A biomarker for detecting placenta accreta and its application
By detecting the expression level of the MIR323B gene, the problem of early diagnosis of placenta accreta has been solved, achieving a highly accurate and convenient diagnostic method and reducing the risks to mothers and newborns.
Patent Information
- Application Number
- CN202210988052.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-17
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2042-08-17
AI Technical Summary
Existing technologies make it difficult to diagnose placenta accreta accurately in the early stages. Imaging diagnostic equipment is expensive and prone to false negatives or false positives. The lack of rapid and convenient testing methods increases the risk of postpartum hemorrhage for mothers.
Using the MIR323B gene as a plasma biomarker, placental implantation diseases, including placental adhesion, placental implantation, and penetrating placenta, are diagnosed by detecting its expression level. Diagnostic kits and drugs are prepared for early diagnosis and treatment.
It improves the diagnostic accuracy of placenta accreta, provides a minimally invasive and repeatable testing method, reduces the risk of massive bleeding during childbirth, and lowers the incidence of neonatal complications.
Smart Images

Figure CN116426625B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological and molecular diagnostic technology, specifically relating to a biomarker for detecting placental implantation and its application. Background Technology
[0002] Placenta accreta spectrum disorders (PAS) are a serious health threat to pregnant women. It results from abnormal adhesion or invasion of the placental villi into the uterine myometrium, with the primary cause of death being massive hemorrhage during childbirth due to uterine lining detachment. The incidence of PAS is rising with the increase in cesarean sections. Data shows that over the past 40 years, the prevalence of PAS has been 0.01-1.1%, with an overall prevalence of 0.17%. Therefore, early detection and treatment of PAS are crucial for prevention. Studies have shown that the development of PAS is accompanied by changes in plasma biomarkers, which can be used to assess placental growth in pregnant women. Plasma biomarkers include hormones, inflammatory factors, and proteins, and with advancements in medicine, genetic testing has become an important clinical diagnostic tool.
[0003] Current research has applied gene detection technology to the clinical diagnosis of PAS (placental implantation syndrome), as exemplified by Chinese patents CN110904222 A, CN 110938687 A, CN 110951863 A, and CN110951865 A, all titled "Placental Implantation Syndrome Markers." These four patents use miR-518a-3p, iR-671-3p, miR-139-3p, and miR-196a-5p as indicators, respectively. The inventors discovered low expression of MIR323B in placental implantation syndrome tissues using high-throughput sequencing, but no reports have been found regarding the detection and diagnosis of placental implantation syndrome using MIR323B. Summary of the Invention
[0004] The purpose of this invention is to solve the aforementioned technical problems and provide a biomarker for detecting placenta accreta and its application. Using the biomarker of this invention can provide a new plasma biomarker for the early diagnosis of placenta accreta. The technical solution used to achieve the purpose of this invention is as follows:
[0005] A biomarker for detecting placenta accreta is disclosed, wherein the biomarker is the MIR323B gene. Reduced expression of MIR323B in subject samples is an indicator of placenta accreta. MIR323B is a non-coding RNA that participates in regulation by affecting mRNA stability and translation. The inventors, through database analysis and experiments, found that MIR323B is expressed at low levels in placenta accreta, a difference not observed in other placental diseases, indicating a relationship between MIR323B and placenta accreta.
[0006] As a further preferred embodiment of the present invention, the placental implantation disease includes placental adhesion, placental implantation, and penetrating placenta, and the subject samples include blood, plasma, serum, peripheral blood, amniotic fluid, cell culture medium, and tissue lysis fluid.
[0007] As a further preferred embodiment of the present invention, the MIR323B biomarker is used in the preparation of diagnostic reagents or kits for detecting placental implantation.
[0008] As a further preferred embodiment of the present invention, MIR323B is used as a diagnostic biomarker for placenta accreta in the preparation of reagents for diagnosing placenta accreta.
[0009] As a further preferred embodiment of the present invention, MIR323B is used as a target in the preparation of drugs for treating diseases caused by placenta accreta.
[0010] As a further preferred embodiment of the present invention, the reagent for detecting MIR323B is used in the preparation of diagnostic reagents for diseases caused by placental implantation.
