Salix psammophila spabr1 gene, encoded protein and application thereof

By screening and cloning the Salix psammophila SpABR1 gene and overexpressing it in Arabidopsis thaliana, the problem of insufficient plant drought resistance was solved, the drought resistance of Arabidopsis thaliana was significantly improved, and new stress resistance gene selection and molecular mechanism elucidation were provided.

CN116444635BActive Publication Date: 2025-10-10NORTH CHINA FORESTRY EXPERIMENTAL CENT CHINESE ACAD OF FORESTRY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310347487.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-03
Publication Date
2025-10-10
Estimated Expiration
2043-04-03

AI Technical Summary

Technical Problem

The existing technology lacks effective regulation of plant drought resistance genes, making it difficult to improve the survival ability of plants under drought conditions.

Method used

The SpABR1 gene of Salix psammophila was screened and cloned, and then transferred into the Arabidopsis genome through Agrobacterium-mediated method to achieve overexpression to improve the drought resistance of the plant, and the ABA signaling pathway was used to regulate the drought tolerance of the plant.

Benefits of technology

It significantly improved the drought resistance of Arabidopsis thaliana under drought conditions, showed sensitivity to ABA, enhanced the drought tolerance of plants, and provided new stress resistance gene selection and molecular mechanism elucidation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004161564980000011
    Figure HDA0004161564980000011
  • Figure HDA0004161564980000012
    Figure HDA0004161564980000012
  • Figure HDA0004161564980000021
    Figure HDA0004161564980000021
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to a Salix psammophila SpABR1 gene, a coding protein thereof and application. The full-length cDNA sequence of the gene is shown as SEQ ID No. 1, and the amino acid sequence of the coding protein is shown as SEQ ID No. 2. A Salix psammophila SpABR1 gene closely related to drought is successfully cloned from Salix psammophila. A recombinant plant expression vector containing the SpABR1 gene is introduced into Arabidopsis thaliana to overexpress the gene, and drought resistance of the plant is significantly promoted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a Salix psammophila SpABR1 gene, a coded protein and an application thereof. Background Art

[0002] Salix psammophila is a shrub or small tree of the genus Salix in the family Salicaceae. It is a unique sand-dwelling shrub willow in my country and is mainly distributed in the arid and semi-arid desert areas of northern China. It has excellent characteristics such as drought resistance and wind and sand resistance. As the main force for wind and sand prevention in the north, Salix psammophila plays an important role in maintaining the ecological balance in the desertified areas of the north. Therefore, conducting research on the molecular mechanism of drought resistance of Salix psammophila and exploring key regulatory genes will provide candidate genes and theoretical support for the creation of new drought-resistant forest germplasm.

[0003] Drought is one of the major environmental issues facing the world, affecting the economic, social, and ecological development of arid regions. Plants play a fundamental role in the ecosystems of arid regions, so studying the drought resistance mechanisms of plants is crucial for ecological restoration and economic development in arid regions. Studies have shown that ABA is the main mediator of drought and plays an important role in regulating plant growth, development, and responses to various environmental stresses. When plants are subjected to drought stress, the accumulation of ABA content leads to stomatal closure and the expression of a large number of stress-responsive genes. For example, a NAC transcription factor, VvNAC17, was isolated from grapes. Overexpression of the NAC transcription factor can increase ABA sensitivity and promote ABA-induced stomatal closure, thereby reducing transpiration rate to reduce water loss and enhance plant drought tolerance.

[0004] Salix psammophila SpABR1, an ABA-responsive gene that regulates drought tolerance in Salix psammophila, provides a crucial insight into the molecular mechanisms of drought resistance in the plant. Research on SpABR1 can help us better understand the role of ABA signaling in plant growth, development, and environmental adaptation, and uncover the molecular mechanisms of drought resistance in Salix psammophila. Furthermore, this research not only contributes to our understanding of Salix psammophila's drought resistance mechanisms but also provides high-quality genetic resources and new ideas and methods for genetic improvement of forest tree stress tolerance. This will facilitate the development of other highly stress-tolerant tree species and further promote sustainable development in forestry production, land management, and other areas. Summary of the Invention

[0005] The purpose of the present invention is to improve the drought resistance of plants by utilizing the SpABR1 gene derived from Salix psammophila. To this end, the present invention provides the Salix psammophila SpABR1 gene and its application.

