooled saline, centrifuged at 1000xg for 5 min, and the supernatant was carefully aspirated. When aspirating, 50 μl of supernatant remained to avoid aspirating the cells. The bottom of the centrifuge tube was flicked to properly disperse the cells to avoid cell clumping. 1 mL of pre-cooled 70% ethanol was added, and the mixture was gently pipetted and mixed. The cells were fixed at 4°C for 24 hours. Centrifuged at 1000xg for 5 min, the supernatant was discarded, and 50 μl of supernatant remained to avoid aspirating the cells. 1 mL of pre-cooled saline was added to wash the cells once. 0.5 mL of PI staining solution was added to each tube of sample, the cells were slowly and fully resuspended, and the cells were stained at 37°C in the dark for 30 min. After staining, the cells were detected by flow cytometry with an excitation wavelength of 488 nm.

[0124] The preparation of PI staining solution: 500 μl of staining buffer, 25 μl of PI staining solution (20×), 10 μl of RNaseA, and a total volume of 535 μl.

[0125] The results are as follows Fig.11 As shown, about 32% of LO2 normal cells are in the S phase, about 8% of LO2 cells are in the S phase after Dox treatment and PBS addition, and about 18% of LO2 cells are in the S phase after Dox treatment and embryonic stem cell exosomes addition, which is significantly higher than the PBS addition group. This indicates that embryonic stem cell exosomes can make senescent cells re-enter the cell cycle, thereby reversing aging.

[0126] Example 4 Single-cell sequencing analysis after embryonic stem cell exosome treatment

[0127] For specific operation procedures, please refer to Fig.12 As shown, LO2-P21-YFP cells were induced with 50 nM Dox for 5 days, and the induced senescent cells were screened by flow cytometry;

[0128] Senescent cells were plated and 0.3x10 cells were seeded per well. 6 Cells were placed in 35 mm cell culture dishes, 10 μL of 2 mg / mL Exos were added to each well and treated for 1 day; cells were collected for single-cell sequencing analysis.

[0129] Among them, the preparation and sequencing of single-cell sequencing samples: the prepared single-cell suspension is mixed with a mixture of gel beads and enzymes containing barcodes, and then encapsulated by oil droplets located in the microfluidic "single cross" connection to form GEMs (GelBead-In-Emulsion), followed by cell lysis and reverse transcription reactions in GEMs. This experiment uses the 10×Genomics system for single-cell transcriptome sequencing, with a sequencing depth of 150G. The original image is converted into Rawdata after GASAVA base recognition, and the single-cell sequencing is completed by Shanghai Paisono Biotechnology Co., Ltd.

[0130] Single-cell data analysis: The raw data obtained by single-cell sequencing was analyzed according to the analysis process provided by 10×Genomics (https: / / www.10xgenomics.com / support / single-cell-gene-expression), which mainly includes quality control, data integration, cell clustering, cell annotation, differential gene enrichment analysis, pseudo-time series analysis, etc. The sequencing data was mainly completed by software packages such as Seurat, monocles3, and CellChat in R software.

[0131] Data quality control and standardization: Single-cell sequencing data is high-dimensional, sparse, and contains a lot of noise. Good quality control is the basis for effective data analysis. The Read10 function in the Seurat package is used to read the sequencing data, the merge function integrates the data of different groups together, and then adds mitochondrial and ribosome information. We perform quality control based on the following three parameters:

[0132] (1) The number of genes and sequences detected in each cell. These two criteria ensure the abundance and richness of gene expression detected in each cell under analysis. The higher the value, the stricter the requirement for cell expression. A relatively loose threshold is used by default. The minimum threshold of both indicators is 100, and the maximum value is unlimited. This experiment is set at 200. <nFeature_RNA<6000。

[0133] (2) The ratio of mitochondrial and ribosomal genes obtained by sequencing. Excessive mitochondrial gene expression indicates that the cell is in a dying state before lysis, and its nuclear gene expression will tend to genes related to cell activity pathways (such as apoptosis). If such cells are not removed, the analysis may lead to erroneous conclusions due to poor cell status. In this experiment, the mitochondrial gene ratio is set to <5%. The ribosomal gene expression ratio represents the proportion of cell rRNA contamination. A high value means that mRNA is not sufficiently enriched. A qualified 10× kit and experimental operation steps will not lead to a low degree of mRNA enrichment. Therefore, the default threshold of this indicator is 100, that is, this indicator is not used, but the threshold can be set according to the purpose of the experiment.

