Methods for establishing a horizontal gene transfer system between wolfberry and tomato and obtaining transformed roots

Abstract

This invention discloses a method for establishing a horizontal gene transfer system between wolfberry and tomato and obtaining transformed roots. Using tomato and wolfberry (both belonging to the Solanaceae family) as starting materials, the method reduces the lignin content of wolfberry cells, eliminates the isolation layer between distantly grafted cells, and connects the grafted cells of the two species. Adventitious roots are induced at the grafting site of the tomato scion by treating it with different auxins. Morphological and molecular biological studies demonstrate that horizontal gene transfer occurred between wolfberry and tomato cells mediated by grafting, and the induced adventitious roots are transformed roots from wolfberry to tomato. This invention establishes a technical system for efficient transfer of wolfberry genes to tomato and obtains transformed roots, achieving complementary advantages between herbaceous and woody plant genetic resources. Tomato plants with transformed root systems exhibit good root vigor, strong plant growth, and a long growth cycle. Obtaining transformed roots is of great significance for improving tomato yield, quality, and resistance.

Description

Technical Field

[0001] This invention relates to a method for rapidly transferring genetic material from wolfberry to tomato using an improved grafting technique, thereby obtaining adventitious roots for tomato regeneration. Through bioinformatics localization, wolfberry DNA fragments were specifically screened from tomatoes, confirming that the adventitious roots regenerated in the tomato grafting area were transformed roots. Tomato plants with transformed roots exhibit strong root vigor, vigorous growth, and long-season growth, achieving complementary advantages between different woody and herbaceous species. This is of great significance for improving the yield, quality, and resistance of tomatoes and other vegetable crops. Background Technology

[0002] Horizontal gene transfer can be defined as the transfer of genetic material across species through means other than fertilization. With advancements in sequencing and bioinformatics analysis, the frequency of horizontal gene transfer observed in plant genomes is increasing. In plants, horizontal gene transfer occurs directly through intervening vectors, including symbiosis, endosymbiosis, parasitism, grafting, and epiphytosis; it also involves indirect intervening vectors such as viruses, bacteria, fungi, insects (aphids), nematodes, pollen grains, and transposon elements. Graft-mediated horizontal gene transfer was first observed in tobacco. In recent years, graft-mediated horizontal gene transfer events have become increasingly frequent between related species. For example, in the Solanaceae plant *Nicotiana*, horizontal gene transfer of mitochondrial genome fragments, complete chloroplast genomes, and even the entire nuclear genome has been observed at the graft union site. Horizontal gene transfer provides a novel avenue for the artificial and targeted improvement of crops.

[0003] Tomato (Solanum lycopersicum), a member of the Solanaceae family, is the world's largest fruit-bearing vegetable. Its apical apex continuously grows upwards, flowering and fruiting simultaneously, making it suitable for high-efficiency, high-yield, long-season cultivation. However, the underground roots of tomatoes are susceptible to factors such as low temperatures and weak light in winter and spring, high temperatures and humidity in summer and autumn, soil-borne diseases, and continuous cropping obstacles, leading to decreased root vitality and premature aging, severely restricting the yield and quality of the above-ground parts. Therefore, improving the root traits of tomatoes is urgently needed to address the current problems of poor plant resistance, premature root aging, and the high cost of improving greenhouse cultivation environments.

[0004] Compared to the herbaceous tomato, wolfberry (Lycium chinense Miller.), a plant belonging to the Solanaceae family, has a more developed root system and is perennial. Growing in arid desert regions, its roots exhibit strong resistance to drought, cold, salinity, and poor soil conditions. Furthermore, wolfberry fruit is extremely nutritious, making it a suitable parent material for improving the poor stress resistance and premature root aging of tomato plants. However, wolfberry and tomato are not closely related, making distant hybridization and cell fusion difficult. Therefore, establishing a high-efficiency grafting system by reducing the lignin content of wolfberry cells, and developing a technology system for horizontal gene transfer between wolfberry and tomato cells, along with methods for inducing adventitious roots in tomato to obtain tomato transformed roots from wolfberry genetic material, is an effective approach to solving the current challenges in strong-root tomato breeding. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by establishing a highly efficient method for horizontal gene transfer between wolfberry and tomato cells and obtaining transformed roots. Firstly, the lignin content of wolfberry cells is reduced to eliminate the isolation layer between distantly grafted cells, allowing communication between the grafted cells of the two species. Then, adventitious roots are induced in the tomato grafting area by treating the tomato scion with different auxins. Morphological and molecular biological analyses demonstrate that grafting-mediated horizontal gene transfer occurred between wolfberry and tomato cells, and the induced adventitious roots are transformed roots from wolfberry horizontal gene transfer to tomato. This invention establishes a highly efficient technical system for transferring wolfberry genes to tomato and obtains transformed roots, achieving complementary advantages between herbaceous and woody plant genetic resources. Tomato plants with transformed root systems exhibit better root vigor, stronger plant growth, longer growth cycles, and improved yield, quality, and resistance.

[0006] The technical solution of the present invention is achieved through the following steps:

[0007] A method for establishing a horizontal gene transfer system between wolfberry and tomato and obtaining transformed roots includes the following steps:

[0008] (1) Select wolfberry seedlings with low lignin content and suitable for grafting as rootstocks; lignin content is less than 500s / g;

[0009] (2) Select tomato seedlings that have grown to 3 leaves and 1 heart, cut off the epicotyl of the tomato seedling 0.5 cm away from the cotyledon, treat it with exogenous auxin for 5 min, and make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped with a wider top and a narrower bottom. Use it as a grafting scion to graft with wolfberry rootstock to establish a high-efficiency grafting system between wolfberry and tomato, and induce the regeneration of adventitious roots in the tomato grafting area.

