A method for improving the traits of poplar

Abstract

The present invention discloses a method for improving the traits of poplar trees. By using the CRISPR / Cas9 system, the GLR3.3a gene and the GLR3.3b gene of poplar trees are knocked out to obtain gene-edited poplar trees. Compared with the wild type, a gelatinous layer appears in the stem cell wall of the gene-edited poplar trees, the widths of the xylem, cambium and cortex in the stem increase, and the cellulose content is significantly increased, endowing the wood with higher strength and tensile strength and improving the mechanical properties of poplar trees.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetics and relates to a method for improving the traits of poplar trees. Background Art

[0002] Poplar (Latin scientific name: Populus L.) is a plant of the genus Populus. There are about 100 species in the whole genus, and about 62 species (including 6 hybrids) in the world. Among them, 57 species are distributed in China, about 4 species are introduced and cultivated, and there are also many varieties, forms and introduced strains. The Populus classification system is divided into five major sections: Tacamahaca, Leuce, Aigeiros, Turanga, and Leucoides. The tree trunks are usually straight; the bark is smooth or longitudinally cracked, often grayish white. It is mainly distributed in vast areas such as central China, north China, northwest China, and northeast China.

[0003] Due to its fast reproduction and vigorous growth, poplar is an important tree species for windbreak and sand fixation. When used for windbreak and sand fixation, it is hoped to have more developed roots to better fix soil and water and better absorb nutrients in the sandy soil. The reduction of plant height can reduce the risk of poplar trees being blown down by strong winds in deserts or soft soil. Well-developed poplar roots can also better fix the soil on the beach and river banks and prevent soil erosion. In the prior art, there is a lack of a good poplar breeding method that can increase the root development and reduce the plant height, and such breeding will have the value of popularization and application. Poplar is an important fast-growing industrial timber tree species and afforestation tree species in China. The increase in the xylem in the roots can better transport water and inorganic salts. The formation and development of the xylem in the roots directly affect the wood quality and yield of forest trees. Therefore, the research on the formation and development of the xylem has always been the focus of forest tree breeding research. However, due to the very complex mechanism of xylem formation and development, so far, there has been no report on significantly promoting the development of root xylem in poplar trees.

[0004] Poplar xylem is the main organ for wood utilization. The widening of xylem is beneficial to increasing the content of lignin and cellulose. The higher the cellulose content, the stronger the toughness and fiber properties of poplar wood, which is more conducive to improving the quality of poplar wood and the utilization rate of wood. The reduction of phloem width promotes the increase in phloem fiber length and expands the utilization range of poplar wood. Its excellent mechanical properties and environmental protection characteristics can be better used in the production of building, ship and aerospace materials. The G-layer (gelatinous layer) makes the wood have a higher content of gelatinous fibers and a lower content of lignin, promotes the increase in the cellulose content of the wood, and makes the wood have higher strength and tensile strength. The growth and development of phloem and xylem directly affect the quality and yield of wood. Using modern biotechnology to deeply understand the key genes and their regulatory networks in the process of poplar wood formation helps to provide important theoretical support for explaining the growth laws of trees and the mechanism of wood formation. Using genetic engineering technology to cultivate fast-growing and high-quality forest trees is an effective way to solve the wood demand in China, and clarifying the molecular mechanism of wood formation is an important basis for genetic improvement of forest trees. Summary of the Invention

[0005] To solve the deficiencies in the prior art, the present invention provides the following six aspects of technical solutions.

[0006] The first aspect of the present invention provides a gRNA for knocking out poplar genes through the CRISPR / Cas9 system, and the gRNA is the first gRNA, the second gRNA or the third gRNA;

[0007] The first gRNA is used to knock out the poplar GLR3.3a gene;

[0008] The second gRNA is used to knock out the poplar GLR3.3b gene;

[0009] The third gRNA is used to double-knock out the poplar GLR3.3a gene and the poplar GLR3.3b gene.

[0010] In some embodiments, the poplar is Populus alba×Populus glandulosa '84K'.

[0011] In some embodiments, the coding sequence of the poplar GLR3.3a gene is shown as SEQ ID NO:1 and / or SEQ ID NO:2; the coding sequence of the poplar GLR3.3b gene is shown as SEQ ID NO:3 and / or SEQ ID NO:4.

[0012] In some embodiments, the target sequence of the first gRNA is selected from the sequence shown in SEQ ID NO:9, the sequence shown in SEQ ID NO:10, the sequence shown in SEQ ID NO:12, the sequence shown in SEQ ID NO:13, the sequence shown in SEQ ID NO:14, or a combination thereof;

[0013] The target sequence of the second gRNA is selected from the sequence shown in SEQ ID NO:15, the sequence shown in SEQ ID NO:16, the sequence shown in SEQ ID NO:17, the sequence shown in SEQ ID NO:18, the sequence shown in SEQ ID NO:19, or a combination thereof;

[0014] The target sequence of the third gRNA includes the target sequence of the first group of the third gRNA and / or the target sequence of the second group of the third gRNA;

[0015] The target sequence of the first group of the third gRNA is selected from the sequence shown in SEQ ID NO:20, the sequence shown in SEQ ID NO:21, the sequence shown in SEQ ID NO:22, the sequence shown in SEQ ID NO:23, the sequence shown in SEQ ID NO:24, or a combination thereof;

[0016] The target sequence of the second group of the third gRNA is a combination of the target sequence of the first gRNA and the target sequence of the second gRNA.

[0017] In some embodiments, the target sequence of the first gRNA is the sequence shown in SEQ ID NO:9 and the sequence shown in SEQ ID NO:10;

[0018] The target sequence of the second gRNA is the sequence shown in SEQ ID NO:15 and the sequence shown in SEQ ID NO:16;

[0019] The target sequence of the first group of the third gRNA is the sequence shown in SEQ ID NO:20 and the sequence shown in SEQ ID NO:21.

[0020] The second aspect of the present invention provides a genetic engineering vector, which can express the gRNA described in the first aspect of the present invention.

[0021] In some embodiments, the genetic engineering vector can also express the Cas9 gene.

[0022] The third aspect of the present invention provides a recombinant Agrobacterium, which contains the genetic engineering vector described in the second aspect of the present invention.

[0023] In some embodiments, the host bacterium of the recombinant Agrobacterium is GV3101 or EHA105.

[0024] The fourth aspect of the present invention provides a kit, which contains the gRNA described in the first aspect of the present invention, the gene engineering vector described in the second aspect of the present invention, or the recombinant Agrobacterium described in the third aspect of the present invention.

[0025] The fifth aspect of the present invention provides a method for gene knockout of poplar, and the gene knockout method is as follows:

[0026] M1: Knock out the GLR3.3a gene of poplar;

[0027] M2: Knock out the GLR3.3b gene of poplar;

[0028] M3: Knock out the GLR3.3a gene and the GLR3.3b gene of poplar simultaneously; or

[0029] M4: Knock out one and the other of the GLR3.3a gene and the GLR3.3b gene of poplar successively.

[0030] In some embodiments, the poplar is 84K poplar.

[0031] In some embodiments, the coding sequence of the poplar GLR3.3a gene is as shown in SEQ ID NO:1 and / or SEQ ID NO:2; the coding sequence of the poplar GLR3.3b gene is as shown in SEQ ID NO:3 and / or SEQ ID NO:4.

[0032] In some embodiments, the gene knockout is achieved through the CRISPR / Cas9 system.

[0033] In some embodiments, the gene knockout is performed using the gRNA described in the first aspect of the present invention.

[0034] In some embodiments, the steps of the gene knockout are as follows:

[0035] S1: Prepare poplar explants;

[0036] S2: Infect the poplar explants with Agrobacterium, and the Agrobacterium can express the gRNA and Cas9 gene described in the first aspect of the present invention.

[0037] S3: Co-culture the poplar explants infected with Agrobacterium;

[0038] S4: Screen and culture the poplar explants obtained by co-culture to obtain callus;

[0039] S5: Differentiate and culture the callus to obtain a poplar plant with buds;

[0040] S6: Culture the poplar plant with buds for rooting to obtain a gene - knockout poplar plant with roots.