[0134] (3) Cell cycle. The cell cycle is a strictly controlled event of DNA replication and mitosis. One of the sources of noise pollution in single-cell sequencing data is the cell cycle. The same cell is in different states, and its expression genes will be greatly different due to different cell cycles. This difference will interfere with the performance of the cell annotation clustering algorithm and cause the same cells to be divided into different cell populations. According to the scoring strategy designed by Tirosh, we score the gene expression in the S phase and G2M phase to predict the cycle stage of each cell. Based on the scoring results, we remove cell cycle heterogeneity when scaling the gene UMIs data. The Seurat function is used to obtain the cell cycle, and the G2M and S phase markers are used to assign cell cycle scores to cell populations.

[0135] The expression levels of markers in different phases should show a negative correlation, and cells that do not express G2M and S phase markers are judged to be in the G1 phase.

[0136] The proportion of cells in the S phase increased after Exos intervention. Fig.13 shown.

[0137] Dimensionality reduction clustering and grouping: dim = 1:30, resolution = 0.6, a total of 12 clusters were obtained, and all clusters were annotated using proliferation markers PCNA and MKI67 and senescence markers p21 and p53 as marker genes, such as Fig.14 shown.

[0138] The younger cells were annotated by expressing proliferation markers, and the older cells were annotated by expressing senescence markers. After the cells were annotated, the proportions of three different types of cell populations, namely, senescent cells (LO2-O), young cells (LO2-Y), and intermediate cells (LO2-M), were analyzed. Fig.15As shown, the proportion of young cells in the ES exosome group (Rejuvenation group) was about 25.2%, which was higher than 15.3% in the control group, and the proportion of senescent cells was about 14.7%, which was lower than 30.7% in the control group.

[0139] Furthermore, heat map analysis was performed on the three types of cell populations, and the top expressed genes were listed; enrichment analysis was performed on the top expressed genes, such as Fig.16 shown.

[0140] Example 6: Embryonic stem cell exosomes reverse aging in mice

[0141] Treatment strategy algorithm see Fig.17 As shown, 20-month-old C57BL / 6 male mice were used in each group, and exosomes (30 μg of exosomes dissolved in 200 μl of PBS) and PBS (200 μl) were administered through the tail vein twice a week for 1 month. Among them, 15 mice were used to observe the survival of the mice. Fig.18 As shown, the results showed that the median survival time of normal mice was about 25 months, while the median survival time of the exosome tail vein administration group was about 30 months, and the longest survival time could reach 39 months, significantly increasing the lifespan of mice.

[0142] The results are as follows Fig.19 As shown in the figure, compared with the old mice group (30 months old), the old mice given embryonic stem cell exosomes showed significantly alleviated hunched back and hair loss, further suggesting that embryonic stem cell exosomes have the ability to reverse aging in animals. Furthermore, the rotarod test was performed on mice at 29-30 months of age. Fig. 20 -A, the mice were placed on the rotating rod and the speed was increased from 8rpm to 80rpm in 300s. The timer was stopped when the mice fell or jumped off. The time the mice spent on the rotating rod was counted. After 4 training sessions (once every two days), the mice started to have significant differences in the exosome treatment group compared with the control group from the fifth training session. Further, the rotating rod was kept at 25rpm and the time the mice spent on the rotating rod was counted. The results are as follows Fig. 20 -B shows that the exosome treatment group lasted about 55 seconds, which was significantly longer than the control group of about 32 seconds. Further, the grip strength test was conducted. The average of the three grip strength results was divided by the body weight and measured every two days. The results are as follows Fig. 20 -C shows that the exosome treatment group is better than the control group. The above results show that the ES exosome treatment group has significantly alleviated aging.

