Application of PaDP protein and its mutants in enzymatic synthesis of pregabalin chiral intermediate

Abstract

The present invention belongs to the field of biotechnology. The present invention provides a PaDP protein, and its amino acid sequence is shown in SEQ ID NO.1 in the sequence listing. The mutant with improved activity and thermal stability is obtained by the combined mutation of amino acid sites in the present invention, and at the same time, the protein expression level is further improved by knocking out the Escherichia coli heterolactic acid pathway. The whole-cell catalysis after high-density fermentation can achieve the enzymatic hydrolysis of 150 g / L of the substrate 3-isobutylglutarimide within 24 hours, and maintain a high optical purity, which can well meet the current industrial production.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology. Background Art

[0002] Pregabalin (PGB) is a new type of γ-aminobutyric acid (GABA) receptor agonist, which has good anti-anxiety and neuropathic pain treatment effects and is widely used in the treatment of epilepsy and peripheral neuropathic pain, etc. Pregabalin is a chiral drug, and the pharmacological activities of different configurations vary greatly. The pharmacological activity of the S-isomer is 10 times that of the R-isomer. Therefore, optically pure S-pregabalin can effectively enhance the drug efficacy, reduce the occurrence of adverse reactions and avoid potential health hazards. Obtaining highly optically pure S-pregabalin is the key to current synthesis.

[0003] The specific conversion of cyclic imide to R-monoamide has been achieved by biological method, and finally highly optically pure S-pregabalin is obtained. Obtaining highly optically pure (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid (hereinafter referred to as R-monoamide) is the key step in the synthesis of S-pregabalin. Therefore, how to achieve the specific conversion of cyclic imide to R-monoamide so as to reduce the chemical reaction steps is a technical problem in obtaining highly optically pure S-pregabalin. Summary of the Invention

[0004] In view of this, the present invention provides a PaDP protein, and its amino acid sequence is shown in SEQ ID NO.1 in the sequence listing.

[0005] Furthermore, the present invention also provides a PaDP-AHT mutant, which is obtained by mutating 3 amino acid residues of the PaDP protein into L64AF66HC318T.

[0006] Even further, the present invention additionally provides a PaDP-AHT1 mutant, which is obtained by mutating the 387th amino acid residue of the PaDP-AHT mutant from V to A.

[0007] Finally, the present invention provides a PaDP-AHT2 mutant, which is obtained by performing an R412N stacking mutation on the PaDP-AHT1.

[0008] Finally, the present invention provides a PaDP-AHT3 mutant, which is obtained by fusing the short peptide 18A to the PaDP-AHT2.

[0009] In a specific embodiment of the present invention, the PaDP protein catalyzes 3-isobutylglutarimide into

[0010] (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid

[0011] In a specific embodiment of the present invention, the application of the PaDP-AHT mutant in the whole-cell catalysis of converting 3-isobutylglutarimide into (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid.

[0012] In a specific embodiment of the present invention, the application of the PaDP-AHT1 mutant in the whole-cell catalysis of converting 3-isobutylglutarimide into (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid.

[0013] In a specific embodiment of the present invention, the application of the PaDP-AHT2 mutant in the whole-cell catalysis of converting 3-isobutylglutarimide into (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid.

[0014] In a specific embodiment of the present invention, the application of the PaDP-AHT3 mutant in the whole-cell catalysis of converting 3-isobutylglutarimide into (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid.

[0015] The present invention provides a mutant with improved activity and thermal stability obtained by combinatorial mutation of amino acid sites. At the same time, the protein expression level is further improved by knocking out the Escherichia coli heterologous acid pathway. The whole-cell catalysis after high-density fermentation can achieve the enzymatic hydrolysis of 150 g / L of the substrate 3-isobutylglutarimide within 24 hours, and maintain a high optical purity, which can well meet the current industrial production. Description of the Drawings

[0016] Figure 1 It is a molecular docking result diagram of PaDP protein and the substrate 3-isobutylglutarimide.

[0017] Figure 2 It is a standard product diagram of the product 3-(carbamoylmethyl)-5-methylhexanoic acid detected by a C18 chromatographic column.

[0018] Figure 3 It is a content diagram of the product 3-(carbamoylmethyl)-5-methylhexanoic acid detected in the PaDP whole-cell catalytic reaction solution by a C18 chromatographic column.

[0019] Figure 4 It is an optical purity diagram of the product 3-(carbamoylmethyl)-5-methylhexanoic acid detected by a chiral column AD-H.

[0020] Among them, 15.230 min is the R configuration, and 16.215 min is the S configuration.