[0010] (3) Observe the origin and morphology of adventitious roots in the grafted area of ​​tomatoes, and extract the genomic DNA of adventitious roots in the grafted area of ​​tomatoes. If the root system of the regenerated adventitious roots is clearly graded and the DNA fragment of wolfberry is detected, it indicates that transformed roots have been obtained.

[0011] Furthermore, the method for cultivating tomato seedlings and wolfberry seedlings with low lignin content suitable for grafting is as follows: Sterile wolfberry seedlings from the culture medium are transferred to the substrate for cultivation for 10-20 days. For the first 3 days, 100% humidity is maintained. Afterward, the seedlings are cultivated at the same temperature (22℃-26℃) and light intensity (100-120 μmol·m⁻¹) as sown tomatoes. -2 ·s -1 They were cultured in an environment with 14 hours of light per day and 85% relative humidity.

[0012] Furthermore, the method for determining the lignin content of wolfberry is as follows: Select wolfberries that have been cultivated in the substrate for a certain number of days with uniform growth, cut a stem segment of 1 cm from the bottom to the top, 7.5 cm to 8.5 cm, and remove the leaves. Place the stem segment in a 15 ml centrifuge tube, open the cap and dry it overnight at 85°C until constant weight. Grind it into powder, sieve it through a 40-mesh filter, and determine the lignin content in the wolfberry stem segment using the acetyl bromide method. Measure the absorbance of the sample at a wavelength of 280 nm using a spectrophotometer, and calculate the lignin content through a regression curve.

[0013] Further, in step (1), the method for establishing the rootstock is as follows: cut a wolfberry seedling with low lignin content and suitable for grafting 5cm down from the top, and cut 0.5-1.0cm down along the center line of the cross-section after the cut to obtain the rootstock.

[0014] Furthermore, the grafting method is as follows: insert the cut tomato scion into the 0.5-1.0cm split of the wolfberry to graft, so that the tomato scion and the rootstock are in full contact, thereby establishing an efficient grafting system between wolfberry and tomato.

[0015] Furthermore, in step (2), the exogenous auxin used is 2.0 mg / L NAA.

[0016] Furthermore, in step (3), the method for extracting genomic DNA from the adventitious roots of the tomato grafting region is the modified CTAB method.

[0017] Furthermore, in step (3), the method for determining whether wolfberry DNA fragments are detected in the adventitious roots of the tomato grafting area is as follows:

[0018] Genomic DNA was extracted from adventitious roots in the grafted tomato region and resequencing was performed. Bioinformatics analysis was conducted, using the Linux `cat` command to ligate the *Lycium barbarum* genome with the tomato genome. Reads aligned with the tomato genome were removed, and the remaining reads were mapped to the *Lycium barbarum* genome. Sequences with mapped read intervals were extracted, yielding multiple corresponding DNA fragments. Primers were designed based on the mapped sequences, and PCR verification was performed. This confirmed the presence of this *Lycium barbarum* DNA fragment in the adventitious roots of the tomato grafted tissue. The tomato genome and the mapped sequence were mixed as a reference genome, and reads aligned at one end to the tomato genome and at the other end to the target sequence were searched. A short fragment was extracted from the unaligned *Lycium barbarum* fragment, blasted into the reference genome, and short fragments matching only the tomato genome were retained for further screening. If the screening yielded a match, it indicated that the regenerated adventitious roots contained *Lycium barbarum* DNA fragments.

[0019] Furthermore, the method for resequencing the genome of adventitious roots is as follows: resequencing the genome according to conventional next-generation genome sequencing technology, with a DNA library length of 200-300bp, each read length of 150bp, and at least 24G of data obtained (the total genome size of tomato is about 800M, and 24G is 30 times the total genome size).

[0020] The technologies utilized in this invention involve RNA extraction, transcriptome sequencing, DNA extraction, PCR reaction, and genome resequencing, all of which are currently mature technologies in molecular biology. At the same time, the application of software such as BWA and BLAST can obtain the desired analysis results relatively quickly and conveniently.

[0021] Compared with the prior art, the present invention has at least the following technical advantages:

[0022] (1) The innovation of this invention is that by reducing the content of lignin, the isolation layer between distant cells is eliminated, and for the first time, efficient grafting between herbaceous and woody plants between distant grafting genera is achieved.

[0023] (2) In this invention, adventitious roots were induced in the grafting area of ​​tomatoes by treating the tomato scions with different auxins. The adventitious roots were identified by PCR as transformed roots of tomatoes with horizontal transfer of the wolfberry gene.

[0024] (3) Both wolfberry and tomato are plants of the Solanaceae family. There are some homologous sequences between the two species, which may pose some difficulties in subsequent analysis. The ingenuity of this invention lies in merging the wolfberry genome and tomato genome using the Linux cat command. Reads containing tomato are removed from the resequencing data. This cleverly removes the homologous sequences between wolfberry and tomato. The remaining data contains only wolfberry-specific reads and some reads that do not match the wolfberry genome. The remaining data is mapped to the wolfberry genome to find multiple sequences that are completely mapped to the wolfberry genome. The subsequent localization merges the multiple sequence files with the tomato genome file as a new reference genome. The BWA software is used to find resequencing sequences that match the tomato genome at one end and the target reads at the other end. The BLAST software is used for further screening to retain only short sequences that match the tomato genome. This method is highly innovative and has wide applicability to species with homologous sequences. It belongs to personalized analysis in bioinformatics.