[0041] In some embodiments, the medium for co - culture is based on WPM and contains 15 - 25 g / L sucrose, 6 - 10 g / L agar, 0.4 - 0.6 g / L 2 - morpholinoethanesulfonic acid, and 80 - 120 μM acetosyringone, with a pH of 5.5 - 6.5.

[0042] In some embodiments, the medium for screening culture is based on WPM and contains 15 - 25 g / L sucrose, 6 - 10 g / L agar, 0.4 - 0.6 g / L 2 - morpholinoethanesulfonic acid, 0.8 - 1.2 mg / L 2,4 - D, 0.08 - 0.12 mg / L KT, 150 - 250 mg / L cefotaxime, 150 - 250 mg / L ticarcillin, and 1.2 - 1.8 mg / L hygromycin B, with a pH of 5.5 - 6.5.

[0043] In some embodiments, the medium for differentiation culture is based on WPM and contains 15 - 25 g / L sucrose, 6 - 10 g / L agar, 0.4 - 0.6 g / L 2 - morpholinoethanesulfonic acid, 0.04 - 0.06 mg / L NAA, 0.4 - 0.6 mg / L 6 - BA, 150 - 250 mg / L cefotaxime, 150 - 250 mg / L ticarcillin, and 1.2 - 1.8 mg / L hygromycin B, with a pH of 5.5 - 6.5.

[0044] In some embodiments, the medium for rooting culture is based on WPM and contains 8 - 12 g / L sucrose, 6 - 10 g / L agar, 0.4 - 0.6 g / L 2 - morpholinoethanesulfonic acid, 150 - 250 mg / L cefotaxime, 150 - 250 mg / L ticarcillin, and 1.2 - 1.8 mg / L hygromycin B, with a pH of 5.5 - 6.5.

[0045] The sixth aspect of the present invention provides a method for improving poplar traits. The method for improving poplar traits is to prepare a gene - knockout poplar by the gene - knockout method described in the fifth aspect of the present invention;

[0046] The improvement of poplar traits includes:

[0047] Increasing the xylem width of the stem;

[0048] Increasing the cellulose content in the stem;

[0049] Increasing the phloem fiber length in the stem;

[0050] Promote the appearance of a colloidal layer in the stem cell wall;

[0051] Increase the number of poplar roots;

[0052] Increase the length of poplar roots;

[0053] Increase the cross-sectional area of poplar roots;

[0054] Increase the number of poplar root branches;

[0055] Reduce the height of poplar plants;

[0056] Increase the diameter of the ground stem;

[0057] Increase the proportion of the vascular cylinder in poplar roots;

[0058] Increase the proportion of xylem in the vascular cylinder of poplar roots;

[0059] Increase the hardness of poplar roots;

[0060] Increase the lignin content in poplar root systems; and

[0061] Increase the proportion of xylem in the stems of poplar plants.

[0062] In some embodiments, the method for improving poplar traits is to improve poplar traits by increasing the expression levels of the ACA7 gene, ABCB21 gene, PRX3 gene, CAD7 gene, MYB43 gene, BCB gene, XTH15 gene, XTH2 gene 3, CIPK7 gene, and WAG1 gene in the poplar.

[0063] In some embodiments, a poplar calcium channel inhibitor is added to the culture medium or soil of the gene knockout poplar.

[0064] In some embodiments, the poplar calcium channel inhibitor is LaCl3.

[0065] In some embodiments, in the culture medium or soil of the gene knockout poplar, the concentration of calcium ion Ca 2+ is 1 - 5 mM, and the concentration of lanthanum ion La 3+ is 0.02 - 0.06 mM.

[0066] In gene - knockout poplars, the expression levels of genes such as ACA7, ABCB21, PRX3, CAD7, MYB43, BCB, XTH15, XTH23, CIPK, and WAG1 are significantly up - regulated in the roots of gene - knockout poplars. In gene - knockout poplars, the number of roots increases, the root length increases, the root cross - sectional area increases, the number of root branches increases, the plant height decreases, the ground stem diameter increases, the proportion of the root vascular cylinder increases, the proportion of xylem in the root vascular cylinder increases, the root hardness increases, the root lignin content increases, and the proportion of xylem in the plant stem increases, which can better conserve water and soil, prevent wind and sand, and resist lodging.

[0067] The present invention aims to excavate the PagGLR3.3 gene that induces the development of poplar phloem fibers and cultivate forest tree varieties with high cellulose content. The operation is simple, the growth rate of poplars is fast, and high - quality fibers can be used for the precise cultivation of poplars. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 Presents the control photos of the growth status of poplars treated with four calcium - concentration culture solutions.

[0069] Figure 2 Presents the fresh and dry weights of the above - ground branches and roots of poplar seedlings treated with four calcium - concentration culture solutions (A), the number of lateral roots (B), and the lignin, cellulose, and xylose contents in the roots. Data are presented as mean ± SD (n = 10). * Indicates significant differences (*p < 0.05, **p < 0.01; one - way ANOVA).

[0070] Figure 3 Presents one of the WGCNA pattern diagrams, where the abscissa indicates the calcium ion concentration in the hydroponic solution, the ordinate represents the gene expression level (in exponential form), and the four curves from top to bottom represent roots, stems, leaves, and shoot tips.

[0071] Figure 4 Presents the expression profiles of GLR gene members in different tissues at different calcium concentrations.

[0072] Figure 5 Presents the control diagram of the expression levels of PopGLR3.3a and PopGLR3.3b in roots, stems, and leaves. * Indicates significant differences (*p < 0.05, **p < 0.01; one - way ANOVA).

[0073] Figure 6 Presents the tissue staining photos of GLR3.3a (left figure) and GLR3.3b (right figure) promoter transgenic poplars. The length of the vertical bar indicates 1 cm.

[0074] Figure 7Photographs of tissue-stained sections of poplar stems (A) and roots (B) are shown. The left side shows the transgenic situation of the GLR3.3a promoter, and the right side shows the transgenic situation of the GLR3.3 promoter. Among them, Xy indicates xylem; ph indicates phloem; pi indicates pith. The length of the vertical bar is 100 μm.

[0075] Figure 8 The gene structure, target positions and sequences, and editing events of single-gene PagGLR3.3a editing are shown.

[0076] Figure 9 The gene structure, target positions and sequences, and editing events of single-gene PagGLR3.3b editing are shown.

[0077] Figure 10 The gene structure, target positions and sequences of double-gene editing are shown.

[0078] Figure 11 The editing events of double-gene editing are shown.

[0079] Figure 12 The trait control and statistics of four poplar trees are shown. The data are presented as mean ± SD (n = 20). * Indicates significant differences (*p < 0.05, **p < 0.01; one-way ANOVA).

[0080] Figure 13 The trait control and statistical information of double-knockout plants and control plants are shown.

[0081] Figure 14 The growth control and statistics of two poplar trees under different ion concentrations are shown. The data are presented as mean ± SD (n = 20). * Indicates significant differences (*p < 0.05, **p < 0.01; one-way ANOVA).

[0082] Figure 15 The expression level control of 10 genes in the lateral roots of double-knockout plants and wild-type plants of two poplar trees is shown. Detailed implementation manners

[0083] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be further described in detail below with reference to the accompanying drawings. The materials and instruments not described in the present invention are conventional materials and instruments in the art, and the operation details not described in the present invention are conventional operations in the art. Unless otherwise specified, the nucleic acid sequences shown in the present invention are written from left to right in the 5' to 3' direction.

[0084] GLR gene: glutamate receptor gene. In the prefix of the GLR gene, "Pop" represents the Populus trichocarpa genome from the Populus reference genome, and "Pag" represents the genome of Populus alba×Populus glandulosa as described below. The suffix represents the corresponding homologous gene number.

[0085] Populus reference genome: In this invention, it refers to the Populus trichocarpa genome. The data can be found in the Populus trichocarpa genome database on the diurnal.tools platform. The link reference is: https: / / diurnal.sbs.ntu.edu.sg / species / view / 21.

[0086] Populus alba×Populus glandulosa genome: In this invention, the Populus alba×Populus glandulosa genome was sequenced and assembled using the Illumina HiSeq X Ten platform in combination with the Sanger method, and a Populus alba×Populus glandulosa genome database was constructed. Its data is not publicly available. Homologous genes in the Populus alba×Populus glandulosa genome were named with reference to the Populus trichocarpa genome.