[0021] Figure 5Optical purity diagram of the product 3-(carbamoylmethyl)-5-methylhexanoic acid in the PaDP whole-cell catalytic reaction solution detected by chiral column AD-H.

[0022] Among them, 15.111 min is the R configuration, and 16.347 min is the S configuration.

[0023] Figure 6 Optical purity diagram of the product 3-(carbamoylmethyl)-5-methylhexanoic acid in the PaDP-AHT whole-cell catalytic reaction solution detected by chiral column AD-H.

[0024] Among them, 15.293 min is the R configuration, and 16.665 min is the S configuration.

[0025] Figure 7 Thermal stability diagram of 19 target mutants.

[0026] Figure 8 Comparison diagram of the catalytic activity of the fusion protein.

[0027] Figure 9 Optical purity diagram of the product 3-(carbamoylmethyl)-5-methylhexanoic acid in the whole-cell catalytic reaction solution after high-density fermentation of PaDP-AHT2 detected by chiral column AD-H.

[0028] Among them, 15.076 min is the R configuration, and 16.617 min is the S configuration.

[0029] Among them, 15.076 min is the R configuration, and 16.617 min is the S configuration.

[0030] Figure 10 It is a gel electrophoresis diagram. Detailed implementation method

[0031] Example

[0032] The following are the experimental items and experimental methods used in this example:

[0033] 1) Determination method of 3-isobutylglutarimide and (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid: Agilent C18 reversed-phase column (250×4.6 mm, 5 μm), detection wavelength: 210 nm; column temperature: 35 °C; flow rate: 1.0 ml / min; injection volume: 20 μl; running time: 45 min. Mobile phase A: buffer salt (weigh about 3.5 g of dipotassium hydrogen phosphate, dissolve in 1000 ml of water, mix well, adjust the pH to 3.0 with phosphoric acid, and filter). Mobile phase B: acetonitrile.

[0034] Time (min) Flow rate (ml / min) Mobile phase A % Mobile phase B % 0 1.0 80 20 20 1.0 80 20 30 1.0 60 40 35 1.0 60 40 40 1.0 80 20 45 1.0 80 20

[0035] 2) 3-Isobutylglutarimide: CAS No.: 916982-10-0; The 3-isobutylglutarimide used in the examples is a product of Macklin.

[0036] 3) (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid: CAS No.: 181289-33-8; The (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid used in the examples is a product of Shanghai Yuanye Bio-Technology Co., Ltd.

[0037] 4) The chiral purity of (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid (i.e., the proportion of the R-form product in the total product) was first detected by high performance liquid chromatography for the yields of (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid and (S)-(+)-3-Carbamoylmethyl-5-methylhexanoic acid. The detection conditions were as follows: Chromatographic column: Chiralpak AD-H column, 250×4.6 mm, 5 μm; Detection wavelength: 210 nm; Column temperature: 25 °C; Flow rate: 0.5 ml / min; Mobile phase: n-Hexane: Ethanol: Trifluoroacetic acid = 880:120:1.5 (volume ratio). The standard used was racemic 3-(Carbamoylmethyl)-5-methylhexanoic acid (i.e., a mixture of (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid and (S)-(+)-3-Carbamoylmethyl-5-methylhexanoic acid) (Shanghai Yuanye Bio-Technology Co., Ltd., product number: S62775).

[0038] 5) Calculate the chiral purity of (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid. Chiral purity of (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid = Yield of (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid / (Yield of (R)-(-)-3-(Carbamoylmethyl)-5-methylhexanoic acid + Yield of (S)-(+)-3-Carbamoylmethyl-5-methylhexanoic acid).

[0039] 6) After centrifugation of the fermented broth after the reaction, the supernatant was taken, freeze-dried and dissolved in 1 / 2 volume of ethanol, and the optical purity was detected by HPLC.

[0040] 7) Fermentation broth medium formulation

[0041] Initial medium: 1) Citric acid 8.5, KH2PO4 70 g, (NH4)2HPO4 20 g, Antifoaming agent 2.5 mL, Water 4.75 L; 2) Glucose 100 g, MgSO4·7H2O 10 g, Trace elements I (x1000) 5 mL, Water 100 mL, Sterilized separately.

[0042] Medium for feeding: 720 g of glucose, 4.8 g of MgSO4·7H2O, 12 mL of trace element II (x100), 720 mL of water.

[0043] 1. Strain screening

[0044] Through literature research, dihydropyrimidinase from Pseudomonas aeruginosa PAO1, abbreviated as PaDP, was screened. The amino acid sequence of PaDP is shown in Sequence Listing SEQ ID NO.1. It was synthesized with sequence optimization according to the codon preference of Escherichia coli, cloned into the expression vector pET-28a, and transformed into Escherichia coli BL21(DE3).