[0025] In summary, this invention achieves this by reducing the lignin content of wolfberry cells, eliminating the isolation layer between distant cells to connect the grafted cells of the two species, and by treating tomato scions with different auxins, inducing adventitious roots at the tomato grafting site. Morphological and molecular biological studies demonstrate that grafting-mediated horizontal gene transfer occurred between wolfberry and tomato cells, and the induced adventitious roots are transformed roots resulting from the horizontal gene transfer from wolfberry to tomato. This invention establishes a highly efficient technology system for transferring wolfberry genes to tomato and obtains transformed roots, achieving complementary advantages between the genetic resources of herbaceous and woody plants. Attached Figure Description

[0026] The invention will now be described in further detail with reference to the accompanying drawings, but this is not intended to limit the invention.

[0027] Figure 1 A schematic diagram illustrating the establishment of a horizontal gene transfer system between wolfberry and tomato and the acquisition of transformed roots, where: a is a tomato seedling; b is a tomato scion; c is a wolfberry seedling cultured in a substrate; d is a wolfberry rootstock; e is a transformed plant obtained after grafting tomato and wolfberry; and f is the acquisition of transformed roots.

[0028] Figure 2 This is a diagram showing the origin of adventitious roots regenerating in the grafting area of ​​a tomato plant. In this diagram, Sc represents the tomato scion and St represents the wolfberry rootstock.

[0029] Figure 3 This is a comparison of the morphology of adventitious roots regenerated from the grafting areas of wolfberry and tomato and adventitious roots regenerated after tomato cuttings. Among them: a is the adventitious root of wolfberry; b is the adventitious root regenerated from the grafting area of ​​tomato; c is the adventitious root regenerated after tomato cuttings.

[0030] Figure 4 The growth vigor of the plant is 3 and a half months after grafting, where: a is the grafted plant; b is the transformed plant; and c is the self-grafted plant.

[0031] Figure 5 These are electrophoresis images of DNA extracted from three transformed plant samples.

[0032] The table shows 216 sequence information mapped to the wolfberry genome in the filtered resequencing data.

[0033] Figure 6 This is a PCR validation of 216 sequences; where: Goji represents wolfberry, CR represents tomato, the numbers 1, 2, 3 before the "-" represent three transformed root samples, and the numbers 1, 2, 3 after the "-" represent three biological replicates.

[0034] Figure 7 The insertion site information of chromosome NC_015444.3 was obtained through analysis.

[0035] Figure 8 Insertion site PCR verification; where: a represents tomato CR, and b represents transformed root sample.

[0036] Figure 9 These are freehand slices of the graft union after grafting goji berries onto tomatoes. Among them: a is a 10-day-old goji berry used as rootstock, b is a 20-day-old goji berry used as rootstock, and c is a 30-day-old goji berry used as rootstock. Detailed Implementation

[0037] This invention provides a method for establishing a horizontal gene transfer system between wolfberry and tomato and obtaining transformed roots, such as... Figure 1 As shown, it includes the following steps:

[0038] (1) Select wolfberry seedlings with low lignin content and suitable for grafting as rootstock;

[0039] (2) Select tomato seedlings that have grown to 3 leaves and 1 heart, cut off the epicotyl of the tomato seedling 0.5 cm away from the cotyledon, treat it with exogenous auxin for 5 min, and make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped with a wider top and a narrower bottom. Use it as a grafting scion to graft with wolfberry rootstock to establish a high-efficiency grafting system between wolfberry and tomato, and induce the regeneration of adventitious roots in the tomato grafting area.

[0040] (3) Observe the origin and morphology of adventitious roots in the grafted area of ​​tomatoes, and extract and observe the genomic DNA of adventitious roots in the grafted area of ​​tomatoes. If the root system of the regenerated adventitious roots is clearly graded and the DNA fragment of wolfberry is detected, it indicates that transformed roots have been obtained.

[0041] The present invention will be further described below with reference to embodiments.

[0042] Example 1

[0043] (1) Cultivation of CR cells from black goji berries and tomatoes: By regulating the cell state of black goji berry, sterile black goji berry seedlings in the culture medium were transferred to the substrate for cultivation for 10 days. For the first 3 days, 100% humidity was maintained. Afterward, the temperature was the same as that of tomato CR cells after sowing, ranging from 22℃ to 26℃, with a light intensity of 100 to 120 μmol·m⁻¹. -2 ·s -1 They were cultured in an environment with 14 hours of light per day and 85% relative humidity.

[0044] (2) Determination of lignin content in black wolfberry stem segments: Black wolfberries with uniform growth after 10 days of cultivation in the substrate were selected, and stem segments of 1 cm were cut from the bottom to the top, 7.5 cm to 8.5 cm. The leaves were removed, and the stem segments were placed in 15 ml centrifuge tubes and dried overnight at 85 °C until constant weight. The tubes were then ground into powder and sieved through a 40 mesh filter. The lignin content in the wolfberry stem segments was determined by the acetyl bromide method. The absorbance of the samples was measured at a wavelength of 280 nm using a spectrophotometer, and the lignin content was calculated by regression curve.