[0006] In order to achieve the above-mentioned purpose, according to a co-expression network constructed after transcriptome sequencing (collection of all mRNAs) of Salix psammophila under drought conditions, a partial sequence of SpABR1 gene of Salix psammophila closely related to drought is screened, a cDNA sequence homologous to the SpABR1 gene of Salix psammophila is screened according to the sequence number in the Salix erythrotricha database, an oligonucleotide primer is designed and synthesized according to the sequence, and a full-length cDNA sequence of the SpABR1 gene of Salix psammophila is cloned by taking the cDNA of Salix psammophila as a template and is named as SpABR1, the gene is cloned by a TOPO reaction, and then the gene is constructed into a plant expression vector by a homologous recombination reaction, positive clones are screened, and the positive clones are transformed into Agrobacterium (GV3101) and then infect Arabidopsis.

[0007] After the above-mentioned treatment, according to the experimental results, the transgenic plants driven by the CaMV 35S promoter derived from the SpABR1 gene of Salix psammophila do not have adverse agronomic traits, and the drought resistance of the Arabidopsis thaliana transformed with the SpABR1 gene is improved.

[0008] Firstly, the present application provides a Salix psammophila SpABR1 protein, which is:

[0009] 1) a protein consisting of the amino acid shown in SEQ ID No. 2; or

[0010] 2) a protein derived from 1) by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID No. 2 and having equivalent activity.

[0011] The present application also provides a gene encoding the Salix psammophila SpABR1.

[0012] In a specific embodiment of the present application, the gene sequence of the Salix psammophila SpABR1 is shown in SEQ ID No. 1.

[0013] The present application also provides a vector, a host cell and an engineered bacterium containing the gene.

[0014] The present application also provides the use of the gene in improving the drought resistance of plants.

[0015] In an embodiment of the present application, the SpABR1 gene is transformed into Arabidopsis thaliana and is overexpressed in the transgenic plant, so as to improve the drought resistance of the transgenic plant.

[0016] The present application also provides a method for constructing a transgenic plant, wherein an overexpression vector containing the SpABR1 gene is transformed into a plant genome by an Agrobacterium-mediated method, and a transgenic plant is obtained by screening.

[0017] Effects achieved by the present application:

[0018] The present invention uses Salix psammophila as the material to screen and identify the SpABR1 gene. Phenotypic identification of overexpressing plants shows that they can improve their ability to cope with drought stress under drought treatment and show sensitivity to ABA. This shows that the SpABR1 gene positively regulates the drought tolerance of plants through the ABA signaling pathway, provides a new option for screening dominant stress resistance genes, and provides more basis for in-depth elucidation of the molecular mechanism of plant drought tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The electrophoresis diagram of the cloned SpABR1 gene provided in Example 1 of the present invention;

[0020] Figure 2 The plasmid map of pCAMBIA1302-SpABR1 obtained by connecting the SpABR1 gene to a plant expression vector provided in Example 1 of the present invention;

[0021] Figure 3 This is the electrophoresis diagram of PCR identification of transgenic Arabidopsis plants provided in Example 4 of the present invention;

[0022] Figure 4 This is a schematic diagram of the quantitative data of transgenic Arabidopsis expression provided in Example 4 of the present invention;

[0023] Figure 5 A schematic diagram of the germination rates of Arabidopsis thaliana seeds heterologously expressing the SpABR1 gene and wild-type Arabidopsis thaliana seeds under mannitol treatment provided in Example 5 of the present invention;

[0024] Figure 6 Schematic diagram of the comparison of simulated drought treatment between Arabidopsis thaliana heterologously expressing the SpABR1 gene and wild-type Arabidopsis thaliana with the same growth period as provided in Example 5 of the present invention;

[0025] Figure 7 This is a schematic diagram of relative water content and relative conductivity under drought treatment provided in Example 5 of the present invention;

[0026] Figure 8 This is a schematic diagram of the response of Arabidopsis thaliana seedlings heterologously expressing the SpABR1 gene and wild-type Arabidopsis thaliana seedlings to ABA provided in Example 6 of the present invention. DETAILED DESCRIPTION

[0027] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are based on conventional experimental conditions or the conditions recommended by the manufacturer's instructions.

