Preparation and application of adenine base editor mRNA

Abstract

The application discloses an adenine base editor CE-8e-SpRY mRNA for in-vitro expression and application thereof as a gene editing tool, and comprises mRNA expression vector construction, mRNA in-vitro preparation and mRNA biological activity testing. After the CE-8e-SpRY mRNA provided by the application is transduced into hematopoietic stem cells, PCR amplification and first-generation sequencing verification are performed on a target site of gene editing, and it is verified that the CE-8e-SpRY mRNA provided by the application has high editing activity.

Description

Technical Field

[0001] This invention relates to the field of bioengineering, specifically to the preparation of adenine base editor CE-8e-SpRY mRNA and its application as a gene editing tool. Background Technology

[0002] In recent years, gene editing technology has become an important research direction in new drug development and gene correction, especially the CRISPR / Cas system. As a revolutionary and powerful genome editing tool, it has revolutionized the field. However, the traditional CRISPR / Cas9 system struggles to achieve efficient, stable, and precise editing. Base editing technology, on the other hand, targets specific single bases without causing double-strand breaks in DNA, allowing for precise DNA repair. Compared to other existing gene editing technologies, base editing technology holds the promise of filling gaps in CRISPR / Cas9 technology, achieving higher editing efficiency and better safety. Base editing systems consist of a base editor and guide RNA. Compared to other existing gene editing technologies, it is more precise, capable of editing specific base pairs on DNA or RNA. However, issues such as low efficiency at certain sites, limited editing range, and off-target effects still hinder the application of base editing systems. The CE-8e-SpRY base editing tool can, in principle, target almost all genomic sites by embedding the TadA-8e monomer into SpRY-nCas9, significantly improving targeting efficiency and exhibiting low RNA and DNA off-target activity. These advantages greatly expand the application scope of CE-8e-SpRY in clinical treatment.

[0003] Currently, an increasing number of companies are investing in base editing therapies, indicating the enormous potential of this approach. However, delivery methods remain a significant research challenge. The mainstream approach involves using electroporation to efficiently deliver drugs to blood cells and immune cells in vitro before reinfusing them into the patient, or using LNPs or AAVs for in vivo drug delivery to the liver and other organs. Base editing systems can be in the form of plasmid DNA, mRNA, or ribonucleoprotein complexes. Among these, mRNA technology offers advantages such as high efficiency, safety, simple preparation, short production cycle, and low cost. Compared to other technologies like DNA and protein editing, mRNA synthesized through in vitro transcription is introduced into specific cells using a suitable delivery system. The cells then use their own translation system to translate the mRNA into the target protein, turning them into mini-factories for protein drug production. The proteins produced by these cells exert their therapeutic effects. Vaccines and drugs developed based on mRNA technology will be a key direction for the development of the biopharmaceutical industry.

[0004] Currently, in vitro transcribed messenger RNA (mRNA) therapy shows great potential. mRNA drugs utilize chemically modified messenger RNA molecules to enter the cytoplasm, where they are transcribed and expressed using the cytoplasm's own nucleotides to generate proteins needed by the body. mRNA drug research is being combined with vaccines, nanotechnology, immunotherapy, and gene therapy, providing new methods and ideas for solving various intractable diseases. Unlike plasmid DNA and viral vectors, mRNA does not need to enter the cell nucleus; once it enters the cytoplasm from outside the cell, it is immediately transcribed. Therefore, mRNA does not need to integrate into the host genome, avoiding the risk of insertional gene mutations. Furthermore, the proteins expressed by mRNA utilize the patient's own post-translational modification system, solving the problem of some proteins being undrugable. Exogenous mRNA entering the cell has only transient activity and can be completely degraded through physiological metabolism. In recent years, in particular, advancements in in vitro transcription technology combined with the introduction of modified nucleotides, chemical and enzymatic capping methods, HPLC purification, and liposome and lipid nanoparticle delivery systems have largely solved the challenges of efficient in vitro preparation, stability, and delivery of mRNA. Therefore, the potential of mRNA in developing new therapies is increasingly recognized. Summary of the Invention

[0005] The purpose of this invention is to provide a method for preparing CE-8e-SpRY mRNA and its application as a base editing therapy drug.

