Engineering strain of Saccharomyces cerevisiae capable of efficiently degrading alkanes and its application

Abstract

The present invention relates to the field of genetic engineering technology, and in particular to an engineering yeast of saccharomyces cerevisiae for efficiently degrading alkanes and its application. The present invention uses saccharomyces cerevisiae BY4741 as a starting strain, introduces high-copy alkm, alkR, LaoA and LaoB into it, and constructs a saccharomyces cerevisiae engineering strain with high degradation efficiency for alkanes. Experimental results show that the introduction of high-copy alkane hydroxylase alkm and alkane hydroxylase transcription activator alkR can achieve an alkane degradation efficiency of 28.36%; the introduction of high-copy alkane hydroxylase alkm, aldehyde dehydrogenase LaoA and its coenzyme LaoB can achieve an alkane degradation rate of 29.94%; compared with the starting strain, the alkane degradation efficiency is significantly improved. The strain can be used in alkane degradation, and based on the introduction of SCRaMbLE technology in saccharomyces cerevisiae, it has better transformation potential.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an engineering yeast of saccharomyces cerevisiae capable of efficiently degrading alkanes and an application thereof. Background Art

[0002] Petroleum hydrocarbons are common environmental pollutants that endanger terrestrial and aquatic ecosystems due to their accumulation in the environment. Traditional physical and chemical treatments are expensive and have limited efficiency. With the development of synthetic biology and metabolic engineering strategies, microbial remediation technology is considered to be one of the most suitable methods for treating petroleum pollution due to its low cost and low environmental impact, and has received increasing attention. Although microbial remediation technology has developed rapidly and made significant progress, there are still many environmental factors that limit its efficiency in environmental remediation.

[0003] At present, the genes SYHY, AlmA and alkm for degrading alkanes have been constructed in Saccharomyces cerevisiae BY4741 and synthetic yeast containing only chromosome X, and engineered strains with the function of degrading hexadecane have been obtained. The modified strains with higher degradation efficiency have been screened out and combined with three Pseudomonas aeruginosa strains to form a mixed bacterial system for degrading hexadecane. However, the alkane degradation efficiency of the modified Saccharomyces cerevisiae strains is low. Although other types of engineered yeasts have higher alkane degradation efficiency, different environments and different composite bacterial systems have different requirements for strains. Therefore, the development of new high-alkane-degrading Saccharomyces cerevisiae strains is of great practical significance. Summary of the invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide an engineered yeast of Saccharomyces cerevisiae for efficiently degrading alkanes and its application.

[0005] The present invention provides a combined enzyme, which includes an alkane hydroxylase (alkm), an alkane hydroxylase transcription activator (alkR), an aldehyde dehydrogenase (LaoA) and / or an aldehyde dehydrogenase coenzyme (LaoB).

[0006] Furthermore,

[0007] The alkane hydroxylase alkm is derived from Acinetobacter sp. strain ADP1;

[0008] The alkane hydroxylase transcription activator is derived from Acinetobacter sp. strain ADP1;

[0009] The aldehyde dehydrogenase is derived from Pseudomonas aeruginosa PAO1;

[0010] The aldehyde dehydrogenase coenzyme is derived from Pseudomonas aeruginosa PAO1.

[0011] Furthermore, in the enzyme combination of the present invention,

[0012] The amino acid sequence of the alkane hydroxylase is shown in SEQ ID NO: 1;

[0013] The amino acid sequence of the alkane hydroxylase transcription activator is shown in SEQ ID NO: 3;

[0014] The amino acid sequence of the aldehyde dehydrogenase is shown in SEQ ID NO: 5;

[0015] The amino acid sequence of the aldehyde dehydrogenase coenzyme is shown in SEQ ID NO:7.

[0016] The present invention provides a nucleic acid encoding at least one enzyme in the combined enzyme.