[0011] As a further preferred embodiment of the present invention, MIR323B is used in the preparation of a medicament for treating placenta accreta.
[0012] As a further preferred embodiment of the present invention, the application of a reagent containing the MIR323B gene in the preparation of a placenta accreta disease assessment kit or diagnostic device is described.
[0013] As a further preferred embodiment of the present invention, an application of a treatment containing the MIR323B gene in the development of a treatment plan to overcome placenta accreta disease is described.
[0014] As a further preferred embodiment of the present invention, the reagent for detecting MIR323B is used in the preparation of a diagnostic kit for placental implantation disease.
[0015] MIR323B precursor sequence:
[0016] hsa-mir-323b MI0014206
[0017] UGGUACUCGGAGGGAGGUUGUCCGUGGUGAGUUCGCAUUAUUUAAUGAUGCCCAAUACACGGUCGACCUCUUUUCGGUAUCA
[0018] Mature MIR323B sequence:
[0019] hsa-miR-323b-5p MIMAT0001630
[0020] AGGUUGUCCGUGGUGAGUUCGCA
[0021] hsa-miR-323b-3p MIMAT0015050
[0022] CCCAAUACACGGUCGACCUCUU
[0023] Placenta accreta is caused by pathological infiltration of the placenta and is mainly divided into three types: placental adhesion, placenta accreta, and penetrating placenta. Placental adhesion is when the placental villi adhere directly to the surface of the myometrium; placenta accreta is when the placental villi infiltrate the myometrium but do not penetrate it; and penetrating placenta accreta is when the placental villi penetrate the myometrium and reach or exceed the serosa of the uterus, which can affect surrounding organs.
[0024] While PAS is relatively rare in obstetrics, it is a serious obstetric complication. Risk factors for PAS include cesarean section and induced abortion. It can lead to incomplete placental detachment during delivery, varying degrees of vaginal bleeding during or after delivery, and an increased incidence of neonatal respiratory distress syndrome, seriously endangering the lives of both mother and fetus. Accurate prenatal diagnosis of PAS and its specific type allows for timely and personalized treatment plans, reducing or preventing complications. However, due to the lack of typical clinical manifestations, signs, and laboratory indicators, most PAS cases cannot be accurately identified before delivery.
[0025] Currently, the main methods for prenatal screening of PAS in clinical practice are imaging diagnostics, such as prenatal ultrasound or MRI. Imaging diagnostic equipment is expensive and requires high technical skills. However, due to the subjective nature of the operators' experience and habits, false negatives or false positives can occur. Some contrast agents are not suitable for pregnant women. There is an urgent need for rapid, convenient methods to assist in clinical testing.
[0026] In summary, because the present invention adopts the above-described technical solution, the present invention has the following technical effects:
[0027] This invention reveals that MIR323B expression levels are downregulated in the plasma of PAS patients. Furthermore, comparisons between in vitro and database results show that MIR323B gene expression is downregulated in all PAS patients, demonstrating high diagnostic accuracy. MIR323B plays a crucial role in the diagnosis and treatment of placenta accreta. Serum MIR323B biomarkers are minimally invasive and reproducible, making them suitable for the development of drugs to treat placenta accreta or related conditions. Attached Figure Description
[0028] Figure 1 These are scatter plots of two sets of data selected from GEO and SRA, where A is the scatter plot of GEO data and B is the scatter plot of SRA data.
[0029] Figure 2 These are ROC curves for two sets of data selected from GEO and SRA, where A is the ROC curve for GEO data and B is the ROC curve for SRA data.
[0030] Figure 3 This is a volcano map of differentially expressed genes from sequencing results.
[0031] Figure 4 These are scatter plots and ROC curves of the sequencing results, where A is the scatter plot and B is the ROC curve.
[0032] Figure 5 This refers to the effect of RNase R on MIR323B expression. Detailed Implementation
[0033] To make the objectives, technical solutions, and advantages of this invention clearer, preferred embodiments are described below to further illustrate the invention in detail. However, it should be noted that many details listed in the specification are merely to provide the reader with a thorough understanding of one or more aspects of the invention, and these aspects can be achieved even without these specific details.