[0028] Example 1 Cloning of SpABR1 gene

[0029] 1. Salix psammophila RNA extraction and quality testing

[0030] With Salix psammophila as the material, the leaves were collected and quickly placed in liquid nitrogen, and then ground with a pestle. The RNA Easy Fast Plant Tissue RNA Fast Extraction Kit was used. The sample was stored at -80℃ for later use.

[0031] 2. Synthesis of Salix cDNA

[0032] The Salix cDNA was synthesized using the FastKing RT Kit (With gDNase) kit from Tiangen. The sample was stored at -20℃ for later use.

[0033] 3. Cloning of Salix SpABR1 gene

[0034] According to the sequence number in the Phytozome database of red willow, the cDNA sequence homologous to the Salix SpABR1 gene was screened, and the primer was designed using primer 5 software according to the sequence. The full-length gene was amplified by PCR. The gene cloning results are shown in Figure 1

[0035] The SpABR1 ORF forward primer sequence is as follows:

[0036] ATGAACATGAAGGGACAGGTTG

[0037] The SpABR1 ORF reverse primer sequence is as follows:

[0038] TTAAGAGGAAGAACTCGCCAGAG

[0039] The high-fidelity PCR reaction system is as follows:

[0040] TaKaRa high-fidelity amplification enzyme PrimeSTAR 25μl, forward primer (10μM) 2μl, reverse primer (10μM) 2μl, template (Salix cDNA) 4μl, sterile ddH2O to 25μl; reaction program: pre-denaturation 95℃, 5min; denaturation 95℃, 10s; annealing 57℃, 30s; extension 72℃, 50s, 38 cycles; final extension 72℃, 2min.

[0041] The T vector was connected by using the Novozyme TOPO cloning reaction kit, and the single clone was picked after transformation and plating. The bacterial liquid PCR verification was sent for sequencing detection. The reaction system was: 5×TOPO-Blunt Cloning Mix 2μl; PCR purified product 30ng; sterile ddH2O to 10μl; reaction program: 20~37℃ reaction for 5min.

[0042] ​The final obtained full-length cDNA sequence of the gene was 708 bp, named SpABR1 gene, and the sequence is shown in SEQ ID No.1.

[0043] Example 2 Construction of Salix psammophila SpABR1 plant expression vector

[0044] A plant expression vector for the SpABR1 gene was constructed using ClonExpress technology. The target fragment was amplified using specific PCR primers (with pCAMBIA1302 homology arms incorporated into the primers). The pCAMBIA1302 vector was double-digested to linearize the vector, heat-inactivated at 80°C for 25 minutes, and cooled on ice before ligation with the target fragment.

[0045] The pCAMBIA1302-SpABR1 ORF forward primer sequence is as follows:

[0046] GGACTCTTGACCATGATGAACATGAAGGGACAGGTTG;

[0047] The pCAMBIA1302-SpABR1 ORF reverse primer sequence is as follows:

[0048] TTCTCCTTTACTAGTTTAAGAGGAAGAACTCGCCAGAG.

[0049] The reaction system is as follows: 15 ng of target gene, 105 ng of vector, 2 μl of 5×CE II Buffer, 1 μl of Exnase II, and 10 μl of ddH2O. The reaction procedure is: incubate at 37°C for 30 min, then cool to 4°C or immediately cool on ice.

[0050] Positive clones were picked from the screening culture plate for PCR detection and sequenced for use. The plasmid map of pCAMBIA1302-SpABR1 is shown in the figure. Figure 2 shown.