[0006] According to a first aspect of the present invention, an mRNA is provided comprising a nucleic acid coding region encoding CE-8e-SpRY, wherein the mRNA further comprises one or more of the following:

[0007] 5'-cap structure, preferably cleancap AG (Cap1 structure);

[0008] The 3'-PolyA sequence contains 100 adenosine nucleotides, with a stable linker added between the 30th and 31st adenosine nucleotides, as shown in SEQ ID NO.1:

[0009] 3'-PolyA sequence (SEQ ID NO.1):

[0010] AAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAA

[0011] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA;

[0012] The 5'-UTR sequence, preferably derived from any 5'-UTR of a gene providing stable mRNA, is shown in SEQ ID NO.2 to SEQ ID NO.7:

[0013] SEQ ID NO.2:

[0014] GCAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCC

[0015] CGGACTCGCCACC

[0016] SEQ ID NO.3:

[0017] AAGTGAACAATGGGCGCCCAGCTCTAAAGCCACC

[0018] SEQ ID NO.4:

[0019] ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACGCC

[0020] ACC

[0021] SEQ ID NO.5:

[0022] ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC

[0023] SEQ ID NO.6:

[0024] GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCA

[0025] GCCGAGCCACATCGCTCAGACGCCACC

[0026] SEQ ID NO.7:

[0027] GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGC CACC;

[0028] The 3'-UTR sequence, preferably derived from the 3'-UTR of a gene providing stable mRNA, more preferably as shown in SEQ ID NO. 8:

[0029] SEQ ID NO.8:

[0030] GCTGGAGCCTCGGTGGCCATGCTTTCTTGCCCCTTGGGCCTCCCCCCAGCCC

[0031] CTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC;

[0032] The modified nucleotide is preferably derived from 5-methylcytosine (m5C) and / or N1-methyl-pseuuridine (m1Ψ).

[0033] According to the mRNA of the present invention, the CE-8e-SpRY further comprises nuclear localization signals at both ends, the sequence of which is SEQ ID NO.9.

[0034] According to another aspect of the present invention, a polynucleotide encoding the above-mentioned mRNA is provided.

[0035] According to another aspect of the present invention, an expression vector comprising the above-mentioned polynucleotides is provided, preferably, the expression vector comprising a T7 promoter sequence, and preferably, the expression vector is a plasmid.

[0036] According to another aspect of the present invention, the above-described mRNA is provided for gene editing in gene therapy and / or cell therapy in precision medicine.

[0037] According to another aspect of the present invention, a method for preparing the above-mentioned mRNA is provided, comprising removing nuclease contamination from the above-mentioned expression vector plasmid, linearizing it, performing in vitro cell-free transcription, co-transcriptional capping, and purification and recovery, thereby obtaining the mRNA.

[0038] According to the preparation method of the present invention, mRNA containing modified nucleotides is obtained by introducing modified nucleotides during in vitro cell-free transcription. Preferably, the modified nucleotides are 5-methylcytosine.

[0039] This invention leverages the advantages of mRNA drugs. The CE-8e-SpRY mRNA can effectively modify the genomes of blood cells and / or immune cells via electroporation, or be used via LNP for in vivo delivery of base-editing drugs to the liver and other organs. The preparation of CE-8e-SpRY mRNA includes expression vector construction, in vitro mRNA transcription, introduction of modified nucleotides, capping reaction, and mRNA purification. The mRNA provided by this invention, after being nuclear-transfected into artificial hematopoietic stem cells via electroporation, possesses the biological activity of mRNA, capable of expressing a base-editing system and performing high-level base-editing modification of target genes at the genomic level. In summary, this invention has the following significant advantages:

[0040] 1. The mRNA prepared by this invention can be obtained by capping reaction after in vitro transcription, and has a stable 5'-cap structure and 3'-PolyA sequence, which can prevent RNase cleavage, prolong the mRNA half-life, and improve translation efficiency.