[0087] Populus alba×Populus glandulosa is a hybrid poplar cultivated by cross-breeding. One allele of PagGLR3.3a and PopGLR3.3b is derived from the male parent, and the other homologous allele is derived from the female parent. According to the aforementioned genomic data, one allele code of PagGLR3.3a (corresponding to the Populus trichocarpa genome gene ID Potri.002G007400) is Pop_A02G026914.T1 (SEQ ID NO:1), and the other allele code is Pop_G02G065355.T1 (SEQ ID NO:2); one allele code of PagGLR3.3b (corresponding to the Populus trichocarpa genome gene ID Potri.005G253800) is Pop_A05G057109.T1 (SEQ ID NO:3), and the other allele code is Pop_G05G008778.T1 (SEQ ID NO:4). The specific coding sequences are shown as follows.

[0088] Sequence of Pop_A02G026914.T1:

[0089] ATGGATTCTACTAGGTTTGGTTGTTGGGTATTTCTCATCTGTTTACTGCTTTCAACAACCGGATATAG T AGGAATCTGACCTCAAGG CCTGCTGTTGTGAATATTGGAGCTCTTTTTACATTCGAATCTTCGATTGGAAGAGTT GC CAAGATTGCTATTCAGGAAGCTGTCAAAGATGTAAATGCGAATTCTAGCATTCTGCGGGGCACCAAACTCAATGTTGATATGAGAAACTCTAATTGCAGTGGGTTTCTAGGAATGGTTGAAGCTTTGCGTTTTATGGAGA CCGATATTGTTGCC ATTATCGG CCCACAATCTTCTGTCGTTGCTCGTATCGTATC CCATGTTGCGAATCAGCTTCAA GTTCCCCTATTGTCATTTTCAGCAACAGACCCCAGTCTCAACTCTCTGCAGTTTCCCTTTTTTGTTCAGACCACCCAGAGCGATTTGCACCAAATGGCAGCAATATCAGACGTTGTTGATTATTATGGTTGGAAGCAGGTAACTGCCATTTACATTGATGATGATTATGGACGAAATGGCATGTCAGCTCTGGGTGATAAACTTGCAGAGAGACGT TGTAGAATATCTTACAAGG TGGGGGTTCC CCCGGATTCTGGAGTTAATAGG ACTGACATCTTAGATATGCTTATTAAGGTTGCATCAATGGAATCTCGAGTTATAGTTCTCCATGTAAATCCTGATGTGGGTTTCGAGGTCTTTTCTGTGGCAAACCGTCTTCAAAT GATGGGTAATGGGTGG GTATGG

[0090] Pop_G02G065355.T1 sequence:

[0091] ATGGATTCTATTAGGTTTGGTTGTTGGGTATTTCTCATCTGTTTACTGCTTTCAACAACTGGATATAG T AGGAATCTGACCTCAAGG CCTGCTGTTGTGAATATTGGAGCTCTTTTTACATTCGAATCTTCGATTGGAAGAGTT GC CAAGATTGCTATTCAGG AAGCTGTCAAAGATGTAAATGCGAATTCTAGCATTCTGCGGGGCACCAAACTCAATGTTGATATGAGAAACTCTAATTGCAGTGGGTTTCTAGGCATGGTTGAAGCTTTGCGTTTTATGGAGA CCGATATTGTTGCC ATTATCGG CCCACAATCTTCTGTCGTTGCTCGTATCATTTC CCATGTTGCGAATCAGCTTCAA GTTCCCCTATTGTCATTTGCAGCAACAGACCCCAGTCTCAACTCTCTGCAGTTTCCCTTTTTTGTTCAGACCACCCAGAGCGATTTGCACCAAATGGCAGCAATATCAGACGCTGTTGATTATTATGGTTGGAAGCAGGTAACTGCCATTTACATTGATGATGATTATGGACGAAATGGCATGTCAGCTCTGGGTGATAAACTTGCAGAGAGACGT TGTAGAATATCTTACAAGG TGGGGGTTCC CCCGGATTCTGGAGTTAATAGG ACTGACATCTTAGATATGCTTATTAAGGTTGCATCAATGGAATCTCGAGTTATAGTTCTCCATGTAAATCCTGATGTGGGTTTCGAGGTCTTTTCTGTGGCAAACCGTCTTCAAAT GATGGGTAATGGGTGG GTATGG

[0092] Pop_A05G057109.T1 sequence:

[0093] ATGAACGCGGTTAGGTTTGCTTTGTGTCTTTTTCTCTTCTGTGTGCTGTTTTCATCAAGTGGATATAGTAGGAATGTGAGCTCAAGGCCTGCCGCTGTGAATATTGGAGCTATTTTTACCTTCGAATCTACGATTGGAAGAGCT GC CAAGATTGCTATCCAGG AAGCTGTCAAAGATGTGAATGCAAATTCTAGCATTCTGCATGGCACCGAACTCAAAATTCACATGAGAAACTCTA ACTGCAGTGGGTTTCTAGG CTTGGCTGAAGGTTTGAAGTTCACGGAGAATGATGTCATTGCCATTATTGGCCCGCAATCTTCTGTTGTTGCCCATATTATATCCCATGTCGCTAATGAACTTCAAGTTCCCCTATTGTCATTTGCAGCAACAGACCCCACTCTGAACTCGCTGCAGTTCCCCTTTTTTGTTAGGACCACGCAGAGTGATTTCTACCAA ATGGCGGCAATATCAGAGG TAGTTGAT CATTATGGTTGGAAGCAGG TGACTGCCATTTTCATTGATAATGATTATGGACGAAATGGCGTGTCAGCTCTAGGTGATAGACTTGCAGAGAGACGT TGTAGAATATCTTACAAGG TGGGGATTCC CCCGGATTCTGGAGTTAATAGG GGTGACATCACGGATATTCTTGTTAAGGTCGCGTTAATGGAATCTCGGGTTGTAATTGTCCATGTGTATCCTGACATGGGTTTCAAGATCTTTTCCATGGCAAACCATCTTGAAAT GATGGGTAATGGGTGG GTATGG ATTGCCACGGATTGGCTTTCGTCTGTTTTGGATTCTGCTTCACCTCTCCCATCAGA GACCATGGACTCAGT GCAAGGGGTTCTTGTTTTGCGTCAACACACACCAGATTCAGATAGAAAGAGAGCCTTTTCCTCTAGGTGGCACAAATTGACTGGTGGTTCTTTGGGGCTGCATTCTTATGGACTCTATGCTTATGATTCTGTCTGGCTAATTGCGCATGCTCTTGATGCATTTTTTAACCAGGGTGGTATAATCTCATTTTCTAACGATTCCAGGTTACCTTCTGGGGAA GGTAGTAGTCT CCACCTTGAGG

[0094] Pop_G05G008778.T1 sequence:

[0095] ATGAACGCGGTTAGGTTTGTTTCGTGTCTTTTTCTCTTTTGTGTACTGTTTTCATCAAGTGGATATAGTAGGAATGTGAGCTCAAGGCCTGCCGTTGTGAATATTGGAGCTATTTTTACCTTCGAATCTACGATTGGAAGAGCT GC CAAGATTGCTATCCAGG AAGCTGTCAAAGATGTGAATGCAAATTCTAGCATTCTGCATGGCACCGAACTCAAAATTCATATGAGAAACTCTA ACTGCAGTGGGTTTCTAGG CTTGGCTGAAGGTTTGAAGTTCACGGAGAATGATGTCATTGCTGTTATTGGCCCGCAATCTTCTGTTGTTGCCCATATTATATCCCATGTCGCTAATGAACTTCAAGTTCCCCTATTGTCATTTGCAGCAACAGACCCCACTCTTAGCTCGCTGCAGTTCCCCTTTTTTGTTAGGACCACGCAGAGTGATTTCTACCAA ATGGCGGCAATATCAGAGG TAGTTGAT CATTATGGTTGGAAGCAGG TGACTGCCATTTTCATTGATAATGATTATGGACGAAATGGCGTGTCAGCTCTAGGTGATAGACTTGCAGAGAGACGT TGTAGAATATCTTACAAGG TGGGGATTCC CCCGGATTCTGGAGTTAATAGG GGTGACATCACGGATATTCTTGTTAAGGTCGCGTTAATGGAATCTCGGGTTGTAATTGTCCATGTGTATCCTGACATGGGTTTCAAGATCTTTTCCATGGCAAACCATCTTGAAAT GATGGGTAATGGGTGG GTATGG ATTGCCACGGATTGGCTTTCATCTGTTTTGGATTCTGCTTCACCTCTCCCATCAGA GACCATGGACTCAGT GCAAGGGGTTCTTGTTTTGCGTCAACACACACCAGATTCAGATAGAAAGAGAGCCTTTTCCTCTAGGTGGCTCAAATTGACTGGTGGTTCTTTGGGGCTGCATTCTTATGGACTTTATGCTTATGATTCTGTCTGGCTAATTGCGCATGCTCTTGATGCATTTTTTAACCAGGGTGGTATGATCTCATTTTCTAACGATTCCAGGTTACCTTCTGGGGAA GGTAGTAGTCT CCACCTTGAGG