[0143] Old mice often have symptoms of overactive bladder (OAB), which is characterized by frequent and urgent urination with or without urinary incontinence. Old mice tend to urinate in small amounts and multiple times, with small spots visible on the filter paper, while young mice mainly have large spots. Fig.21 As shown, OAB symptoms were significantly alleviated after ES exosome treatment.

[0144] Furthermore, β-gal staining was performed on the pathological sections of multiple organs of mice to detect the level of tissue senescence, such as Fig. 22 As shown, aged mice (30 months old) showed positive β-gal staining in multiple organs such as kidney / liver / lung / spleen compared with young mice (12 months old), and the symptoms were significantly alleviated after ES exosome treatment.

[0145] Example 7 Single-cell sequencing of mouse PBMC

[0146] Mouse PBMCs were obtained and isolated as follows:

[0147] Take out the lymphocyte separation solution from 4℃ in advance, restore it to room temperature, and transfer 4mL to a 15mL test tube for later use. Take 1mL of blood sample from the mouse eyeball and place it in an EDTA sodium blood collection tube. Take 1mL of blood and dilute it with DPBS 1:1. Use a sterile pipette to absorb the diluted blood and slowly add it to the surface of the human lymphocyte separation solution along the tube wall. Slowly do not shake the centrifuge tube to keep the interface clear, put it into a horizontal centrifuge, 800g, 4℃ centrifuge for 20min. After centrifugation, carefully take out the 15mL test tube. After centrifugation, the tube can be divided into three layers. At the interface between the upper and middle layers, there is a narrow band of white cloud layer dominated by mononuclear cells, which is the mononuclear cells we need. Use a sterile pipette to absorb the mononuclear cells in the narrow band of the white cloud layer and place it in another 15mL centrifuge tube, add 5mL DPBS+2% FBS, and centrifuge at 1500rpm at 4℃ for 5min. Discard the supernatant, add the precipitate to the red blood cell lysis solution, let it stand at room temperature for 2min, and centrifuge at 800rpm for 5min. Discard the supernatant, add 5 mL DPBS + 2% FBS to the precipitate, and centrifuge at 500 rpm and 4°C for 5 min. Repeat this step once. Discard the supernatant, add 200 μL DPBS + 2% FBS to resuspend the cells, perform cell counting and viability determination, and aspirate an appropriate volume of cell suspension for subsequent experiments.

[0148] Single-cell sample preparation and sequencing: The prepared single-cell suspension is mixed with a mixture of gel beads and enzymes containing barcodes, and then encapsulated by oil droplets in the microfluidic "single cross" connection to form GEMs (Gel Bead-In-Emulsion), followed by cell lysis and reverse transcription reactions in GEMs. This experiment uses the 10×Genomics system for single-cell transcriptome sequencing, with a sequencing depth of 150G. The original image is converted into Raw data after GASAVA base recognition. The single-cell sequencing is completed by Shanghai Paisono Biotechnology Co., Ltd.

[0149] For the single cell data analysis method, see Example 4.

[0150] Seurat package was used to score the cell cycle stages of different samples and determine the cell cycle stage. Fig.23 shown.

[0151] The proportion of cells in different cell cycle phases was counted and quantified, e.g. Fig.24 As shown, the proportion of G1 and G2M phases in the Ageing group increased, indicating that cell cycle arrest occurred in PBMCs in the Ageing group; Exos treatment increased the proportion of cells in the S phase of PBMCs.

[0152] Example 8 Single-cell sequencing of mouse skin

[0153] Experimental groups: 3 rats were selected from each of the 12-month-old, 30-month-old, and 30-month-old ES exosome treatment groups for single-cell sequencing of skin tissue.

[0154] Sampling: The dorsal skin was separated along the fascia with dissecting scissors, and the subcutaneous fat was further trimmed and rinsed with cold PBS 5 times. The skin was further minced with ophthalmic scissors, enzymatically digested with Liberase DL (Roche, 0.5 mg / mL) for 1 hour, and filtered with a 40 μm nylon filter.