[0045] (3) Obtaining transcriptome data of black wolfberry stem segments: Total RNA was extracted from the corresponding stem segments of wolfberry at 10 days using Trizol reagent. mRNA with polyA tails was enriched using Oligo(dT) magnetic beads. First-strand cDNA was synthesized using fragmented mRNA as template and random oligonucleotides as primers. Second-strand cDNA was then synthesized using dNTPs. The purified double-stranded cDNA underwent end repair, A-tailing, and sequencing adapter ligation. cDNA of about 250-300 bp was screened using AMPure XP beads, and PCR amplification was performed. The PCR product was purified again using AMPure XP beads to obtain the final library. After the library was constructed, it was first preliminarily quantified using a Qubit2.0 Fluorometer and diluted to 1.5 ng / μl. Then, the insert size of the library was detected using an Agilent2100 bioanalyzer. After the insert size met the expectations, the effective concentration of the library was accurately quantified by qRT-PCR (effective concentration of the library is higher than 2 nM) to ensure the quality of the library.

[0046] (4) Establishing a high-efficiency grafting system between black goji berries and tomato CR: Select 10-day-old goji berry seedlings and make a horizontal cut 5cm down from the top. Then, make a 0.5-1.0cm cut down along the center line of the cut surface to serve as the grafting rootstock. When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5cm from the cotyledons. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato CR wedge-shaped, wider at the top and narrower at the bottom, to serve as the grafting scion. Insert the cut tomato CR scion into the 0.5-1.0cm cut in the goji berry for grafting, ensuring full contact between the tomato scion and the rootstock, thereby establishing a high-efficiency grafting system between black goji berries and tomato CR.

[0047] Example 2

[0048] The difference in this embodiment is that the sterile black wolfberry seedlings in the culture medium were transferred to the substrate for 20 days of cultivation. The wolfberry stem segments selected for lignin and transcriptome determination were all 20 days old. All other operating steps were the same as in Embodiment 1, specifically:

[0049] (1) Cultivation of CR cells from black goji berries and tomatoes: By regulating the cell state of black goji berry, sterile black goji berry seedlings in the culture medium were transferred to the substrate for cultivation for 10 days. For the first 3 days, 100% humidity was maintained. Afterward, the temperature was the same as that of tomato CR cells after sowing, ranging from 22℃ to 26℃, with a light intensity of 100 to 120 μmol·m⁻¹. -2 ·s -1 They were cultured in an environment with 14 hours of light per day and 85% relative humidity.

[0050] (2) Determination of lignin content in black wolfberry stem segments: Black wolfberries with uniform growth after 20 days of cultivation in the substrate were selected, and stem segments of 1 cm were cut from 7.5 cm to 8.5 cm from the bottom upwards. The leaves were removed, and the stem segments were placed in 15 ml centrifuge tubes and dried overnight at 85 °C until constant weight. The tubes were then ground into powder and sieved through a 40-mesh filter. The lignin content in the wolfberry stem segments was determined by the acetyl bromide method. The absorbance of the samples was measured at a wavelength of 280 nm using a spectrophotometer, and the lignin content was calculated by regression curve.

[0051] (3) Obtaining transcriptome data of black wolfberry stem segments: Total RNA was extracted from the corresponding stem segments of wolfberry at 20 days using Trizol reagent. mRNA with polyA tails was enriched using Oligo(dT) magnetic beads. First-strand cDNA was synthesized using fragmented mRNA as template and random oligonucleotides as primers. Second-strand cDNA was then synthesized using dNTPs. The purified double-stranded cDNA underwent end repair, A-tailing, and sequencing adapter ligation. CDNA of about 250-300 bp was screened using AMPure XP beads, and PCR amplification was performed. The PCR product was purified again using AMPure XP beads to obtain the final library. After the library was constructed, it was first preliminarily quantified using a Qubit2.0 Fluorometer and diluted to 1.5 ng / μl. Then, the insert size of the library was detected using an Agilent2100 bioanalyzer. After the insert size met the expectations, the effective concentration of the library was accurately quantified by qRT-PCR (effective concentration of the library is higher than 2 nM) to ensure the quality of the library.

[0052] (4) Establishing a high-efficiency grafting system between black goji berries and tomato CR: Select 20-day-old goji berry seedlings and make a horizontal cut 5cm down from the top. Then, make a 0.5-1.0cm cut down along the center line of the cut surface to serve as the grafting rootstock. When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5cm from the cotyledons. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato CR wedge-shaped, wider at the top and narrower at the bottom, to serve as the grafting scion. Insert the cut tomato CR scion into the 0.5-1.0cm cut in the goji berry for grafting, ensuring full contact between the tomato scion and the rootstock, thereby establishing a high-efficiency grafting system between black goji berries and tomato CR.

[0053] Example 3

[0054] The difference in this embodiment is that the sterile black wolfberry seedlings in the culture medium were transferred to the substrate for 30 days of cultivation. The wolfberry stem segments selected for lignin and transcriptome determination were all 30 days old. All other operating steps were the same as in Embodiment 1, specifically:

[0055] (1) Cultivation of CR cells from black goji berries and tomatoes: By regulating the cell state of black goji berry, sterile black goji berry seedlings in the culture medium were transferred to the substrate for cultivation for 10 days. For the first 3 days, 100% humidity was maintained. Afterward, the temperature was the same as that of tomato CR cells after sowing, ranging from 22℃ to 26℃, with a light intensity of 100 to 120 μmol·m⁻¹. -2 ·s -1 They were cultured in an environment with 14 hours of light per day and 85% relative humidity.