[0045] Pick a single positive clone colony into 10 mL of LB medium containing 40 μg / mL kanamycin. After culturing at 37 °C for 12 h, inoculate it into 200 mL of LB medium containing 40 μg / mL kanamycin at an inoculation amount of 1%. Culture at 37 °C until OD600 = 0.6 - 0.8, add the inducer IPTG to a final concentration of 0.5 mM, culture overnight at 24 °C and 200 rpm, collect the cells, and wash the cells once with 50 mM Trsi-Hcl (pH 7.5) to remove the medium on the cell surface.

[0046] Verify the catalytic activity according to the whole-cell transformation method. Resuspend the collected cells in 50 mM Trsi-Hcl (pH 7.5), adjust OD600 to 20 (1.2 ± 0.7×10 8 cfu / L), add the substrate 3-isobutylglutarimide to a final concentration of 10 mM, and react at 50 °C for 2 h.

[0047] In this experiment, the strain containing the PET-28a empty vector was used as the control group.

[0048] Centrifuge the reaction system at 12000 rpm for 2 min, take the supernatant, and freeze-dry the sample using a vacuum freeze dryer. After drying, add 1 mL of ethanol to dissolve the sample, and determine the chiral purity of (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid in the product by HPLC detection (that is, the proportion of the R-type product in the total product). The experimental results confirmed that PaDP can catalyze 3-isobutylglutarimide to generate monoamide, and the optical purity is 51.69%.

[0049] 2. Improve the stereoselectivity of the enzyme to obtain the engineered strain PaDP-AHT mutant

[0050] The PaDP protein and the substrate 3-isobutylglutarimide were subjected to molecular docking using the software Autodock to search for key amino acids at the active pocket. According to the docking results, the key amino acid residues were L64, F66, and C318. Based on the predicted mutation results of the software, these 3 amino acid residues were mutated to L64A F66H C318T, abbreviated as mutant PaDP-AHT, that is, L at position 64 was mutated to A, F at position 66 was mutated to H, and C at position 318 was mutated to T.

[0051] Using the method of overlap PCR, the plasmid containing wild-type PaDP was used as a template, and fragment 1 was obtained by PCR amplification using primers L64AF66H-F and C318T-R. Fragment 2 was obtained by PCR amplification using C318T-F and L64AF66H-R as primers. After PCR was completed, the wild-type template was digested with the restriction enzyme DpnI to obtain purified fragment 1 and 2. Fragment 1 and 2 were ligated using a seamless ligation kit (Nanjing Novozymes Co., Ltd.), and then transformed into Escherichia coli BL21(DE3), and positive clones were obtained by sequencing verification.

[0052] According to the above method of whole-cell catalysis, the catalysis of 3-isobutylglutarimide to produce monoamide and the detection of the optical purity of the product were carried out. HPLC confirmed that the optical purity of the mutant PaDP-AHT reached 99.3%.

[0053] The primer sequences used in the experiment:

[0054] L64AF66H-F CACACTCACATGCAGGCCCCGCACATGGGTACTGTTG L64AF66H-R CAACAGTACCCATGTGCGGGGCCTGCATGTGAGTGTG C318T-F ACCACCGCGACCGATCACACCTGCTTCTGTGCTGAACAGAAAGC C318T-R GCTTTCTGTTCAGCACAGAAGCAGGTGTGATCGGTCGCGGTGGT

[0055] 4. Improving the thermal stability of the enzyme

[0056] Based on the best mutant PaDP-AHT, further thermal stability improvement was carried out. Using the FireProt website for online prediction, 19 targets were obtained. Using the method of overlap PCR, the plasmid containing PaDP-AHT was used as a template. After PCR amplification, the wild-type template was digested with the restriction enzyme DpnI, and then transformed into Escherichia coli BL21(DE3), and positive clones were obtained by sequencing verification.

[0057] The mutants were T9I, S16I, Q49F, S77T, F106L, G122S, W128D, S130N, A142M, N157G, A168L, Q200E, P278G, N309W, V387A, A406P, R412N, G441R, Y452F. After the engineered strain completed protein induction expression, it was treated at 50 °C for 24 h and then subjected to whole-cell reaction.

[0058] The relative activity calculation formula is:

[0059] Relative activity = Amount of product generated after the whole-cell reaction of the mutant / Amount of product generated after the whole-cell reaction of PaDP-AHT

[0060] The experimental results confirmed that on the basis of the PaDP-AHT mutant, the amino acid residue at position 9 was mutated from T to I, the amino acid residue at position 387 was mutated from V to A, and the catalytic activity in the mutation of the amino acid residue at position 412 from R to N was significantly increased. Among them, the increase in activity after the mutation at position 387 was the most obvious. Therefore, this quadruple mutant (L64AF66HC318TV387A) was named PaDP-AHT1.