[0017] Furthermore, in the nucleic acid of the present invention,

[0018] The nucleic acid encoding the alkane hydroxylase has the nucleotide sequence shown in SEQ ID NO: 2;

[0019] The nucleic acid encoding the alkane hydroxylase transcription activator has the nucleotide sequence shown in SEQ ID NO:4;

[0020] The nucleic acid encoding the aldehyde dehydrogenase has the nucleotide sequence shown in SEQ ID NO: 6;

[0021] The nucleic acid encoding the aldehyde dehydrogenase coenzyme has a nucleotide sequence as shown in SEQ ID NO:8.

[0022] The nucleic acid described in the present invention also includes nucleic acids encoding the combined enzyme in a single or multiple form connected in series, and the multiple forms include but are not limited to 2, 3, 4, 5, 6, etc.

[0023] The nucleic acid encoding the recombinant antigen of the present invention can be DNA, RNA, cDNA or PNA. In an embodiment of the present invention, the nucleic acid is in the form of DNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. Nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). Nucleic acid can be linear or circular in topology. Nucleic acid can be, for example, a part of a vector (e.g., an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc.

[0024] In the present invention, the DNA sequence encoding the combined enzyme is optimized, and these optimizations include but are not limited to: codon usage preference, elimination of secondary structures that are not conducive to expression (such as hairpin structures), changes in GC content, CpG dinucleotide content, secondary structure of mRNA, cryptic splicing sites, early polyadenylation sites, internal ribosome entry sites and binding sites, negative CpG islands, RNA unstable regions, repeat sequences (direct repeats, inverted repeats, etc.) and restriction sites that may affect cloning.

[0025] The present invention provides an expression unit comprising a promoter, a terminator and the nucleic acid of the present invention.

[0026] Furthermore, the expression unit described in the present invention refers to a DNA sequence starting from a promoter and ending at a terminator. A regulatory segment may also be included on both sides or between the promoter and the terminator, and the regulatory segment may include a promoter, an enhancer, a transcription termination signal, a polyadenylation sequence, a replication origin, a nucleic acid restriction site, and a homologous recombination site operably linked to the nucleic acid sequence, such as an enhancer of the promoter, a poly(A) signal, etc.

[0027] The present invention provides a recombinant vector, which comprises a vector backbone and,

[0028] The nucleic acid of the present invention, and / or

[0029] The expression unit of the present invention.

[0030] Furthermore, in the recombinant vector of the present invention, the vector backbone comprises at least one of PRS426, PRS416 and / or PRS425.

[0031] The present invention screens vector backbones. In some embodiments of the present invention, the vector backbone used is a single-copy vector backbone, such as PRS416, which is integrated with the nucleic acid described in the present invention to form a recombinant vector introduced into the strain; in other embodiments of the present invention, such as PRS426 and PRS425, the vector backbone used is a multi-copy vector backbone, which is integrated with the nucleic acid described in the present invention to form a recombinant vector introduced into the strain; experimental results show that the alkane degradation efficiency of the alkane-degrading engineered bacteria constructed by the multi-copy vector-introduced strain is significantly improved.

[0032] In the present invention, the nucleic acid or expression unit can be integrated with the vector backbone alone, or can be repeatedly connected in series and then integrated with the vector backbone, which is not limited in the present invention. Further, the nucleic acid or expression unit of the present invention can be located on the same recombinant vector, or can be located separately on different vectors, which is not limited in the present invention.

[0033] Recombinant vector of the present invention refers to a recombinant nucleic acid vector, which is a recombinant DNA molecule, which comprises a desired coding sequence and an appropriate nucleic acid sequence or element that is essential for the expression of an operably connected coding gene in a specific host organism. The nucleic acid sequence or element necessary for the expression in a eukaryotic microorganism includes a promoter, a ribosome binding site and possible other sequences. Known eukaryotic cells utilize promoters, enhancers and terminators. Once transformed into a suitable host, the vector can be replicated and play a role independently of the host genome, or, in some cases, integrate into the genome itself. In this specification, "plasmid" and "vector" can sometimes be interchanged and used, because plasmid is the most commonly used vector form at present. However, the present invention is intended to include such other forms of expression vectors, which play an equivalent role, which is known in the art or will become known. In a specific embodiment, the nucleic acid encoding the combined enzyme provided by the present invention can be constructed in various eukaryotic expression vectors.