[0056] (2) Determination of lignin content in black wolfberry stem segments: Black wolfberries with uniform growth after 30 days of cultivation in the substrate were selected, and stem segments of 1 cm were cut from 7.5 cm to 8.5 cm from the bottom upwards. The leaves were removed, and the stem segments were placed in 15 ml centrifuge tubes and dried overnight at 85 °C until constant weight. The tubes were then ground into powder and sieved through a 40-mesh filter. The lignin content in the wolfberry stem segments was determined by the acetyl bromide method. The absorbance of the samples was measured at a wavelength of 280 nm using a spectrophotometer, and the lignin content was calculated by regression curve.

[0057] (3) Obtaining transcriptome data of black wolfberry stem segments: Total RNA was extracted from the corresponding stem segments of wolfberry at 30 days using Trizol reagent. mRNA with polyA tails was enriched using Oligo(dT) magnetic beads. First-strand cDNA was synthesized using fragmented mRNA as template and random oligonucleotides as primers. Second-strand cDNA was then synthesized using dNTPs. The purified double-stranded cDNA underwent end repair, A-tailing, and sequencing adapter ligation. CDNA of about 250-300 bp was screened using AMPure XP beads, and PCR amplification was performed. The PCR product was purified again using AMPure XP beads to obtain the final library. After the library was constructed, it was first preliminarily quantified using a Qubit2.0 Fluorometer and diluted to 1.5 ng / μl. Then, the insert size of the library was detected using an Agilent2100 bioanalyzer. After the insert size met the expectations, the effective concentration of the library was accurately quantified by qRT-PCR (effective concentration of the library is higher than 2 nM) to ensure the quality of the library.

[0058] (4) Establishing a high-efficiency grafting system between black goji berries and tomato CR: Select 30-day-old goji berry seedlings and make a horizontal cut 5cm down from the top. Then, make a 0.5-1.0cm cut down along the center line of the cut surface to serve as the grafting rootstock. When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5cm from the cotyledons. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato CR wedge-shaped, wider at the top and narrower at the bottom, to serve as the grafting scion. Insert the cut tomato CR scion into the 0.5-1.0cm cut in the goji berry for grafting, ensuring full contact between the tomato scion and the rootstock, thereby establishing a high-efficiency grafting system between black goji berries and tomato CR.

[0059] In Examples 1-3 above, each sample consisted of three mixed samples of black wolfberry stem segments, with three biological replicates, to analyze and observe the lignin content.

[0060] The following are the statistical results regarding the quantity, frequency of new leaf unfolding 10 days after grafting, and transcriptome data:

[0061] Table 1 Lignin Content

[0062]

[0063] Table 2. Frequency of new leaf unfolding 10 days after grafting.

[0064]

[0065] Table 3 Transcriptome data

[0066]

[0067]

[0068] As shown in Tables 1, 2, and 3 above, the lignin content of black wolfberry stem segments has a significant impact on the healing of grafts. The tables also show that by analyzing the lignin content of black wolfberry stem segments at 10, 20, and 30 days, the frequency of new leaf unfolding in grafts 10 days after grafting, and cell wall thickness, a black wolfberry rootstock with thinner cell walls, lower lignin content, and suitable for grafting was selected with a cultivation period of 10 days. Furthermore, since some new leaves also unfolded in grafts 10 days after grafting when using 20-day-old black wolfberry as rootstock, further analysis of the transcriptome data of black wolfberry stem segments at 10 and 20 days was conducted, identifying four genes related to cell wall synthesis. The gene sequences are: >transcript_HQ_goji_transcript39652 / f3p0 / 1243, >transcript_HQ_goji_transcript9772 / f5p0 / 3864, >transcript_HQ_goji_transcript37980 / f2p0 / 1623, >transcript_HQ_goji_transcript38631 / f2p0 / 1531. It was found that these four genes were significantly downregulated at 20 days, and the cell wall synthesis gene was highly expressed at 10 days, which contributes to graft healing and is closely related to graft survival rate. Therefore, 10-day-old black goji berries were selected as rootstock and tomato CR as scion for grafting, establishing a high-efficiency grafting system between black goji berries and tomato CR. Figure 9 These are freehand sections of the graft union site after grafting tomatoes onto wolfberries at 10d, 20d, and 30d. At 10d, there was almost no isolation layer; at 20d, the isolation layer was not obvious; and at 30d, there was a distinct brownish-yellow isolation layer. This further illustrates that wolfberry cells at 10d are more conducive to graft healing and eliminate the isolation layer between two distant cells.

[0069] Example 4

[0070] When the tomato CR has grown to 3 leaves and 1 heart, cut off the epicotyl 0.5 cm away from the cotyledon. Treat it with exogenous auxin NAA 2.0 mg / L for 5 min. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped with a wider top and narrower bottom. Use it as a grafting scion to graft onto the black wolfberry rootstock obtained in Example 1. Induce adventitious roots in the tomato grafting area.

[0071] Example 5

[0072] The difference in this embodiment is that the concentration of exogenous auxin NAA used is 0 mg / L, while all other operating steps are the same as in Embodiment 4, specifically:

[0073] When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5cm away from the cotyledon. Treat it with 0mg / L NAA (ddH2O) for 5min. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped with a wider top and narrower bottom. Use it as a grafting scion to graft onto the black wolfberry rootstock obtained in Example 1. Induce adventitious roots in the tomato grafting area.