[0096] Example 1: Effect of Calcium Concentration on the Growth of Poplar

[0097] After adding water to the MS medium (purchased from Qingdao Hi-Tech Industrial Park Haibo Biotechnology Co., Ltd., product number: HB8469-21) without agar, sucrose and calcium salts according to the requirements, calcium chloride was added to a final concentration of 0.1 mM (calcium deficiency), 1 mM (low calcium), 5 mM (calcium sufficient), and 10 mM (high calcium) respectively to obtain hydroponic solution 1, hydroponic solution 2, hydroponic solution 3 and hydroponic solution 4.

[0098] Select wild-type 84K poplar (Populus alba×P.glandulosa) poplar conventional tissue culture seedlings that have rooted for one month in the same batch, pre-culture them in hydroponic solution 3 for one month by the conventional method, and then transplant them into new culture bottles and culture them hydroponically with the above four hydroponic solutions for two weeks respectively to explore the phenotypic differences of the plants after cultivation under different calcium conditions. The morphological characteristics of poplar plants cultured with calcium salts at four concentrations are shown in Figure 1 , the fresh weight and dry weight of above-ground branches and roots, the number of lateral roots, and the lignin, cellulose and xylose contents in the roots are shown in Figure 2 . The morphological comparison shows obvious differences in plant growth. Plants grown with 5 mM Ca 2+ supply (calcium sufficient) were used as controls in subsequent experiments. Plants grown at 1 mM Ca 2+ (low calcium stress) or 10 mM Ca 2 + (high calcium stress) showed no significant difference in the above-ground parts compared with the control. Plants grown at 0.1 mM Ca 2+ (calcium deficiency) showed light yellow wrinkled leaves( Figure 1 ), and the fresh weight (FW) and dry weight (DW) decreased( Figure 2 A). Calcium deficiency and 1 mM treatment led to opposite root phenotypes. In the case of calcium deficiency, roots with lower density, mainly brown and necrotic, and a reduced number of lateral roots were observed( Figure 1 and Figure 2 B), and the FW and DW of the roots decreased significantly by 58.4% and 41.0% respectively( Figure 2 B), while under low calcium 1 mM Ca 2+ supply, denser roots, increased biomass accumulation and enhanced lateral roots were observed compared with the control( Figure 1 , Figure 2 A and Figure 2 B). In addition, the cellulose, xylan and lignin contents of root cells differed at different Ca levels( Figure 2 C). In the calcium deficiency state, the cellulose, xylan and lignin contents were significantly lower than those at other Ca levels( Figure 2C). These results indicate that Ca plays an important regulatory role in the root growth of poplar trees.

[0099] Example 2: Effects of Calcium Treatment on the Gene Expression Profile of Poplar

[0100] For the 84K poplar seedlings cultured in the four hydroponic solutions of Example 1 for two weeks, shoot tips, leaves, stems, and roots were taken respectively, for a total of 16 samples with 3 replicates. RNA was extracted and transcriptome sequencing was performed in the Paired-end 150-bp mode on the Illumina HiSeq X Ten platform. Combining with the aforementioned 84K poplar genome for analysis, a total of 31,869 transcribed genes were obtained. Principal component analysis (PCA) showed that these genes had tissue-specific expression patterns in the aforementioned four tissue samples. Using the R package WGCNA v.1.71 for weighted gene co-expression network analysis (WGCNA) of the data showed that all expressed genes were divided into 17 modules. In one of these modules (see Figure 3 ), some glutamate receptor genes showed co-expression networks, and further study of these genes is needed.

[0101] Example 3: Study on the Calcium Stress Expression Profile of Glutamate Receptor Genes

[0102] As can be seen from the experiment in Example 2, the calcium ion concentration in the culture solution affects the gene expression profile of poplar seedlings' GLR genes. To further study the tissue specificity of PagGLR members, as well as their potential functions and corresponding mechanisms in the calcium-mediated process, for the 16 samples described in Example 2, using PtrUBQ as the internal reference gene, qRT-PCR detection was performed on the PagGLR3.7, PagGLR3.4 / 3.5b, PagGLR3.4 / 3.5a, PagGLR3.3b, PagGLR3.3a, PagGLR3.1 / 3.2, PagGLR3.6a, and PagGLR3.6b genes in 84K poplar. The heat map of the results is shown in Figure 4 .

[0103] The names of the homologous genes of the above seven genes in Populus trichocarpa and the gene IDs of the related genes in the above Populus trichocarpa genome are successively: PopGLR3.7 (Potri.002G229900), PopGLR3.4 / 3.5b (Potri.014G152200), PopGLR3.4 / 3.5a (Potri.002G230000), PopGLR3.3b (Potri.005G253800), PopGLR3.3a (Potri.002G007400), PopGLR3.1 / 3.2 (Potri.009G168300), PopGLR3.6a (Potri.005G102600), PopGLR3.6b (Potri.005G102700).

[0104] From Figure 4 It can be seen that the genes of the GLR subfamily III have higher expression abundances. The expression profile shows that under calcium deficiency, the expression of GLR3.3b in the roots and stems of poplar is significantly up-regulated ( Figure 4 ). Phylogenetic analysis shows that there are two closely related genes GLR3.3a and GLR3.3b in the 84K poplar genome. Because of potential gene redundancy, in order to reduce the redundant effects of the expression regulation of the two genes and their expression products, genetic operations and studies were respectively carried out on these two homologous genes in subsequent research. Using the 84K poplar seedlings after being cultured in hydroponic solution 3 for two weeks in Example 1, total RNA of the samples was extracted, and by quantitative PCR method, the expression levels of the PagGLR3.3a homologous gene of PopGLR3.3a and the PagGLR3.3b homologous gene of PopGLR3.3b in the roots, stems and leaves of 84K poplar were measured. The expression level in the leaves was normalized as a reference, and the statistical results are shown in Figure 5 . From Figure 5 It can be seen that quantitative PCR analysis shows that the expression levels of PagGLR3.3a and PagGLR3.3b in the roots and stems are higher than those in the leaves.

[0105] Example 4: Study on the promoter activity of GLR genes

[0106] In order to further obtain detailed tissue-specific information on gene expression, using the 84K poplar genome as a template, with GLR3.3a Pro _F and GLR3.3a Pro _R as primers, the promoter Pro PagGLR3.3a of PagGLR3.3a was cloned. With GLR3.3b Pro _F and GLR3.3b Pro _R as primers, the promoter Pro PagGLR3.3b of PagGLR3.3b was cloned.

[0107] GLR3.3a Pro _F (SEQ ID NO:5): TTCTACCATTTCGATACATGC

[0108] GLR3.3a Pro _R (SEQ ID NO:6): TTCAATTCAATAACACAATTATCTTCTC GLR3.3b Pro _F(SEQID NO:7): TTGTTTTAATTCAATGTCGAGCT GLR3.3b Pro _R (SEQ ID NO:8): TTCAATTCAATAGCACAATTATCTTCCCC

[0109] Pro PagGLR3.3a and Pro PagGLR3.3b were respectively ligated to the upstream promoter region of the GUS gene (β-glucosidase gene) in the PMDC164 vector, and recombinant expression vectors were constructed. The 84K poplar was transformed by the conventional leaf disc transformation method to obtain transgenic poplar plants with their respective promoters.