[0051] Example 3 Genetic transformation of SpABR1 gene

[0052] Genetic transformation of Arabidopsis thaliana was performed by the floral dipping method. The specific steps are as follows:

[0053] Agrobacterium carrying the pCAMBIA1302-SpABR1 plasmid constructed in Example 2 was cultured in LB liquid medium containing kanamycin and rifampicin at 28°C and 220 rpm. When the OD600 value of the LB liquid medium (bacterial suspension) reached 1.4-1.6, the culture was shaken and resuspended in AAM suspension. When the OD600 value reached 0.6-0.8, it was used to infect Arabidopsis thaliana. Transformation was performed once in the early flowering phase of the Arabidopsis thaliana, followed by another injection every 7 days. After the pods matured, seeds were harvested as the T0 generation.

[0054] Example 4 Screening of transgenic Arabidopsis thaliana expressing the Salix psammophila SpABR1 gene

[0055] After vernalization, T0 generation seeds were sown in 1 / 2MS medium containing 25 mg / L hygromycin in a clean bench. After one week of culture, some seedlings were observed to be yellow and wilted, while others were green and growing well, which were positive seedlings. The positive seedlings were transferred to nutrient soil for culture. Each Arabidopsis seedling was T1 generation. When Arabidopsis grew 6-8 cotyledons, 2-3 cotyledons were cut and gDNA was extracted using the CTAB method for PCR identification. The results showed that a total of 12 positive SpABR1 transgenic wild-type Arabidopsis plants ( Figure 3 ).

[0056] The SpABR1 ORF forward primer sequence is as follows:

[0057] ATGAACATGAAGGGACAGGTTG

[0058] The SpABR1 ORF reverse primer sequence is as follows:

[0059] TTAAGAGGAAGAACTCGCCAGAG

[0060] The positive T1 generation plants were retained, and RNA was extracted from 12 positive plants. After reverse transcription, qRT-PCR was performed for quantification to verify the expression level of the SpABR1-transfected Arabidopsis plants.

[0061] The SpABR1-QF forward primer sequence is as follows:

[0062] AACATGAAGGGACAGGTTGC

[0063] The SpABR1-QF reverse primer sequence is as follows:

[0064] GCGAAACCTGTAGGCAAAAG

[0065] The results are as follows Figure 4As shown, OE-3 and OE-7 plants with high expression levels were selected, Arabidopsis seeds were collected, and the above method was followed until Arabidopsis T3 seeds were cultivated and screened, and collected for subsequent drought resistance phenotypic identification and analysis.

[0066] Example 5 Drought resistance evaluation of transgenic Arabidopsis thaliana expressing the Salix psammophila SpABR1 gene

[0067] This example analyzes multiple physiological indicators of Arabidopsis thaliana transgenic with the SpABR1 gene, and the specific steps are as follows:

[0068] 1) Determination of germination rate of SpABR1 transgenic Arabidopsis thaliana under mannitol treatment

[0069] SpABR1 transgenic T3 homozygous seeds and wild-type Arabidopsis seeds were sown on 1 / 2 MS solid culture plates containing 300mM mannitol. After vernalization at 4°C, the plates were sealed and incubated at 24°C under light. Wild-type Arabidopsis seeds (WT) were used as a control, and their germination rates were calculated. Figure 5 As shown, the germination rate of transgenic plants treated with 300 mM mannitol was significantly different from that of wild-type Arabidopsis. After overexpressing the SpABR1 gene, the germination rate of Arabidopsis was greatly increased after mannitol treatment.

[0070] 2) Epigenetic observation of SpABR1 transgenic Arabidopsis under drought stress

[0071] SpABR1 transgenic Arabidopsis plants and wild-type Arabidopsis plants were screened, and plants with consistent growth cycles, good condition, and similar appearance were transferred to a nutrient medium (nutrient medium was nutrient soil: vermiculite = 4:1) and placed in a culture room (temperature 25°C; relative humidity 70%; photoperiod of 8 hours dark, 16 hours light; light intensity 4500lx) for cultivation. After 30 days of cultivation, simulated drought was started (watering was stopped). During the 10 days of drought and under normal growth conditions, the morphology of the transgenic and wild-type Arabidopsis plants was observed and recorded, and the differences between the two groups were compared ( Figure 6 Under normal growth conditions, there was no significant difference between WT and transgenic Arabidopsis plants, and both plants grew well. However, after 10 days of drought treatment, the germination rate of transgenic plants was significantly different from that of wild-type Arabidopsis, and WT and transgenic Arabidopsis plants showed significant wilting.