[0074] Example 6

[0075] The difference in this embodiment is that the concentration of exogenous auxin NAA used is 0.5 mg / L, while all other operating steps are the same as in Embodiment 4, specifically:

[0076] When the tomato CR black fruit grows to 3 leaves and 1 heart, cut off the epicotyl 0.5cm away from the cotyledon. Treat it with 0.5mg / L NAA for 5min. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped with a wider top and narrower bottom. Use it as a grafting scion to graft onto the wolfberry rootstock obtained in Example 1. Induce adventitious roots in the tomato grafting area.

[0077] Example 7

[0078] The difference in this embodiment is that the concentration of exogenous auxin NAA used is 1.0 mg / L, while all other operating steps are the same as in Embodiment 4, specifically:

[0079] When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5 cm away from the cotyledon. Treat it with 1.0 mg / L NAA for 5 min. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped, wider at the top and narrower at the bottom. Use it as a grafting scion to graft onto the black wolfberry rootstock obtained in Example 1. Induce adventitious roots in the tomato grafting area.

[0080] Example 8

[0081] The difference in this embodiment is that the concentration of exogenous auxin NAA used is 5.0 mg / L, while all other operating steps are the same as in Embodiment 4, specifically:

[0082] When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5 cm away from the cotyledon. Treat it with 5.0 mg / L NAA for 5 min. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped, wider at the top and narrower at the bottom. Use it as a grafting scion to graft onto the black wolfberry rootstock obtained in Example 1. Induce adventitious roots in the tomato grafting area.

[0083] Example 9

[0084] The difference in this embodiment is that the concentration of exogenous auxin IBA used is 0.5 mg / L, while all other operating steps are the same as in Embodiment 4, specifically:

[0085] When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5 cm away from the cotyledon. Treat it with 0.5 mg / L IBA for 5 min. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped, wider at the top and narrower at the bottom. Use it as a grafting scion to graft onto the black wolfberry rootstock obtained in Example 1. Induce adventitious roots in the tomato grafting area.

[0086] Example 10

[0087] The difference in this embodiment is that the concentration of exogenous auxin IBA used is 1.0 mg / L, while all other operating steps are the same as in Embodiment 4, specifically:

[0088] When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5 cm away from the cotyledon. Treat it with 1.0 mg / L IBA for 5 min. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped, wider at the top and narrower at the bottom. Use it as a grafting scion to graft onto the black wolfberry rootstock obtained in Example 1. Induce adventitious roots in the tomato grafting area.

[0089] Example 11

[0090] The difference in this embodiment is that the concentration of exogenous auxin IBA used is 2.0 mg / L, while all other operating steps are the same as in Embodiment 4, specifically:

[0091] When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5 cm away from the cotyledon. Treat it with 2.0 mg / L IBA for 5 min. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped, wider at the top and narrower at the bottom. Use it as a grafting scion to graft onto the black wolfberry rootstock obtained in Example 1. Induce adventitious roots in the tomato grafting area.

[0092] Example 12

[0093] The difference in this embodiment is that the concentration of exogenous auxin IBA used is 5.0 mg / L, while all other operating steps are the same as in Embodiment 4, specifically:

[0094] When the tomato CR grows to 3 leaves and 1 heart, cut off the epicotyl 0.5 cm away from the cotyledon. Treat it with 5.0 mg / L IBA for 5 min. Make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped, wider at the top and narrower at the bottom. Use it as a grafting scion to graft onto the black wolfberry rootstock obtained in Example 1. Induce adventitious roots in the tomato grafting area.

[0095] In Examples 4-12 above, each plant consisted of 12 plants. The number of regenerated adventitious roots and the maximum root length were observed and statistically analyzed as follows:

[0096] Table 4

[0097]

[0098] Table 5

[0099]

[0100] As shown in Tables 4 and 5 above, exogenous application of auxin has a certain impact on adventitious root regeneration. Different concentrations and types of auxin have different effects on adventitious root regeneration. In Example 4, the number of regenerated adventitious roots and the maximum root length 14 days after grafting were optimal compared to Examples 5-12. The tables also show that the application of an appropriate amount of exogenous auxin can promote the acquisition of adventitious roots.

[0101] Example 13

[0102] A. Origin and phenotype of adventitious roots

[0103] Observation of the origin of adventitious roots induced in the CR grafting area of ​​tomatoes ( Figure 2 ) and phenotype, comparison of the morphology of adventitious roots of black wolfberry, adventitious roots induced in the CR grafting area of ​​tomato obtained in Example 4, and adventitious root systems regenerated after tomato CR cuttings ( Figure 3 It can be observed that the adventitious roots induced in the CR grafting area of ​​tomatoes exhibit a clear root hierarchy, while the adventitious roots regenerated from black goji berries and tomato CR cuttings show a weaker hierarchy. In particular, the adventitious roots regenerated from tomato CR cuttings are all of similar thickness and grow in clusters like whiskers. The adventitious roots induced in the CR grafting area of ​​tomatoes are significantly thicker than those regenerated from black goji berries and tomato CR cuttings. Phenotypically, the adventitious roots induced in the CR grafting area of ​​tomatoes have a clear advantage over those regenerated from black goji berries and tomato CR cuttings.