[0041] 2. The mRNA prepared by this invention also has an optimized combination of 5'-UTR and 3'-UTR sequences, which improves mRNA translation efficiency and further enhances the biological activity of mRNA.

[0042] 3. The mRNA prepared by this invention also has optimized modified nucleotides, which can effectively reduce the immunogenicity of the mRNA, inhibit the activation of innate immunity, and improve its translation efficiency, making the prepared mRNA a powerful tool for regenerative medicine, disease treatment, and cell reprogramming. Attached Figure Description

[0043] Figure 1 The efficiency of CE-8e-SpRY and Tset-sgRNA editing at the 293T cell level was tested.

[0044] Figure 2 Schematic diagrams of DNA structures for different combinations of mRNAs;

[0045] Figure 3 The results of denaturing agarose gel electrophoresis of post-transcriptional mRNA products in vitro;

[0046] Figure 4 Results of cell viability analysis before and after HSC electroporation;

[0047] Figure 5 Results of HSC-level CE-8e-SpRY and Tset-sgRNA editing efficiency tests. Detailed Implementation

[0048] Example 1: Testing the editing efficiency of CE-8e-SpRY and pGL3-U6-EGFP-Test-sgRNA at the 293T cell level

[0049] 1.1 293T cell transfection

[0050] 293T cells are commonly used in laboratories to test editing efficiency due to their simple culture, ease of transfection, and high transfection efficiency. 293T cells do not express the CE-8e-SpRY gene themselves. By transfecting plasmids containing CE-8e-SpRY and pGL3-U6-EGFP-Test-sgRNA, the editing activity of pGL3-U6-EGFP-Test-sgRNA and CE-8e-SpRY at the mammalian level was tested, providing a reference for assessing mRNA editing activity. The specific implementation is as follows:

[0051] (1) One day before transfection, 293T cells were seeded into 24-well cell culture plates according to the transfection density. The culture medium was complete DMEM supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin antibiotic.

[0052] (2) During transfection, the cell density should be maintained at 60%-70%. Transfection should be performed according to the Lipo2000 liposome transfection instructions. In short, take two 1.5mL EP tubes, add 50μL of opti-MEM medium to each tube, add 2μL of Lipo2000 liposome to one EP tube, mix thoroughly, and let stand for 5min; add 600ng of CE-8e-SpRY plasmid and 300ng of pGL3-U6-EGFP-Test-sgRNA plasmid to the other EP tube, mix well, then mix the two EP tubes together, mix thoroughly, let stand for 20min, and then add to one well of a 24-well cell culture plate, and gently mix well.

[0053] (3) Replace the transfection well with fresh culture medium after 4-6 hours and continue culturing.

[0054] 1.2 GFP-positive sorting of 293T cells

[0055] 293T cells exhibited high transfection efficiency, and the pGL3-U6-EGFP-Test-sgRNA carried green fluorescent protein. Cells expressing GFP were sorted using flow cytometry for subsequent editing efficiency testing. The specific implementation is as follows:

[0056] (1) 48 h after transfection, a large area of ​​green fluorescence appeared in the field of view under a microscope. The cells were washed with PBS and then digested with trypsin for 1-2 min. The digestion reaction was then terminated with DMEM complete medium. The cells were collected and centrifuged.

[0057] (2) Use flow cytometry to resuspend cells in Staining Buffer and filter cell clusters using a single-cell filter. Then, perform flow cytometry on the filtered single cells.

[0058] (3) Use untransfected wells to adjust the GFP-positive gate, and then collect the GFP-positive cell population from the transfected sample.

[0059] 1.3 293T cell editing activity assay

[0060] Specific primers were designed to target the gene targeted by pGL3-U6-EGFP-Test-sgRNA. The target gene was then amplified, sequenced, and the results were analyzed to determine the target editing activity. The specific implementation is as follows:

[0061] (1) Genomic DNA was extracted from the collected GFP-positive cells, and specific amplification primers were designed for the Test-sgRNA target gene. Test-PCR-F: CCGTGGGATACTGAGACA (SEQ ID NO.10), Test-PCR-R: CCTCCTTGGCGTAGTAGT (SEQ ID NO.11). After the PCR amplification reaction, Sanger sequencing was performed to analyze the editing efficiency of the target gene.