[0110] For one-month-old transgenic plants, conventional histological staining was performed using GUS staining solution containing X-Gluc. See the plant photos in Figure 6 , from which it can be seen that GUS signals exist in the vascular tissues such as the stems and roots of poplar. For one-month-old transgenic plants, paraffin section analysis was further performed on the fifth internode of the stem and the cross-section of the root. See the result photos in Figure 7 . It shows that GUS signals are distributed in the phloem of the stem and root.

[0111] Example 5: Preparation of gene knockout plants

[0112] The CRISPR / Cas9 system used in the present invention (for the usage method of the version, see the literature Yi An, Yangyan Zhou, Xiao Han, Chao Shen, Shu Wang, Chao Liu, Weilun Yin, Xinli Xia. The GATA transcription factor GNC plays an important role in photosynthesis and growth in poplar. J Exp Bot. 2020 Mar 25;71(6):1969-1984.) was gifted by the Andrew Groover laboratory. Its entry vector is pEn-Chimera1.1, also known as pEn-C1.1, which contains the first gRNA target insertion site and the gRNA expression element; the destination vector is pDe-Cas9, also known as pDe-Cas9-npt, which contains the second gRNA target insertion site and the gRNA expression element, and also has the Cas9 gene with an expression element; after recombining the entry vector with the first gRNA target inserted and the destination vector with the second gRNA target inserted through the Gateway reaction, a CRISPR / Cas9 vector capable of simultaneously knocking out two target sites is obtained, and this vector is suitable for transforming plants through Agrobacterium tumefaciens.

[0113] 1. Selection of gene target sites

[0114] The Populus alba × Populus glandulosa 84K genome database constructed according to the present invention was used to analyze the CDS regions of the PagGLR3.3a and PagGLR3.3b genes and their structures, and to clarify the intron and exon parts. According to the nature of the genes themselves, candidate knockout sites were selected and determined. The online analysis platforms CRISPR-P (for methods, see Liu, H., Ding, Y., Zhou, Y., Jin, W., Xie, K., Chen, L.L., 2017. CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants. Mol Plant 10, 530-532.) and ZiFiT Targeted Version 4.2 were used to search for potential Cas9 target sites (for methods, see Sander J D, Maeder M L, Reyon D, Voytas D F, Joung J K, Dobbs D. ZiFiT (Zinc Finger Targeter): an updated zinc finger engineering tool[J]. Nucleic Acids Research, 2010, gkq319). To analyze the specific functions of PagGLR3.3, the CRISPR / Cas9 system was used to mutate and edit the coding sequence of the PagGLR3.3 gene. Two target sites were selected for mutation in each gene, that is, 2 target sites were designed for each gene. To edit the PagGLR3.3a gene, a series of specific target sites 1 was designed according to the gene sequence characteristics. Five target sites were designed according to the same sequence part of the aforementioned Pop_A02G026914.T1 and Pop_G02G065355.T1 (the target sites for the paternal and maternal sources are the same). The target sites T1 and T2 located on the second exon (referred to as target site combination 1) were selected for subsequent gene knockout work. The sequences of these two target sites and the sequence between them are shown in Figure 8 . To edit the PagGLR3.3b gene, a series of specific target sites 2 was designed according to the gene sequence characteristics. Five target sites were designed according to the same sequence part of the aforementioned Pop_A05G057109.T1 and Pop_G05G008778.T1 (the target sites for the paternal and maternal sources are the same). The target site T1 located on the second exon and the target site T2 located on the third exon (referred to as target site combination 2) were selected for subsequent gene knockout work. The sequences of these two target sites and the sequence between them are shown in Figure 9。To eliminate the gene redundancy effect, a mutation editing operation was performed on two genes simultaneously. Based on the identical sequence portions of the aforementioned Pop_A02G026914.T1, Pop_G02G065355.T1, Pop_A05G057109.T1, and Pop_G05G008778.T1 (the targets for the paternal and maternal sources of PagGLR3.3a and PagGLR3.3b are the same), 4 targets were designed, and targets T1 and T2 located on the second exon (referred to as target combination 3) were selected for subsequent gene knockout work. The sequences of these two targets and related sequences are shown in Figure 10 。The sequences of the three target series are as follows.

[0115] Target series 1:

[0116] T1 (SEQ ID NO:9): 5’-CCGATATTGTTGCCATTATCGG-3’;

[0117] T2 (SEQ ID NO:10): 5’-TTGAAGCTGATTCGCAACATGG-3’

[0118] The sequence of T2 in the coding strand is (SEQ ID NO:11): 5’-CCATGTTGCGAATCAGCTTCAA-3’

[0119] T3 (SEQ ID NO:12): 5’-TAGGAATCTGACCTCAAGG-3’

[0120] T4 (SEQ ID NO:13): 5’-GCCAAGATTGCTATTCAGG-3’

[0121] T5 (SEQ ID NO:14): 5’-ACTGCAGTGGGTTTCTAGG-3’

[0122] Target series 2:

[0123] T1 (SEQ ID NO:15): 5’-GACCATGGACTCAGTGCAAGGG-3’

[0124] T2 (SEQ ID NO:16): 5’-GGTAGTAGTCTCCACCTTGAGG-3’

[0125] T3 (SEQ ID NO:17): 5’-GCCAAGATTGCTATCCAGG-3’

[0126] T4 (SEQ ID NO:18): 5’-ATGGCGGCAATATCAGAGG-3’

[0127] T5 (SEQ ID NO:19): 5’-CATTATGGTTGGAAGCAGG-3’

[0128] Target series 3:

[0129] T1 (SEQ ID NO:20): 5’-GATGGGTAATGGGTGGGTATGG-3’

[0130] T2 (SEQ ID NO:21): 5’-CCCGGATTCTGGAGTTAATAGG-3’

[0131] T3 (SEQ ID NO:22): 5’-TGTAGAATATCTTACAAGG-3’

[0132] T4 (SEQ ID NO:23): 5’-GGATTCTGGAGTTAATAGG-3’

[0133] The sequences of PagGLR3.3a and PagGLR3.3b genes of Populus alba×Populus glandulosa were amplified by PCR respectively, and Sanger sequencing was carried out to verify the correctness of the gene sequences and the target sequences (truly existing) obtained by high-throughput sequencing.

[0134] 2. Design of gRNA

[0135] Oligonucleotides gRNAa1_GLR_F2 and gRNAa1_GLR_R2 were synthesized for target T1 of target combination 1, and the two were annealed to form double-stranded C1T1.

[0136] Oligonucleotides gRNAa2_GLR_F3 and gRNAa2_GLR_R3 were synthesized for target T2 of target combination 1, and the two were annealed to form double-stranded C1T2.

[0137] Oligonucleotides gRNAb1_GLR_F and gRNAb1_GLR_R were synthesized for target T1 of target combination 2, and the two were annealed to form double-stranded C2T1.

[0138] Oligonucleotides gRNAb2_GLR_F and gRNAb2_GLR_R were synthesized for target T2 of target combination 2, and the two were annealed to form double-stranded C2T2.

[0139] Oligonucleotides gRNAab1_GLR_F and gRNAab1_GLR_R were synthesized for target T1 of target combination 3, and the two were annealed to form double-stranded C3T1.

[0140] For the target combination of 3 targets T2, the synthetic oligonucleotide gRNAab2_GLR_F and gRNAab2_GLR_R are annealed to form the double-stranded C3T2.