[0034] This invention relates to the application of the MIR323B gene as a biomarker for placenta accreta, wherein reduced expression of MIR323B in subject samples is an indication of placenta accreta, which includes three types: placental adhesion, placenta accreta, and penetrating placenta. Subject samples include blood, plasma, serum, peripheral blood, amniotic fluid, cell culture medium, and tissue lysate.
[0035] This invention also relates to the application of the MIR323B detection reagent in the preparation of reagents or kits for differentiating placenta accreta from other diseases with similar characteristics. The biomarkers for the characterized diseases are selected from creatinine kinase, serum proteins, or placental prolactin mRNA.
[0036] The MIR323B gene of the present invention includes a precursor sequence and a mature sequence, including the nucleotide sequence of its precursor and the nucleotide sequence of its mature form, the nucleotide sequence of which is a natural sequence without deletions or variants.
[0037] Example 1
[0038] Figures 1 to 4 This embodiment illustrates a process of low expression of a biomarker for placenta accreta, including the following aspects:
[0039] (1) Two sets of data were downloaded from the GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ) and the SRA database (https: / / www.ncbi.nlm.nih.gov / sra / ), namely 7 PAS patients and 3 normal placental samples, and 5 PAS patients and 5 normal placental samples. The two sets of microarrays were screened to obtain two sets of MIR323B low expression data, and receiver operating characteristics (ROC) curves were plotted to determine the accuracy of MIR323B in distinguishing PAS from normal placenta.
[0040] Scatter plots and ROC curves were generated for 7 PAS patients and 3 normal placental samples, as well as 5 PAS patients and 5 normal placental samples. Figure 1 , Figure 2 As can be seen, MIR323B is expressed at a low level in PAS, and its diagnostic accuracy is at a medium to high level.
[0041] (2) After obtaining informed consent from the pregnant women, plasma from 5 normal placental tissues and 3 PAS tissues from the Department of Obstetrics of the First Affiliated Hospital of Guangxi Medical University were coagulated at room temperature for 30-45 minutes, centrifuged at 4℃ and 6000 rpm for 15 minutes, and then serum and cells were separated. The separated serum was stored at -80℃ and Guangzhou Megvii Biotechnology Co., Ltd. was commissioned to sequence the sample tissues. The sequencing results were analyzed for differential expression to obtain differentially expressed genes (DEGs) of PAS. The screening criteria were set as |logFold Change|>1 and P<0.05, and 758 differentially expressed genes were finally screened. In addition, scatter plots and ROC curves were also plotted on the above sequencing data.
[0042] Differential expression analysis was performed on sequencing data from 3 PAS patients and 5 normal placentas using the limma package. The selection criteria were |logFold Change|>1 and P<0.05, ultimately identifying 758 differentially expressed genes, such as... Figure 3 As shown, the horizontal axis represents the negative logarithm of P.Val. It's easy to see that the larger the horizontal axis, the more significant the selected genes. The vertical axis represents logFC, which is the logarithm of the ratio of gene expression values between the two groups. If it's greater than 0, it indicates that gene expression in the PAS group is higher than in the normal placenta group. In this example, the absolute value of the horizontal axis is greater than or equal to 1, indicating that the fold change in gene expression is greater than twofold. Figure 3 In the diagram, upregulated differentially expressed genes are located at the top, and downregulated differentially expressed genes are located at the bottom. Furthermore, scatter plots and ROC curves were plotted for the MIR323B gene in the sequencing data. Figure 4 ), and found that its expression level was downregulated.
[0043] (3) Data collected from GEO and SRA high-throughput databases and placental tissue sequencing data collected from the First Affiliated Hospital of Guangxi Medical University were used to demonstrate that MIR323B was lowly expressed in PAS through bioinformatics and statistical analysis.
[0044] Example 2: Effect of RNase R on MIR323B expression
[0045] (1) Total RNA was extracted from three PAS tissue samples preserved at the First Affiliated Hospital of Guangxi Medical University using the Trizol method. 0.5 μL of RNase R (Shanghai Beyotime Biotechnology Co., Ltd.) and enzyme-free water were added to each sample, followed by 2 μL of 10x Reaction Buffer. The reaction mixture was then brought to a final volume of 20 μL with enzyme-free water. The mixture was purified after incubating at 37°C for 15-20 min.