[0062] (2) The sequencing results were analyzed using EditR analysis software to determine the target gene editing efficiency. The editing efficiency of CE-8e-SpRY and pGL3-U6-EGFP-Test-sgRNA at the 293T cell level was as follows: Figure 1 As shown.

[0063] Example 2: In vitro transcription of CE-8e-SpRY mRNA

[0064] 2.1 Preparation of DNA template for in vitro transcription

[0065] In vitro transcription is a process that uses linearized DNA as a template and contains RNA transcriptase, NTPs, and other necessary conditions to prepare RNA in a cell-free system, mimicking the in vivo transcription process. The specific implementation is as follows:

[0066] (1) Using pUC57 as the plasmid vector, the gene sequence was T7 promoter sequence, 5'UTR sequence, target gene sequence, 3'UTR sequence and PolyA sequence as the target gene. Figure 2 The plasmids pUC57-TUBA4A-CE-8e-SpRY, pUC57-TUBA1C-CE-8e-SpRY, pUC57-HBB-CE-8e-SpRY, pUC57-HBA1-CE-8e-SpRY, pUC57-GAPDH-CE-8e-SpRY, and pUC57-BNT-CE-8e-SpRY were constructed by inserting the plasmids into the restriction sites of XbaI and BamHI, respectively.

[0067] (2) After the plasmid vector is amplified, the linearized plasmid template is prepared by XbaI endonuclease, and the plasmid is purified and recovered by agarose gel electrophoresis after enzyme digestion.

[0068] 2.2 In vitro transcription reaction

[0069] In vitro transcription was performed in a cell-free transcription system containing RNA transcription buffer, enzymes, nucleoside triphosphates, N1-methyl-pseudouridine (m1Ψ), or 5-methylcytosine (m5C). The specific procedures are as follows:

[0070] (1) According to the T7 High yield RNA Transcription Kit, mix RNase-free water, reaction buffer, CleanCap AG, ATP, CTP (or m5C), UTP (or m1Ψ), GTP, template DNA and T7 RNA polymerase mixture evenly, and incubate at 37℃ for 3-5h. After transcription is completed, add 1μl of DNase to every 1μg DNA template and incubate at 37℃ for 15min to remove DNA template.

[0071] (2) Add 1.5 times the volume of the mRNA recovered in the previous step to RNase-free pure water, mix well, add an equal volume of LiCl solution pre-cooled at -20℃, mix thoroughly, let stand at -20℃ for 2 hours, centrifuge at 12000g for 20 minutes, discard the supernatant, wash the precipitate with 70% ethanol, centrifuge at 12000g for 20 minutes, discard the supernatant, air dry in a clean bench, and dissolve in an appropriate volume of RNase-free water.

[0072] (3) The obtained mRNA was subjected to denaturing agarose gel electrophoresis to detect whether the target mRNA band was present and whether the band size met the requirements. The final mRNA electrophoresis results are as follows: Figure 3 As shown.

[0073] Example 3: Hematopoietic stem cell level testing of the editing efficiency of CE-8e-SpRY and pGL3-U6-EGFP-Test-sgRNA

[0074] 3.1 Hematopoietic stem cell nuclear transfer

[0075] After isolating PBMCs from umbilical cord blood using density gradient centrifugation, hematopoietic stem cells were separated and enriched using magnetic sorting technology. mRNA was then delivered via electroporation of the hematopoietic stem cells. The specific implementation is as follows:

[0076] (1) Hematopoietic stem cell isolation

[0077] According to the Miltenyi CD34 MicroBead Kit instructions, prepare a single-cell suspension of PBMCs and count them. After centrifugation at 300g for 10 min, remove the supernatant and resuspend 10⁸ cells in 300 μl buffer. Add 100 μl FcR blocking reagent to each 10⁸ cells, followed by 100 μl CD34 Microbeads. Incubate at 4°C for 30 min, then use an LS column to enrich and elute CD34+ cells. The isolated CD34 cells are cultured in SFEM II medium supplemented with cytokines such as Fit3L, SCF, and TPO.