[0141] gRNAa1_GLR_F2 (SEQ ID NO:24): attgCCGATATTGTTGCCATTAT

[0142] gRNAa1_GLR_R2 (SEQ ID NO:25): aaacATAATGGCAACAATATCGG

[0143] gRNAa2_GLR_F3 (SEQ ID NO:26): attgTTGAAGCTGATTCGCAACA

[0144] gRNAa2_GLR_R3 (SEQ ID NO:27): aaacTGTTGCGAATCAGCTTCAA

[0145] gRNAb1_GLR_F (SEQ ID NO:28): attgGACCATGGACTCAGTGCAA

[0146] gRNAb1_GLR_R (SEQ ID NO:29): aaacTTGCACTGAGTCCATGGTC

[0147] gRNAb2_GLR_F (SEQ ID NO:30): attgGGTAGTAGTCTCCACCTTG

[0148] gRNAb2_GLR_R (SEQ ID NO:31): aaacCAAGGTGGAGACTACTACC

[0149] gRNAab1_GLR_F (SEQ ID NO:32): attgCCCGGATTCTGGAGTTAAT

[0150] gRNAab1_GLR_R (SEQ ID NO:33): aaacATTAACTCCAGAATCCGGG

[0151] gRNAab2_GLR_F (SEQ ID NO:34): attgGATGGGTAATGGGTGGGTA

[0152] gRNAab2_GLR_R (SEQ ID NO:35): aaacTACCCACCCATTACCCATC

[0153] 3. Preparation of Recombinant Entry Vectors

[0154] The pEn-Chimera1.1 vector was digested and linearized with the restriction enzyme NEB BbsI. The linearized vector was ligated with double-stranded C1T1, double-stranded C2T1, and double-stranded C3T1 respectively under the action of T4 DNA ligase. The recombinant vectors were respectively transformed into competent DH5α cells for screening and culture. Plasmids were extracted. After electrophoresis confirmed the success of recombinant positive clones, Sanger sequencing was used to verify the correctness of the recombinant sequences, and recombinant entry vectors EVC1T1, EVC2T1, and EVC3T1 were obtained respectively.

[0155] 4. Preparation of Recombinant Destination Vectors

[0156] The pDe-Cas9 vector was digested and linearized with the restriction enzyme Bsu36I. The linearized vector was ligated with double-stranded C1T2, double-stranded C2T2, and double-stranded C3T2 respectively under the action of T4 DNA ligase. The recombinant vectors were respectively transformed into competent DH5α cells for screening and culture. Plasmids were extracted. After electrophoresis confirmed the success of recombinant positive clones, Sanger sequencing was used to verify the correctness of the recombinant sequences, and recombinant entry vectors DVC1T2, DVC2T2, and DVC3T2 were obtained respectively.

[0157] 5. Preparation of Recombinant Gene Knockout Vectors

[0158] The recombinant entry vector EVC1T1 and the recombinant destination vector DVC1T2 were mixed. Under the action of LR clonase II enzyme mix, a recombinant product was formed through the Gateway reaction. The recombinant product was transformed into competent Agrobacterium tumefaciens GV3101 for screening and culture. Plasmids were extracted. After electrophoresis confirmed the success of recombinant positive clones, Sanger sequencing was used to verify the correctness of the recombinant sequences, and recombinant Agrobacterium liquid 1 was obtained. Recombinant Agrobacterium liquid 2 was obtained in the same way through the recombinant entry vector EVC2T1 and DVC2T2. Recombinant Agrobacterium liquid 3 was obtained through the recombinant entry vector EVC3T1 and the recombinant destination vector DVC3T2.

[0159] 6. Infection and Transformation of Populus alba×Populus glandulosa Leaves

[0160] (1) Explant treatment: Young leaves of Populus alba×Populus glandulosa tissue culture seedlings grown for 4 - 6 weeks were taken as explant transformation materials. After sampling, the leaves were first washed with clean water, then disinfected with 20 w / v% sodium hypochlorite aqueous solution for 20 min in a laminar flow hood, and washed with sterile distilled water at least 5 times to ensure that there was no sodium hypochlorite residue on the material surface, and the excess distilled water was blotted with sterile filter paper.

[0161] (2) Agrobacterium culture: Recombinant Agrobacterium liquid culture 1 was cultured overnight at 28 °C and 180 rpm in a shaker in 200 mL of YEP liquid medium containing 100 mg / L Kan and 50 mg / L Rif. After amplification in the logarithmic phase, it was centrifuged at 3600 rmp and 4 °C for 10 - 15 min. The cells were resuspended in sterile 1 / 2MS (with sucrose) solution to a final OD 600 of approximately 0.4 to obtain the infection liquid 1 for use.

[0162] (3) Infection: The disinfected explant leaves were scratched with a scalpel tip at the main vein, the leaf margins were excised, and cut into pieces about 0.5×2.0 cm in size. Then, they were infected in the bacterial solution with an OD 600 of approximately 0.4 for 10 - 20 min, during which they were gently rotated and shaken to ensure that each leaf was in close contact with the Agrobacterium.

[0163] (4) Co - culture: The infected leaves were blotted dry with filter paper and placed flat on the co - culture medium, and placed in the dark for 2 days to transfer the Agrobacterium carrying the target gene into the leaves. The co - culture medium was based on WPM medium and also contained 20 g / L sucrose, 7.8 g / L agar, 0.5 g / L MES (2 - morpholinoethanesulfonic acid), 100 μM AS (acetosyringone), and pH 5.9.

[0164] (5) Screening culture: The leaves were torn and transferred to the screening medium for continued dark culture for about two weeks. After callus grew, it was subcultured to a new screening medium. Subculture was performed once every two weeks, and callus grew in about 2 - 4 weeks. The screening medium was based on WPM medium and also contained 20 g / L sucrose, 7.8 g / L agar, 0.5 g / L MES, 1.0 mg / L 2,4 - D, 0.1 mg / L KT, 200 mg / L cefotaxime, 200 mg / L ticarcillin, 1.5 mg / L hygromycin B, and pH 5.9.

[0165] (6) Differentiation culture: When the callus reached the size of rice grains, it was transferred to the differentiation medium and subcultured approximately once every three weeks. The culture temperature was 25 °C, the light intensity was 50 μmol·m -2 ·s -1 , and the photoperiod was 16 h light / 8 h dark. During this period, the callus would turn green, become hard, and sprout. This stage took about two months. The differentiation medium was based on WPM medium and also contained 20 g / L sucrose, 7.8 g / L agar, 0.5 g / L MES, 0.05 mg / L NAA, 0.5 mg / L 6 - BA, 200 mg / L cefotaxime, 200 mg / L ticarcillin, 1.5 mg / L hygromycin B, and pH 5.9.

[0166] (7) Rooting culture: After the small seedlings grow to about 1 cm, cut them off and place them in the rooting medium for about one week to root. The culture temperature is 25 °C, and the light intensity is 50 μmol·m -2 ·s -1 . The photoperiod is 16 h light / 8 h dark. The rooting medium is based on WPM and also contains 10 g / L sucrose, 7.8 g / L agar, 0.5 g / L MES, 200 mg / L cefamycin, 200 mg / L ticarcillin, 1.5 mg / L hygromycin B, and the pH is 5.9.

[0167] (8) Results: After two weeks of rooting, plant DNA was extracted, and PCR detection was performed using specific primers on the CRISPR vector to obtain positive transgenic plants. Ten plants were selected for subsequent research.

[0168] Using the same method as described above, the aforementioned gene knockout operation for target combination 2 was performed using recombinant Agrobacterium liquid 2, and ten positive transgenic plants were selected for subsequent research. The aforementioned gene knockout operation for target combination 3 was performed using recombinant Agrobacterium liquid 3, and ten positive transgenic plants were selected for subsequent research.

[0169] 7. Mutation identification of transgenic plants

[0170] For the ten positive strains of the gene knockout operation for target combination 1, genomic DNA was extracted respectively, and PCR amplification was performed using the specific primers GLRa_Mut_F1 and GLRa_Mut_R1 for gRNA target site detection as primers. The amplification products were ligated to the T vector. Escherichia coli was transformed to obtain single colonies. Then the plasmids were extracted for sequencing of the target sites. The sequencing results were compared with the control sequence to analyze the mutation effect. The knockout site sequences of plants #3, #6, and #7 and the wild control plant (CK) are shown in Figure 8 . The two sequences represent the sequences from the male parent and the female parent in Populus alba × Populus glandulosa, respectively. It can be seen that large fragment deletions occurred between the two target sites in the two allelic sequences of the PagGLR3.3a gene in these three transgenic positive plants, and the gene was successfully knocked out. Using the same method, for the ten positive strains of the gene knockout operation for target combination 2, with GLRb_Mut_F1 and GLRb_Mut_R1 as primers, the knockout site sequences of plants #4, #6, and #8 and the wild control plant (CK) are shown in Figure 9。It can be seen that large - fragment deletions have occurred between the two target sites in the two allelic sequences of the PagGLR3.3b gene of these three transgenic positive plants, and the gene has been successfully knocked out. Using the same method, for the 10 positive plants with gene knockout operation of target combination 3, the PagGLR3.3a gene was amplified with GLRa_Mut_F2 and GLRa_Mut_R2 as primers, and the PagGLR3.3b gene was amplified with GLRb_Mut_F2 and GLRb_Mut_R2 as primers. The sequences of the knockout sites of plants #3, #6, and #9 and the wild - type control plant (CK) are shown in Figure 11 。It can be seen that insertions or deletions have occurred at the positions of the two target sites in the two allelic sequences of the PagGLR3.3a gene and the PagGLR3.3b gene of these three transgenic positive plants, and the genes have been successfully knocked out.