[0061] Primers used in the experiment:

[0062]

[0063]

[0064] 3. Preparation of mutant PaDP-AHT2

[0065] On the basis of PaDP-AHT1, the superimposed mutations of T9I and R412N were carried out in sequence. Using the method of overlapping PCR, the plasmid containing the PaDP-AHT1 mutant was used as a template, and primers T9I-F and T9I-R or primers R412-F and R412-R were used. After PCR amplification, the wild-type template was digested with the restriction enzyme DpnI, and Escherichia coli BL21(DE3) was transformed. Sequencing verification was used to obtain positive clones, namely L64AF66HC318TV387AT9I and L64AF66HC318TV387AR412N.

[0066] The whole-cell catalytic experiment was carried out according to the above method to verify its thermal stability. The catalytic activity of the mutant L64AF66HC318TV387AR412N was further improved and named PaDP-AHT2.

[0067] 4. Preparation of mutant PaDP-AHT3

[0068] According to the literature report, adding a short peptide tag to the C-terminus of the amino acid sequence to construct a fusion expression protein can improve the expression level of the protein or the catalytic activity of the enzyme. Therefore, short peptides 18A, DKL6, L6KD, EAK16, ELK16, L6K2, and ELP10 were selected to construct fusion proteins and experimental verification was carried out.

[0069] The method for constructing the fusion protein is as follows: Using the method of overlapping PCR, with the plasmid containing PaDP-AHT2 as the template, PCR amplification is carried out using the following primers F and R respectively. After the amplification is completed, the wild-type template is digested with the restriction enzyme DpnI, and then transformed into Escherichia coli BL21(DE3). Positive clones are obtained by sequencing verification. The whole-cell catalysis experiment is carried out according to the above method.

[0070] The relative activity calculation formula is:

[0071] Relative activity = Amount of product generated after 2 h of whole-cell reaction / Amount of product generated after 2 h of PaDP-AHT2 whole-cell reaction.

[0072] As Figure 8 shown, the whole-cell catalytic activity of the fusion protein constructed by introducing the short peptide 18A on the basis of PaDP-AHT2 is increased by 10%, which is the best fusion protein and is named PaDP-AHT3.

[0073] ELK16-R cagttccagttccagtttcagtttcagttccagttccagaagcttacgttcaacgg ELK16-F ctgaaactggaactggaactgaaactgaaataagtcgacctgcaggcatgcaag DKL6-R cctgcaggtcgacttacagcagcagcagcagcagtttatcaagcttacgttcaacgg DKL6-F ctgaccattgataaactgctgctgctgctgctgtaagtcgacctgcaggcatgcaag L6KD-F ctgaccattctgctgctgctgctgctgaaagattaagtcgacctgcaggcatgcaag L6KD-R gcaggtcgacttaatctttcagcagcagcagcagcagaagcttacgttcaacggtg L6K2-F ctgaccattctgctgctgctgctgctgaaaaaataagtcgacctgcaggcatgcaag L6K2-R gcaggtcgacttattttttcagcagcagcagcagcagaagcttacgttcaacggtg ELP10-F cattgttccgggtgttggtgttccgggtgttggttaagtcgacctgcaggcatgcaag ELP10-R cgacttaaccaacacccggaacaccaacacccggaacaagcttacgttcaacggtg EAK16-F gaaagcgaaagcggaagcggaagcgaaagcgaaataagtcgacctgcaggcatgcaag EAK16-R gcttccgcttccgctttcgctttcgcttccgcttccgcaagcttacgttcaacggtg 18A-F gaaaaagttctggaaaaactgaaagaactgttttaagtcgacctgcaggcatgcaag 18A-R gtttttccagaactttttcataaaacgctttcagccattcaagcttacgttcaacgg GFIL16-F gttttattctgggttttattctgggttttattctgtaagtcgacctgcaggcatgcaag GFIL16-R cccagaataaaacccagaataaaacccagaataaaaccaagcttacgttcaacggtg

[0074] 4. Experimental method and result verification for the mutant to catalyze 3-isobutylglutarimide into (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid

[0075] Literature reports that knocking out the ldhA, poxB, and pflbB genes in the metabolic pathway of Escherichia coli BW25113 can significantly improve the expression level of foreign proteins. Using the crispr-cas9 technology to knock out the above 3 genes in sequence, the corresponding N20 sequences of the genes are as follows. After verification by gel electrophoresis, the strain IB3 is obtained.