[0078] (2) Electroporation of hematopoietic stem cells

[0079] Electroporation experiments were performed using the Lonza P3 primary cell 4D nuclear transfection system X unit kit and the Lonza 4D electroporation platform. Following the kit instructions, CE-8e-SpRY mRNA and Test-sgRNA were incubated for 5 min, and 50,000 hematopoietic stem cells were collected. After centrifugation at 300g for 10 min, the supernatant was removed, and the cells were resuspended in 20 μl of electroporation buffer composed of P3 primary cell-specific nuclear transfection solution and additives. After adding the RNA incubator to the cells, they were transferred to the wells of the electroporation consumables for electroporation experiments. The electroporation program used was EO-100. After electroporation, the cells were transferred to culture medium for further culture.

[0080] 3.2 Hematopoietic stem cell editing activity test

[0081] After electroporation of hematopoietic stem cells, the editing efficiency was detected and analyzed using PCR and Sanger sequencing technologies. This not only tested the editing efficiency for some cells that are difficult to transfect, such as hematopoietic stem cells, but also detected the editing activity of CE-8e-SpRY mRNA with different UTR sequence combinations, and selected the mRNA and UTR sequence combinations with better editing effect.

[0082] (1) After electroporation for 48-72 hours, a portion of cells were collected for cell viability testing to analyze whether the electroporation process caused damage to hematopoietic stem cells and the extent of such damage. The cell viability test results are as follows: Figure 4 As shown in Figure 1.3. Simultaneously, some cells were collected and genomic DNA was extracted. The extracted genomic DNA was then amplified by PCR using the specific primers described in 1.3, and Sanger sequencing was performed to analyze the editing efficiency of the target gene.

[0083] (2) The sequencing results were analyzed using EditR analysis software to assess the target gene editing efficiency. The editing efficiency of CE-8e-SpRY and Test-sgRNA at the hematopoietic stem cell level was as follows: Figure 5 As shown.

[0084] In summary, by optimizing the composition and structure of the mRNA UTR sequence, it is possible to prepare CE-8e-SpRY mRNA with high editing activity. Some highly active CE-8e-SpRY mRNAs can be used for gene editing of difficult-to-transfect cells such as hematopoietic stem cells, which not only improves editing efficiency but also has high biocompatibility. As a base editing therapy drug, it has broad application prospects in the fields of gene therapy and / or cell therapy.

Claims

1. An mRNA comprising a nucleic acid coding region for CE-8e-SpRY, wherein the mRNA further comprises: 5'-cap structure, which is cleancap AG; The 3'-PolyA sequence contains 100 adenosine nucleotides, with a linker for a stable structure added between the 30th and 31st adenosine nucleotides, and its sequence is shown in SEQ ID NO.1; The 5'-UTR sequence, which is derived from the 5'-UTR of the gene that provides stable mRNA, is shown in SEQ ID NO. 4; The 3'-UTR sequence, which is derived from the 3'-UTR of the gene that provides stable mRNA, is shown in SEQ ID NO. 8; The modified nucleotide is 5-methylcytosine (m5C) or N1-methyl-pseuuridine; The CE-8e-SpRY also includes end-nuclear positioning signals, the sequence of which is SEQ ID NO.

9.

2. A polynucleotide encoding the mRNA of claim 1.

3. An expression vector comprising the polynucleotide of claim 2, wherein the expression vector comprises a T7 promoter sequence, and the expression vector is a plasmid.

4. A method for preparing the mRNA of claim 1, comprising removing nuclease contamination from the expression vector plasmid of claim 3, linearizing it, performing in vitro cell-free transcription, co-transcriptional capping, and purification and recovery to obtain the mRNA.

5. The method of claim 4, wherein a modified nucleotide is introduced during in vitro cell-free transcription to obtain mRNA containing the modified nucleotide, wherein the modified nucleotide is 5-methylcytosine.

Images