[0171] GLRa_Mut_F1 (SEQ ID NO:36): ATGGATTCTATTAGGTCTGGTTGTTGG GLRa_Mut_R1 (SEQID NO:37): ATTACCCATCATTTGAAGGCGGTT

[0172] GLRb_Mut_F1 (SEQ ID NO:38): GGATTGCCACGGATTGGCTTTC

[0173] GLRb_Mut_R1 (SEQ ID NO:39): CGACCAACAGCCAAAATGAGATGAT GLRa_Mut_F2 (SEQID NO:40): CGGCCCACAATCTTCTGTCGT

[0174] GLRa_Mut_R2 (SEQ ID NO:41): GCCTCAAGGTGGAGACCACT

[0175] GLRb_Mut_F2 (SEQ ID NO:42): GGCCCGCAATCTTCTGTTGT

[0176] GLRb_Mut_R2 (SEQ ID NO:43): GGTGGAGACTACTACCTTCCCC

[0177] It can be seen that Figure 8Among the 9 transgenic plants shown in Figures 9 and 11, the target sites of the transgenic plants were successfully edited. Mutation events occurred in the two allelic sequences of each target, and multiple bi-allelic mutants were generated from different editing events, which can be used for genetic studies on the phenotypes of single-gene knockout and double-gene knockout of PagGLR3.3a and PagGLR3.3b genes.

[0178] Example 6: Characterization of Traits of Gene Knockout Plants

[0179] Compare the traits of wild type (CK), PagGLR3.3a gene-edited plants (gene knockout for target combination 1, code: crispr-PagGLR3.3a), PagGLR3.3b gene-edited plants (gene knockout for target combination 2, code: crispr-PagGLR3.3b), and PagGLR3.3a and PagGLR3.3b double-gene edited plants (gene knockout for target combination 3, code: crispr-PagGLR3.3ab). Observe and count the tissue culture seedlings of CK, plants #3, #6, and #7 of crispr-PagGLR3.3a, plants #4, #6, and #8 of crispr-PagGLR3.3b, and plants #3, #6, and #9 of crispr-PagGLR3.3ab obtained in Example 5.

[0180] See the statistical results of various aspects in Figure 12 , where the upper part of A shows a photo of the bottom of the culture bottle, and the lower part shows a photo of the root morphology. B shows a column chart of the comparison of the number of lateral roots of four poplar seedlings. C shows a column chart of the comparison of the length of lateral roots of four poplar seedlings. D shows a column chart of the comparison of the hardness of four poplar seedlings. E shows microscopic photos of cross-sectional slices of the root systems of CK and crispr-PagGLR3.3ab at 1 cm, 2 cm, and 5 cm from the root tip. In the 2 cm photo of CK, the three arrows from top to bottom point to the epidermis, xylem, and phloem respectively. The upper line indicates the vascular bundle, and the lower line indicates the cortex. In A, B, C, D, and E, the #3 knockout plant of crispr-PagGLR3.3a is selected, the #4 knockout plant of crispr-PagGLR3.3b is selected, and the #3 knockout plant of crispr-PagGLR3.3ab is selected. F shows a column chart of the comparison of the cross-sectional area of the root systems of four poplar seedlings at 1 cm, 2 cm, and 5 cm from the root tip. G shows a column chart of the comparison of the vascular bundle ratio of the roots of four poplar seedlings. H shows a column chart of the comparison of the xylem ratio of the vascular tissue of the roots of four poplar seedlings. In G and H, the control and three double-knockout plants are used.

[0181] From Figure 12It can be seen that morphological comparative analysis shows that the number of lateral roots of the crispr-PagGLR3.3a and crispr-PagGLR3.3b mutant plants is more than that of the control, and the double mutant crispr-PagGLR3.3ab has more lateral root branches( Figure 12 A). The number of lateral roots of the double mutant is significantly increased compared with the control, and the length of the lateral roots is significantly increased compared with the control( Figure 12 B and Figure 12 C). The results of root hardness measurement show that the mutant plants are significantly higher than the control, reflecting that the lignin content in the roots of the mutant plants is higher than that of the control( Figure 12 D). From the cross-section analysis of different developmental parts of the roots at 1 cm, 2 cm and 5 cm away from the root tip, it can be seen that the number of xylem cells in the mutant plants increases, promoting the development of secondary vascular tissue( Figure 12 E). The cross-sectional area, vascular cylinder ratio and vascular cylinder xylem ratio of the root at 5 cm away from the root tip are increased by 37%, 28% and 41% respectively compared with the control( Figure 12 F, 12G and 12H). The above results indicate that the GLR3.3 gene is involved in the root development of poplar.

[0182] The plant heights and ground diameters of the wild control and three gene knockout strains under parallel culture conditions and the same growth time are shown in Table 1, and the average values of the three plants are taken.

[0183] Table 1. Statistical comparison of plant height and ground diameter

[0184]

[0185] Thus, it can be seen that by single or double knockout of the PagGLR3.3a and PagGLR3.3b genes, the present invention can not only increase the number and length of roots, but also increase the ground diameter and reduce the plant height, which helps to firmly root in the soil and enhance the ability to resist wind and lodging.

[0186] Example 7: Phenotypic characterization of the stems of gene double knockout plants

[0187] I. Plant cultivation

[0188] The test materials were the control plants of Populus alba×Populus glandulosa 84K (CK) and the double-knockout crispr-PagGLR3.3 (abbreviated as crispr-PagGLR3.3) transgenic plants #3, #6, and #9 obtained through Example 5. Tissue-cultured poplar seedlings were obtained through conventional cultivation. The rooting medium was based on the calcium-free 1 / 2MS medium, supplemented with 0.8% (w / v) agar, 3% (w / v) sucrose, and 5 mM calcium chloride. After rooting and growing for 1 month, they were transplanted into flower pots containing 5 mM calcium chloride in the soil and used for experiments after growing conventionally for 1 month. Crispr-PagGLR3.3 #9 was used for subsequent anatomical observation and other characterization experiments.

[0189] Figure 13 A shows the morphological photos of four plants. It can be seen that the height of the double-knockout plants is significantly shorter, and the ability to resist wind and lodging is enhanced.

[0190] II. Histochemical staining and photographing observation and analysis

[0191] Vibratome (VT1200S, Leica) was used to section the stems of the aforementioned CK and crispr-PagGLR3.3 #9, with a section thickness of 50 μm. After the fresh sections were conventionally stained with 0.01% toluidine blue O (TBO) for 1 min, they were washed three times with water to remove the excess staining solution on the surface, covered with cover slips, and observed and photographed with an optical microscope (Leica DM6B) to analyze the morphological differences in the cross-section of the stem tip.

[0192] The fresh sections were immersed in 1% Astra Blue and 5% safranin to stain the gelatinous layer (G-layer). The inner cell wall layer stained blue was called the gelatinous layer. The number of gelatinous layers was measured based on the stained inner cell wall layer.

[0193] Figure 13 In D, the 10th internode is shown. Through double staining with Astra Blue-safranin stain, it was found that a gelatinous layer appeared in the cell wall of the crisper-PagGLR3.3 plants ( Figure 13 D).

[0194] In Figure 13 E, the left figure is the control, and the right figure is the knockout plant. Among them, ve represents the vessel, xf represents the wood fiber, and gl represents the gelatinous layer. It can be seen that the phloem fibers of the knockout plant are significantly thickened.

[0195] In Figure 13 F, the number of gelatinous layers is shown.

[0196] The appearance of the gelatinous layer makes the wood have a higher cellulose content, making the wood have higher strength and tensile strength.