[0072] 3) Determination of relative water content and relative conductivity

[0073] The relative water content of Arabidopsis leaves was determined using the drying and weighing method. Leaves from each group of Arabidopsis plants were collected, and the collected fresh leaves were rinsed with pure water. Filter paper was used to absorb the moisture on the Arabidopsis leaves, and the leaves were placed on an analytical balance to weigh the fresh weight (FW). After weighing the fresh weight, the leaves were roughly divided into two parts. One part was placed in a paper bag and placed in an oven (temperature 100-105℃, time 15min) for fixing. After fixing, the oven temperature was adjusted to 70-80℃, and the leaves were dried to constant weight and the dry weight (DW) was weighed. The other part was immersed in ultrapure water. After 60 minutes, the leaf material that reached constant weight was taken out, the surface moisture was wiped with filter paper, and weighed (SFW).

[0074] Leaf relative water content (%) = (FW-DW) / (SFW-DW)*100%

[0075] Relative conductivity was determined using the method of Li Hesheng. Leaves were collected from each group of Arabidopsis plants and rinsed with pure water. The leaves were then dried using filter paper. Leaf discs were then punched (avoiding the main veins). Twenty leaf discs were randomly selected from each group and placed in a small beaker containing 50 mL of deionized water. Vacuum was applied for 20 minutes. After the vacuum was completed, the solution conductivity was measured, denoted as R1. The beaker was then placed in a boiling water bath and heated for 20 minutes. After cooling to room temperature, the solution conductivity was measured again, denoted as R2.

[0076] Relative conductivity (%) = R1 / R2*100%.

[0077] The results are as follows Figure 7 As shown in the figure, under normal growth conditions, there was no significant difference in the relative water content and relative electrical conductivity of leaves between WT and transgenic Arabidopsis. After 10 days of drought treatment, there was a significant difference between WT and transgenic Arabidopsis.

[0078] Example 6 Response of Transgenic Arabidopsis thaliana Expressing the Salix psammophila SpABR1 Gene to ABA

[0079] Prepare 1 / 2MS solid medium containing 30μM ABA, vernalize the seeds of Arabidopsis thaliana overexpressing SpABR1, and sow them on plates in a clean bench. After sealing, place them in a light incubator and culture them vertically. After 4 days of culture, transfer the seedlings to 1 / 2MS solid medium containing 30mM ABA and continue to culture for 7 days. WT was used as a control to observe the root length and fresh weight. The results are as follows. Figure 8 As shown in the figure, in the absence of ABA treatment, the root length of the transgenic seedlings had no significant difference from that of the control. However, after treatment with 30 μM exogenous ABA, the root length and fresh weight of the transgenic seedlings were significantly lower than those of the control, and the transgenic plants showed a hypersensitive response.

[0080] In summary, the SpABR1 gene can significantly improve the drought resistance of Arabidopsis thaliana, and the SpABR1 gene may improve the drought resistance of plants through the ABA signaling pathway.

[0081] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. Use of a gene encoding Salix psammophila SpABR1 protein in improving drought resistance in Arabidopsis thaliana, wherein: The amino acid sequence of the Salix psammophila SpABR1 protein is shown in SEQ ID No.

2.

2. The use according to claim 1, characterized in that The gene is transferred into the Arabidopsis genome and is overexpressed in the transgenic Arabidopsis to improve the drought resistance of the Arabidopsis.

3. The use according to claim 1 or 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID No.

1.

4. A method for improving drought resistance of Arabidopsis thaliana, characterized in that: The gene encoding the Salix psammophila SpABR1 protein was transferred into the Arabidopsis genome and overexpressed in the transgenic Arabidopsis. The amino acid sequence of the Salix psammophila SpABR1 protein is shown in SEQ ID No.

2.

5. The method according to claim 4, wherein The nucleotide sequence of the gene is shown in SEQ ID No. 1.