[0076] ldhA-N20 ccgtgatgctaacttctctc poxB-N20 atgtagtcactattgcgagc pflbB-N20 caaagcgtacaaccgcgaac

[0077] As Figure 9 shown, among them, band 1 is the ldhA positive control, band 2 is the ldhA knockout, band 3 is the poxB positive control, band 4 is the poxB knockout, band 5 is the pflB positive control, and band 6 is the pflB knockout.

[0078] The mutants PaDP-AHT2 and PaDP-AHT3 were separately electrotransformed into the strain IB3 and spread on an LB plate containing ampicillin resistance, and cultured overnight at 37°C for 14 - 20 h. Single colonies were picked and transferred into 10 mL of LB liquid medium (containing ampicillin resistance), and cultured at 37°C and 220 rpm for 6 - 8 h; 2 mL of the bacterial solution was taken and transferred into 100 mL of LB liquid medium (containing ampicillin resistance), and cultured at 37°C and 220 rpm. After 6 - 8 h, all were inoculated into a 5 L fermenter (containing 2 L of fermentation broth medium), at 37°C, 400 rpm, pH 6.7, and the DO was controlled at 30%; after culturing for about 9 - 12 h, the initial sugar was exhausted and fed-batch feeding began. When the cell concentration reached 60 (OD 600nm ), an inducer was added, the temperature was adjusted to 30°C and culturing continued for 24 h, and the cells were collected by centrifugation.

[0079] PaDP-AHT2 whole-cell catalytic reaction: The collected cells were resuspended in deionized water, and the OD was adjusted to 20 (1.2 ± 0.7×10 8 cfu / L), the substrate 3-isobutylglutarimide was 100 g / L, and the reaction was carried out at 50°C for 24 h. During the reaction process, ammonia water was used to adjust the pH to 8.5.

[0080] PaDP-AHT3 whole-cell catalytic reaction: The collected cells were resuspended in deionized water, and the OD was adjusted to 20 (1.2 ± 0.7×10 8 cfu / L), the substrate 3-isobutylglutarimide was 150 g / L, and the reaction was carried out at 50°C for 24 h. During the reaction process, ammonia water was used to adjust the pH to 8.5.

[0081] Strain - IB3 Mutant PaDP - AHT2 Time (h) Yield (g / L) 2 22.19±4.06 4 36.57±4.53 6 50.95±16.6 18 86.50±1.34 20 90.64±8.03 22 95.61±22.09 24 97.68±16.12

[0082] After the reaction, the product production amount and optical purity were detected. After 24 h of reaction, the substrate had completely reacted, and the optical purity of the product was 99.7%.

[0083]

[0084]

[0085] After the reaction, the product production amount and optical purity were detected. After 24 h of reaction, the substrate had completely reacted, and the optical purity of the product was 99.3%.

[0086] The present invention provides a mutant with improved activity and thermal stability obtained through combinatorial mutation of amino acid sites. At the same time, the protein expression level is further improved by knocking out the Escherichia coli heterologous acid pathway. The whole-cell catalysis after high-density fermentation can achieve the enzymatic hydrolysis of 150 g / L of the substrate 3-isobutylglutarimide within 24 h and maintain a high optical purity, which can well meet the current industrial production.

Claims

1. The PaDP-AHT mutant, which is obtained by mutating the 64th amino acid residue in the PaDP protein from L to A, the 66th amino acid residue from F to H, and the 318th amino acid residue from C to T; the amino acid sequence of the PaDP protein is shown in SEQ ID NO.1 in the sequence listing.

2. The PaDP-AHT1 mutant, which is obtained by mutating the 387th amino acid residue in the PaDP-AHT mutant described in claim 1 from V to A.

3. The PaDP-AHT2 mutant, characterized in that It is obtained by mutating the 412th amino acid residue in PaDP-AHT1 described in claim 2 from R to N.

4. The application of the PaDP-AHT mutant described in claim 1 in the enzymatic synthesis of pregabalin chiral intermediate, characterized in that The pregabalin chiral intermediate is (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid.

5. The application of the PaDP-AHT1 mutant described in claim 2 in the enzymatic synthesis of pregabalin chiral intermediate, characterized in that The pregabalin chiral intermediate is (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid.

6. The application of the PaDP-AHT2 mutant described in claim 3 in the enzymatic synthesis of pregabalin chiral intermediate, characterized in that The pregabalin chiral intermediate is (R)-(-)-3-(carbamoylmethyl)-5-methylhexanoic acid.

Images