[0034] The present invention provides a strain,

[0035] Genome integration of the nucleic acid of the present invention; and / or

[0036] Genome integration of the expression unit of the present invention; and / or

[0037] Transfect or transform the recombinant vector of the present invention.

[0038] Furthermore, the starting strain of the strain described in the present invention is Saccharomyces cerevisiae BY4741.

[0039] The vector constructed using recombinant DNA technology is transformed or transfected into a strain, so that the transformed or transfected strain has the ability to replicate the protein-encoding vector or express the desired protein.

[0040] Furthermore, the transformation methods include chemical transformation and electrotransformation; the transfection methods include calcium phosphate coprecipitation, artificial liposome method, and viral transfection. The viral transfection includes adenovirus transfection, adeno-associated virus transfection, lentivirus transfection, etc.

[0041] The present invention provides a method for degrading petroleum hydrocarbons, which utilizes the strain of the present invention to degrade the petroleum hydrocarbons.

[0042] In the present invention, Saccharomyces cerevisiae BY4741 is used as a starting strain for the construction of an alkane-efficient engineering strain. Compared with other yeast strains, the Saccharomyces cerevisiae strain, as a synthetic yeast, can be introduced with the SCRaMbLE technology, and thus has a transformation potential that other types of yeast strains do not have. At the same time, in the present invention, the enzymes of the alkane metabolic pathway introduced are all high-copy. Experimental results show that the alkane degradation efficiency of the strain introduced with the high-copy vector is significantly higher than that of the strain introduced with the single-copy vector, and compared with the starting strain, the introduction of alkm, alkR, LaoA and LaoB significantly improves the alkane degradation efficiency of Saccharomyces cerevisiae.

[0043] The present invention uses Saccharomyces cerevisiae BY4741 as a starting strain, introduces high-copy alkm, alkR, LaoA and LaoB into it, and constructs a Saccharomyces cerevisiae engineering strain with high alkane degradation efficiency. Experimental results show that the introduction of high-copy alkane hydroxylase alkm and alkane hydroxylase transcription activator alkR can achieve an alkane degradation efficiency of 28.36%; the introduction of high-copy alkane hydroxylase alkm, aldehyde dehydrogenase LaoA and its coenzyme LaoB can achieve an alkane degradation rate of 29.94%; compared with the starting strain, the alkane degradation efficiency is significantly improved. The strain can be used in alkane degradation, and based on the introduction of SCRaMbLE technology in Saccharomyces cerevisiae, it has better transformation potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Schematic diagram of the alkane degradation pathway introduced into Saccharomyces cerevisiae;

[0045] Figure 2 The growth conditions of 4741, 416-alkm, and 426-alkm in SC+10g / L hexadecane medium for 96h are shown;

[0046] Figure 3 The degradation rates of 4741, 416-alkm and 426-alkm in 96h are shown;

[0047] Figure 4 Schematic diagram showing the introduction of the alkane hydroxylase transcription activator gene alkR into the engineered yeast strain 426-alkm;

[0048] Figure 5 The growth of 426-alkm and 426-alkm+425-alkR in SC+10g / L hexadecane medium for 96h is shown;

[0049] Figure 6 The degradation efficiency of 426-alkm and 426-alkm+425-alkR for 96 h is shown;

[0050] Figure 7Schematic diagram showing the introduction of aldehyde dehydrogenase LaoA and its coenzyme LaoB into the engineered yeast strain 426-alkm;

[0051] Figure 8 The growth conditions of 426-alkm, 426-alkm+425-LaoA and 426-alkm+425-LaoA B in SC+10 g / L hexadecane medium for 96 h are shown;

[0052] Fig. 9 The degradation efficiency of 426-alkm, 426-alkm+425-LaoA and 426-alkm+425-LaoAB for 96h is shown. DETAILED DESCRIPTION

[0053] The present invention provides an engineered yeast for efficiently degrading alkanes and its application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application of this article without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.