[0104] B. Extracting genomic DNA

[0105] Adventitious roots were induced from the CR grafting areas of nine tomato plants obtained in Example 4. Three plants were mixed together, and the samples were replicated three times. Approximately 30 days after grafting, 100 mg of root tissue was taken from each plant, ground with liquid nitrogen, and then added with 1000 μL of liquid nitrogen. Add 2 vol% pre-prepared 65℃ preheated CTAB extraction buffer and 2 μL β-mercaptoethanol to a 2 mL centrifuge tube; incubate at 65℃ for 30 min, shaking every 5 min; cool to room temperature, add 900 μL of a chloroform:isoamyl alcohol = 24:1 mixture, and slowly invert the centrifuge tube 100 times to thoroughly mix the solution; centrifuge at 20℃ and 12000 rpm for 10 min; collect the supernatant, add an equal volume of pre-chilled isopropanol, mix well, and incubate at -20℃ for 30 min; centrifuge at 4℃ and 13000 rpm for 15 min, discarding the supernatant; wash the DNA precipitate twice with pre-chilled 75 vol% ethanol, then wash once with anhydrous ethanol, air dry the precipitate, add 200 μL of ddH2O to dissolve the DNA; add 2 μL of 10 mg / mL... RNase was incubated at 37°C for 30 min; 400 μL of pre-chilled anhydrous ethanol was added, and the mixture was incubated at -20°C for 1 h; the mixture was centrifuged at 12000 rpm for 15 min at 4°C, washed twice with pre-chilled 75 vol% ethanol, then washed once with anhydrous ethanol, dried, and dissolved in 30 μL of ddH2O for later use. DNA concentration was determined using Nanodrop. DNA extraction results are shown below. Figure 4 ,according to Figure 4 This indicates that the extracted DNA structure was intact, without degradation or RNA contamination.

[0106] C. Genome resequencing of adventitious roots:

[0107] The method for resequencing the genome of adventitious roots is as follows: Resequencing the genome is performed using conventional next-generation genome sequencing technology. The DNA library length is 200-300 bp, and each read is 150 bp in length, resulting in at least 24 G of data (the total size of the tomato genome is about 800 M, and 24 G is 30 times the total size of the genome).

[0108] D. Perform bioinformatics analysis:

[0109] The wolfberry genome and tomato genome were merged into a single file using the Linux cat command as a reference genome. Reads aligned with the tomato genome were removed, and the remaining reads were mapped to the wolfberry genome. Sequences with mapped read intervals were extracted, yielding 216 corresponding DNA fragments (see Table 6). The sequence alignment analysis software was BWA (Version: 0.7.17-r1188). Primers were designed based on the mapped sequences, and PCR verification was performed using the standard PCR method. Primers were designed based on weakly aligned sequences to the tomato genome from 216 sequences: 619-F: CTTCCTAGCGACACAGTCCC (SEQ ID NO.5), 619-R: TGGTGCAAGGGATCGTGAAA (SEQ ID NO.6); 426-F: TGGCCTCCAATATGGGCATT (SEQ ID NO.7), 426-R: GAGGACCACACTCATGGCAA (SEQ ID NO.8); 341-F: ATACCCGTGTGAAATGGCCT (SEQ ID NO.9), 341-R: AATGGTTGAGGTCGCTGTCC (SEQ ID NO.10). Using mixed genomic DNA samples from three transformed plants as templates, PCR was performed in the following PCR system:

[0110] DNA template 1μL upstream primer 1μL Downstream primer 1μL Green Taq Mix 12.5μL <![CDATA[ddH2O]]> 9.5μL Total volume 25μL

[0111] The PCR reaction conditions were: 95℃ pre-denaturation for 3 min, 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 30 cycles, and 72℃ extension for 5 min.

[0112] Table 6 216 sequences

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119] PCR results are shown Figure 6 According to this Figure 6 It can be seen that the adventitious roots regenerated from the grafted regions of both wolfberry and tomato contain DNA fragments from wolfberry, while those from tomato do not, thus proving the accuracy of the resequencing data.

[0120] The 216 sequences mapped to the wolfberry genome were merged with the tomato genome using the Linux `cat` command to create a new reference genome. Reads with one end aligned to the tomato genome and the other to the target sequence were identified using BWA software (Version: 0.7.17-r1188). These reads were selected, predicting 42,936 insertion sites for wolfberry DNA fragments into the tomato genome. Of these, 2,240 were inserted into gene regions, 40,696 into intergenic regions, and 2,387 into promoter regions. Further screening using BLAST software yielded 44,298 reads, half from wolfberry and half from tomato.

[0121] Based on the predicted insertion site of the wolfberry DNA fragment in the tomato genome, screening was conducted, and PCR verification was performed on the tomato genome and the root genome of transformed plants. The verification revealed a resequencing sequence >E100041715L1C002R00300424975 (SEQ ID NO.11).

[0122] The DNA fragment AACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCCATCTCCATTTTGTACTGAGAACTTATGAGTCAAAAAGCTTCAAACTCACCGTTAATGGCG, with the first 91 bp derived from wolfberry and the last 59 bp from tomato, was located at positions 67495142 bp-67495200 bp on the tomato NC_015444.3 gene. The wolfberry DNA fragment was inserted into the exon region of the tomato LOC101248594 gene. It was found that this fragment could be cloned from wolfberry tomato, but no insertion site information was found in the tomato genome. See [see details]. Figure 7 , Figure 8 .

[0123] Step 4: Transform the plants for cultivation to simulate the environment of cold regions.