[0155] For single cell sample preparation and sequencing, sample preparation, sequencing and analysis process, please refer to Example 7.

[0156] Results Fig.25 Skin cells are divided into different groups according to surface markers ( Fig.25 -A), differentially expressed genes see Fig.25 -B, cell cycle analysis see Fig.25 -CD, it can be seen that about 20% of the skin of 30-month-old mice is in the S phase, about 40% of the skin of 12-month-old mice is in the S phase, and about 32% of the skin of 30-month-old mice treated with ES exosomes is in the S phase, that is, the proliferation ability of skin cells is significantly improved after treatment. Further analysis of differentially expressed genes in CCGs subgroups was performed ( Fig.25 -E), and G1 / S and G2 / M were analyzed. The results showed that the number of cells in S phase increased after exosome treatment ( Fig.25 -FG). Cell cycle-related genes were further analyzed, differentially expressed genes were counted and functional analysis was performed ( Fig.25 -HI).

[0157] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0158] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description and drawings may be used to interpret the contents of the claims.

Claims

1. Use of stem cell exosomes in the preparation of a product for restoring senescent cells to re-enter the cell cycle and proliferate, wherein the stem cell exosomes are human embryonic stem cell exosomes; the product has the characteristic of enabling senescent cells with cell cycle arrest to re-enter the S phase of the cell cycle; the senescent cells are senescent liver cells and / or blood PBMC cells.

2. The use according to claim 1, characterized in that: The product has the effects of improving aging-related hair loss, decreased athletic ability due to aging, decreased coordination ability due to aging, and overactive bladder due to aging.

3. The use according to claim 2, characterized in that: The product has the effect of treating skin aging by reducing the proportion of immune cells (IC) and fibroblast (Fib) subpopulations and increasing the proportion of hair follicle cells (VHFC) subpopulations in aging skin cells.

4. The use according to claim 1 or 2, characterized in that: The product has the effects of increasing the proportion of the S phase in the PCNA+MKI67 cell population in aged skin and reducing the proportion of the G1 phase, thereby achieving the effect of treating skin aging.

5. The use according to claim 1 or 2, characterized in that: The product has the effect of reducing the expression of P53, P16, P21, IL6, IL1a, MMP3 and TGFβ in senescent liver cells.

6. The use according to claim 1 or 2, characterized in that: The product has the effect of increasing the proportion of PCNA+MKI67 subpopulations in aged liver cells and reducing the proportion of CDKN1A+LFS1 cell subpopulations, thereby achieving a therapeutic effect on liver aging.

7. The use according to claim 1 or 2, characterized in that: The method for isolating human embryonic stem cell exosomes comprises the following steps: collecting the human embryonic stem cell culture supernatant, centrifuging the supernatant in a low-speed low-temperature centrifuge for 3 to 6 minutes; centrifuging at 1500g to 2500g for 15 to 20 minutes; centrifuging at 10000g for 20 to 30 minutes; and centrifuging at 100,000g for 60 to 90 minutes; resuspending the precipitate after centrifugation with PBS, and centrifuging again at 100,000g for 60 to 90 minutes to resuspend the exosomes.

8. The use according to claim 1 or 2, characterized in that: The product includes a medicine or a preparation.

9. The use according to claim 8, characterized in that: The active ingredient of the drug is human embryonic stem cell exosomes.

10. The use according to claim 9, characterized in that: The drug is used in combination with other drugs for treating aging.

11. The use according to claim 10, characterized in that: The combined use method includes encapsulating other drugs for treating aging in the human embryonic stem cell exosomes.

12. The use according to claim 11, characterized in that: The other drugs for treating aging include proteins or RNA that inhibit aging, or inhibitors of proteins or RNA that promote aging.

13. The use according to any one of claims 9 to 12, characterized in that: The drug also includes pharmaceutically acceptable excipients.

Images