[0054] The genome rearrangement system (SCRaMbLE-loxP-mediated synthetic chromosome rearrangement technology) is a genome reconstruction technology unique to synthetic yeast genomes, which is strategically arranged with hundreds of symmetrical loxPsym sites. The present invention introduces alkm, alkR, LaoA and LaoB into Saccharomyces cerevisiae cells, and the obtained strain can be used for alkane degradation. At the same time, based on the introduction of SCRaMbLE technology into Saccharomyces cerevisiae, it provides a good foundation for further rearrangement and transformation.

[0055] alkm amino acid sequence:

[0056]

[0057]

[0058] The gene sequence after alkm codon optimization:

[0059]

[0060] alkR amino acid sequence:

[0061]

[0062] alkR gene sequence after codon optimization:

[0063]

[0064]

[0065] LaoA amino acid sequence:

[0066]

[0067] LaoA codon optimized gene sequence:

[0068]

[0069]

[0070] LaoB amino acid sequence:

[0071]

[0072] LaoB codon optimized gene sequence:

[0073]

[0074] Linker gene sequence: ggtcgacggatccccgggttaattaac (SEQ ID NO: 9). The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0075] The present invention will be further described below in conjunction with embodiments:

[0076] Example 1 Construction of Saccharomyces cerevisiae engineered strains and study of alkane degradation efficiency

[0077] 1. In this study, wild-type strain BY4741 of Saccharomyces cerevisiae was selected to construct an engineered strain that can efficiently degrade n-hexadecane. As a model organism, Saccharomyces cerevisiae has a clear genetic background and is easy to operate. The SCRaMbLE technology has been introduced to facilitate subsequent rearrangement screening operations.

[0078] 2. Construction of Saccharomyces cerevisiae chassis cells for the degradation of n-hexadecane

[0079] 2.1 Preliminary introduction of alkm alkane hydroxylase

[0080] The alkane hydroxylase alkm (amino acid sequence as shown in SEQ ID NO: 1) from Acinetobacter sp. strain ADP1 (accession number: AJ002316.1) was introduced into Saccharomyces cerevisiae to preliminarily achieve the degradation of alkanes. The nucleotide sequence after codon optimization is shown in SEQ ID NO: 2.

[0081] like Figure 1 As shown in Figure 1, the gene alkm was integrated into the PRS416 single-copy plasmid and the PRS426 multi-copy plasmid, and then introduced into the chassis cells to obtain two engineered strains, named 416-alkm and 426-alkm. Together with the original BY4741 strain without any vector, the three strains were fermented and verified, and the growth was shown in Figure 1. Figure 2 As shown in Figure 2, the alkane degradation efficiency is Figure 3 shown.

[0082] Depend on Figure 3 It can be seen that the degradation rate of the control group 4741 was 0 after 96 hours of fermentation, the degradation efficiency of the 416-alkm engineering yeast strain could reach 10.37% after 96 hours of fermentation, and the degradation efficiency of the 426-alkm engineering yeast strain could reach 19.68%.

[0083] 2.2 Introduction of transcriptional activator alkR gene into engineered Saccharomyces cerevisiae 426-alkm

[0084] The transcriptional activator alkR (amino acid sequence shown in SEQ ID NO: 3) of alkane hydroxylase from Acinetobacter sp. strain ADP1 (accession number: AJ002316.1) was introduced into the engineered Saccharomyces cerevisiae strain 426-alkm to further improve the degradation of alkanes. The nucleotide sequence after codon optimization is shown in SEQ ID NO: 4.