[0046] (2) Add enzyme-free water to the RNase R-treated sample and adjust the reaction system to 100 μL. Add 350 μL of RLT and mix well. Then add 250 μL of anhydrous ethanol and mix well. Centrifuge the sample at 8500-10000 rpm for 15 seconds and discard the supernatant. Add 500 μL of RPE to the sample and centrifuge at 8500-10000 rpm for 15 seconds and discard the supernatant. Add 500 μL of anhydrous ethanol and centrifuge at 8500-10000 rpm for 2 minutes and discard the supernatant. Air dry the sample and finally add 15 μL of enzyme-free water and centrifuge at 8500-10000 rpm for 1 minute.
[0047] (3) Take 5 μg of RNA from step (2) and reverse transcribe it to obtain cDNA. Dilute it with three times the volume of RNase-free water and perform quantitative real-time PCR detection using the SYBR Green method. Each sample is repeated three times. The expression levels of different target genes are statistically analyzed using the ΔΔCT value of untreated GAPDH as an internal reference standard.
[0048] (4) RNA extracted from placental implantation tissue showed a significant decrease in MIR323B expression after treatment with RNase R, indicating that MIR323B has a linear structure (see...). Figure 5 ).
[0049] Example 3: Effects of MIR323B on Intrauterine Placental Cells
[0050] PAS tissue preserved in the Department of Obstetrics, First Affiliated Hospital of Guangxi Medical University, was placed in a culture dish and minced until no visible lumps remained. A prepared digestion solution (hyaluronidase + collagenase + DNase) was added, and the mixture was thoroughly mixed by pipetting. The mixture was incubated at 37°C for 3 minutes, and then observed under a microscope for glandular release. If individual glands were dispersed and precipitated, 2 ml of cell culture medium was added to terminate the digestion. The solution was then filtered through a 40 μm sieve into a 20 ml centrifuge tube. If no glands were released, digestion continued at 37°C.
[0051] Centrifuge the liquid in a 20ml centrifuge tube at 5000rpm / min for 2min, remove the supernatant, resuspend the placental tissue cells, and spread them into a culture dish. After passage the placental tissue cells to the second generation, spread them evenly into a 24-well plate. Centrifuge the liquid in a 10ml centrifuge tube at 5000rpm / min for 2min, remove the supernatant, resuspend the placental tissue cells, and spread them evenly into a 24-well plate.
[0052] Placental tissue cells were digested with pancreatic enzymes and counted, taking (1-5) x 10⁻⁵ cells. 6 Cells / ml, centrifuged at 2000 rpm for 5 min and the supernatant was discarded;
[0053] Add 1 ml of pre-chilled PBS, gently vortex to suspend the cells, centrifuge at 2000 rpm for 5 min and discard the supernatant, wash twice with PBS; resuspend the cells in 100 μl binding buffer; add 5 μl Annexin V-FITC and mix gently, incubate at room temperature in the dark for 15 min; add 10 μl PI, incubate in the dark for 5 min and then analyze.
[0054] The same volume (5 μl) of the above RNA was reverse transcribed to obtain cDNA, which was then diluted with 3 volumes of RNase-free water. Quantitative real-time PCR was performed using the SYBR Green method, with three replicates per sample. The expression levels of different target genes were statistically analyzed using the ΔΔCT value of the untreated GAPDH group as an internal control.
[0055] The results showed that cytopathic effects led to low expression of MIR323B in placental tissue, with cell death, low levels of normal cells, and low MIR323B expression.
[0056] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The application of a reagent for detecting the expression level of MIR323B in the preparation of a diagnostic reagent for placental implantation disease.
2. The application of a reagent for detecting MIR323B expression levels in the preparation of a diagnostic kit for placental implantation disease.
Citation Information
Patent Citations
Marker for placenta accreta spectrum disorders
CN110904222A
Placental implantable disease markers
CN110938687A
Placental implantable disease marker
CN110951863A
Placental implantable disease marker
CN110951865A