[0124] In an artificial climate chamber simulating cold summer conditions in the West District of the Zijingang Campus in Hangzhou, Zhejiang Province, nine transformed plants with adventitious roots from tomato grafting tissue, nine grafted plants, and nine self-grafted tomato CR plants of uniform growth were selected and transplanted into the artificial climate chamber for cultivation and management. Three and a half months after grafting, the phenotypes and growth of the transformed, grafted, and self-grafted plants were compared. It was found that the transformed and self-grafted plants had vigorous growth, significantly higher than that of the grafted plants. The yield of the transformed plants was higher than that of the self-grafted plants, and significantly higher than that of the grafted plants (Table 7). Furthermore, it was observed that the transformed plants could grow for more than 10 months, with a growth cycle significantly longer than that of the self-grafted plants. Figure 4 This indicates that the transformed plant combines the advantages of tomato and wolfberry root systems, resulting in strong resistance and an extended root growth cycle.

[0125] Table 7 Production Statistics

[0126]

[0127] Finally, it should be noted that the above example of using cleft grafting to graft tomatoes and goji berries to achieve horizontal gene transfer and obtain transformed roots is merely a specific embodiment of the present invention. Obviously, the present invention is not limited to the above embodiment and can have other variations, including with other Solanaceae plants such as peppers and potatoes.

Claims

1. A method for establishing a horizontal gene transfer system between wolfberry and tomato and obtaining transformed roots, characterized in that, Includes the following steps: (1) Select wolfberry seedlings with low lignin content and suitable for grafting as rootstocks, with a lignin content of 204.92-256.76s / g; (2) Select tomato seedlings that have grown to 3 leaves and 1 heart, cut off the epicotyl of the tomato seedling 0.5 cm away from the cotyledon, treat it with exogenous auxin for 5 min, and make two symmetrical cuts along the center line from the bottom of the epicotyl to make the cut tomato wedge-shaped with a wider top and a narrower bottom. Use it as a grafting scion to graft with wolfberry rootstock to establish a high-efficiency grafting system between wolfberry and tomato, and induce the regeneration of adventitious roots in the tomato grafting area. (3) Observe the origin and morphology of adventitious roots in the tomato grafting area, and extract genomic DNA from the adventitious roots in the tomato grafting area. If the regenerated adventitious roots have obvious root classification and wolfberry DNA fragments are detected, it indicates that transformed roots have been obtained. The method for determining whether wolfberry DNA fragments are detected in the adventitious roots in the tomato grafting area is as follows: Genomic DNA was extracted from adventitious roots in the grafted tomato region and resequencing was performed. Bioinformatics analysis was conducted, using the Linux `cat` command to ligate the *Lycium barbarum* genome with the tomato genome. Reads aligned with the tomato genome were removed, and the remaining reads were mapped to the *Lycium barbarum* genome. Sequences with mapped read intervals were extracted, yielding multiple corresponding DNA fragments. Primers were designed based on the mapped sequences, and PCR verification was performed. This confirmed the presence of this *Lycium barbarum* DNA fragment in the adventitious roots of the tomato grafted tissue. The tomato genome and the mapped sequence were mixed as a reference genome, and reads aligned at one end to the tomato genome and at the other end to the target sequence were searched. A short fragment was extracted from the unaligned *Lycium barbarum* fragment, blasted into the reference genome, and short fragments matching only the tomato genome were retained for further screening. If the screening yielded a match, it indicated that the regenerated adventitious roots contained *Lycium barbarum* DNA fragments.

2. The method according to claim 1, characterized in that: The method for cultivating tomato seedlings and wolfberry seedlings with low lignin content suitable for grafting is as follows: Sterile wolfberry seedlings in the culture medium are transferred to the substrate and cultured for 10-20 days. For the first 3 days, 100% humidity is maintained. Afterward, the seedlings are kept at the same temperature (22℃~26℃) and light intensity (100~120 μmol·m⁻¹) as sown tomatoes. -2 ·s -1 They were cultured in an environment with 14 hours of light per day and 85% relative humidity.

3. The method according to claim 1, characterized in that: The method for determining the lignin content of wolfberry is as follows: Select wolfberries that have been cultivated in the substrate for a certain number of days with uniform growth, cut a stem segment of 1 cm from the bottom to the top, 7.5 cm-8.5 cm, and remove the leaves. Place the stem segment in a 15 ml centrifuge tube, open the cap and dry it overnight at 85℃ until constant weight. Grind it into powder, sieve it through a 40-mesh filter, and determine the lignin content in the wolfberry stem segment using the acetyl bromide method. Measure the absorbance of the sample at a wavelength of 280 nm using a spectrophotometer, and calculate the lignin content through a regression curve.

4. The method according to claim 1, characterized in that: In step (1), the method for establishing the rootstock is as follows: cut a wolfberry seedling with low lignin content and suitable for grafting 5 cm down from the top, and cut down 0.5-1.0 cm along the center line of the cross-section after the cut to obtain the rootstock.

5. The method according to claim 1, characterized in that: The grafting method is as follows: insert the cut tomato scion into the 0.5-1.0 cm split of the wolfberry to graft, so that the tomato scion and the rootstock are in full contact, thereby establishing an efficient grafting system between wolfberry and tomato.

6. The method according to claim 1, characterized in that: In step (2), the exogenous auxin used is 2.0 mg / L NAA.

7. The method according to claim 1, characterized in that: In step (3), the method for extracting genomic DNA from the adventitious roots of the tomato grafting region is the modified CTAB method.

8. The method according to claim 1, characterized in that: The method for resequencing the genome of adventitious roots is as follows: resequencing the genome using conventional next-generation sequencing technology, with a DNA library length of 200-300 bp, each read length of 150 bp, and at least 24 G of data obtained.

Images