[0085] The construction process is as follows Figure 4 As shown, by integrating the gene alkR into the PRS425 multi-copy plasmid and then introducing it into the chassis cell-engineered yeast strain 426-alkm, an engineered strain was obtained, named 426-alkm+425-alkR, and the obtained strain was fermented and verified, and the growth condition was shown in Figure 5 , the alkane degradation efficiency is as follows Figure 6 As shown,

[0086] Depend on Figure 6 It can be seen that the degradation rate of the control group 4741 was 0 after 96 hours of fermentation, the degradation efficiency of the 426-alkm engineered yeast strain could reach 19.68% after 96 hours of fermentation, and the degradation efficiency of the 426-alkm+425-alkR engineered yeast strain could reach 28.36%.

[0087] 4.2.3 Gene introduction of aldehyde dehydrogenase LaoA and its coenzyme LaoB into engineered Saccharomyces cerevisiae 426-alkm

[0088] The degradation of alkanes was further improved by introducing the aldehyde dehydrogenase LaoA (accession number: PA0364, the amino acid sequence is shown in SEQ ID NO: 5, and the nucleotide sequence after codon optimization is shown in SEQ ID NO: 6) from Pseudomonas aeruginosa PAO1 and its coenzyme LaoB (accession number: PA0365, the amino acid sequence is shown in SEQ ID NO: 7, and the nucleotide sequence after codon optimization is shown in SEQ ID NO: 8) into the engineered Saccharomyces cerevisiae strain 426-alkm.

[0089] The construction process is as follows Figure 7 As shown, the gene LaoA alone and LaoA and LaoB were connected by linker (as shown in SEQ ID NO: 9) and integrated into the pRS425 multi-copy plasmid, and then introduced into the chassis cell-engineered yeast strain 426-alkm, to obtain two engineered strains, named 426-alkm+425-LaoA and 426-alkm+425-LaoAB, and the two strains were fermented and verified, and the growth conditions were shown in Figure 8 As shown in Figure 2, the alkane degradation efficiency is Fig. 9 As shown,

[0090] Depend on Fig. 9 It can be seen that the degradation rate of the control group 426-alkm was 19.68% after 96 hours of fermentation, the degradation efficiency of the 426-alkm+425-LaoA engineered yeast strain could reach 27.50% after 96 hours of fermentation, and the degradation efficiency of the 426-alkm+425-LaoAB engineered yeast strain could reach 29.94%.

[0091] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A strain, characterized in that The base strain is Saccharomyces cerevisiae BY4741 and: Expression of alkm and alkR, or expressing alkm and LaoA, or expressing alkm and LaoA and LaoB; in, alkm is an alkane hydroxylase derived from Acinetobacter sp. strain ADP1; alkR is the transcriptional activator of alkane hydroxylase derived from Acinetobacter sp. strain ADP1; LaoA is an alcohol dehydrogenase from Pseudomonas aeruginosa PAO1; LaoB is the alcohol dehydrogenase coenzyme from Pseudomonas aeruginosa PAO1; The amino acid sequence of the alkane hydroxylase is shown in SEQ ID NO: 1; The amino acid sequence of the alkane hydroxylase transcription activator is shown in SEQ ID NO: 3; The amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:5; The amino acid sequence of the alcohol dehydrogenase coenzyme is shown in SEQ ID NO:

7.

2. The strain according to claim 1, characterized in that The nucleic acid sequence encoding the alkane hydroxylase is shown in SEQ ID NO: 2; The nucleic acid sequence encoding the alkane hydroxylase transcription activator is shown in SEQ ID NO:4; The nucleic acid sequence encoding the alcohol dehydrogenase is shown in SEQ ID NO:6; The nucleic acid sequence encoding the alcohol dehydrogenase coenzyme is shown in SEQ ID NO:

8.

3. A method for degrading petroleum hydrocarbons, comprising degrading petroleum hydrocarbons using the strain as claimed in claim 1 or 2.

Images