[0197] III. Fiber Morphology Observation

[0198] Cut the bark and xylem from the stem and place them in an impregnating solution containing CH3COOH and H2O2 with a volume ratio of 1:1. After placing them in an incubator at 60 °C for 48 hours, pour out the solution and wash them three times with distilled water. Observe the samples using a Leica DM6B microscope. The data are expressed as the mean ± standard deviation of three biological replicates.

[0199] In Figure 13 B, the scale bar in the lower left corner of the figure represents 100 μm. The left attached figure is the control, and the right attached figure is the knockout strain. The upper part is the stained cross-section of the stem, and the lower part is the enlarged view of the upper part. Among them, cz represents the cambium, pf represents phloem fibers, xy represents xylem, pi represents pith, and co represents cortex.

[0200] In Figure 13 C, the widths of the xylem, cambium, cortex, and phloem are shown for comparison.

[0201] In this invention, 1-month-old crisper-PagGLR3.3#9 knockout plants and wild-type 84K poplars were selected for anatomical observation. Through section staining and photographing, it was found that compared with the CK, the widths of the xylem, cambium, and cortex of crisper-PagGLR3.3#9 increased by about 2 times, about 36.1%, and about 20% respectively, and the width of the phloem decreased by 20%. The degree of lignification of crisper-PagGLR3.3 increased.

[0202] The increase in the width of the xylem enlarges the stem diameter of the wood and improves the utilization efficiency of the wood.

[0203] The appearance of the gelatinous layer in crisper-PagGLR3.3 plants increases the cellulose content and the length of phloem fibers, promoting the expansion of the utilization range of poplar wood. With its excellent mechanical properties and environmental protection characteristics, it can be widely used in the production of building, ship, and aerospace materials.

[0204] IV. Transmission Electron Microscopy Observation

[0205] Take the stem tips of the 9th internode of the control and transgenic plants, about 0.5 cm. Immerse them in 2.5% (v / v) glutaraldehyde and 0.2 M sodium phosphate buffer (pH 7.2) under vacuum for fixation. Then wash them three times with 0.2 M sodium phosphate buffer, 15 minutes each time. Subsequently, the samples are post-fixed in 2% (w / v) OsO4 for 2 hours, and washed three times with 0.2 M sodium phosphate buffer, 15 minutes each time. Subsequently, gradient elution is carried out with ethanol, and finally embedded with Spurr embedding medium and heated overnight. All TEM images were captured at a voltage of 100 kV on a TEM 1010 device (JEOL, Tokyo, Japan), which is equipped with an XR-41B AMT digital camera (Advanced Microscopy Techniques, Woburn, MA, USA).

[0206] For the 9th - 11th internodes of CK and crisper-PagGLR3.3 poplars grown in soil for 1 month, fiber isolation of the bark was carried out. Through transmission electron microscopy observation and calculation, the lengths of phloem fibers and xylem fibers in the stems of transgenic materials were analyzed. In Figure 13 H, the left figure is the control, the right figure is the knockout strain. The upper figure shows phloem fibers, and the lower figure shows xylem fibers. The scale bar in the lower left corner of the figure represents 100 μm. The straight lines drawn in the figure represent the fiber lengths. Figure 13 J counted the lengths of phloem fibers, Figure 13 H counted the lengths of xylem fibers. Through Figure 13 H-J, it can be seen that the length of phloem fibers in the stems of crisper-PagGLR3.3 poplars increased by 47.8%, and the length of xylem fibers decreased by 28.0%.

[0207] V. Determination of Three Major Elements

[0208] Collect the 7th - 12th internodes of 1-month-old control and crispr-PagGLR3.3 transgenic plants for the determination of lignin, cellulose, and hemicellulose contents. The samples are treated with alcohol to obtain insoluble residues. The monosaccharide composition is determined by GC-MS (gas chromatography - mass spectrometry) (Agilent, Santa Clara, CA, USA). For the analysis of crystalline cellulose, the remaining materials after trifluoroacetic acid treatment are hydrolyzed in Updegraff reagent. The cooled pellets are washed and hydrolyzed with 72% sulfuric acid. The cellulose content is routinely determined by the anthrone method. The lignin content is routinely determined by the acetyl bromide method. After acid treatment, hemicellulose is converted into reducing sugars, which react with 3,5-dinitrosalicylic acid (DNS) to form a reddish-brown substance, and the hemicellulose content is determined by a spectrophotometer. The data are expressed as the mean ± standard deviation of three biological replicates.

[0209] Figure 13G is a control chart of the contents of three major components. The results show that the hemicellulose and cellulose contents of transgenic plants are significantly higher than those of wild-type plants, with the contents increasing by 12.4% and 8% respectively.

[0210] The higher the hemicellulose and cellulose contents, the stronger the toughness and fiber properties of poplar wood, which is beneficial to improving the quality of poplar wood and the utilization rate of wood.

[0211] Example 8: Response of gene knockout plants to calcium ions

[0212] Based on the calcium-free 1 / 2MS medium as the basal medium, after adding 0.8% (w / v) agar and 3% (w / v) sucrose, 1 mM calcium chloride; 5 mM calcium chloride; 5 mM calcium chloride + 10 mg / L lanthanum chloride (LaCl3); 10 mM calcium chloride were added respectively to prepare four rooting media with a pH of 5.7. Using the above four rooting media respectively, tissue culture seedlings of the leaves explants of 84K poplar crispr-PagGLR3.3ab#3 and control plants (CK) were prepared by the conventional method. After one month of rooting culture, the root morphology was photographed, and the number and length of lateral roots were counted. The results are shown in Figure 14 .

[0213] As Figure 14 can be seen, the treatment with low calcium and the calcium channel inhibitor LaCl3 promoted the lateral root growth of the control and crispr-PagGLR3.3ab plants ( Figure 14 A). Under normal conditions (5 mM Ca 2+ ), the number of lateral roots of crispr-PagGLR3.3ab plants increased by 37% compared with the control, and the length of lateral roots increased by 48.5% compared with the control; under the treatment of LaCl3, the number of lateral roots of crispr-PagGLR3.3ab plants increased by 18.2% compared with the control, and the length of lateral roots increased by 47% compared with the control; under the low calcium treatment, the number of lateral roots of crispr-PagGLR3.3ab plants increased by 60.5% compared with the control, and the length of lateral roots increased by 61% compared with the control ( Figure 14 A, 14B, 14C). The results show that both the treatment with LaCl3 and low calcium can significantly promote the number and length of poplar lateral roots, and the PagGLR3.3 mutant further strengthens this effect. These morphological changes indicate that PagGLR3.3 is involved in the calcium ion-mediated lateral root development.

[0214] Example 9: Response of gene double knockout plants to transcriptome

[0215] The rooting medium was based on a calcium-free 1 / 2 MS medium, supplemented with 0.8% (w / v) agar, 3% (w / v) sucrose, and 5 mM calcium chloride. Using the aforementioned rooting medium, tissue culture seedlings of Populus alba × Populus glandulosa cv. 84K with the crispr-PagGLR3.3ab#3 strain and control plants (CK) were prepared by conventional methods. After one month of culture, the RNA of their lateral roots was extracted, and transcriptome sequencing was performed in the Paired-end 150-bp mode on the Illumina HiSeq XTen platform. Comparative transcriptome and functional analyses were carried out in combination with the aforementioned Populus alba × Populus glandulosa cv. 84K genomic information.

[0216] Compared with the wild-type control plants, the double knockout plants had 572 upregulated genes and 70 downregulated genes. The Gene ontology (GO) method was used to analyze the functions of the upregulated genes. It was found that the genes upregulated in the double knockout plants included four calcium transporter Ca 2+ -ATPase genes, ACA7, ACA12a, ACA12b, and ACA13 (auto-inhibited Ca 2+ -ATPase); protein kinases, such as CIPK7 (CBL-interacting protein kinase 7), CPK1 (calcium-dependent protein kinase 1), MAPKKK19 (mitogen-activated protein kinase kinase kinase 19), MAPKKK21, and WAG1 genes; three auxin transport-related ABC transporters, ABCB21 (ATP-binding cassette B21), which may affect the accumulation of auxin in cells; some peroxidase genes (PRX3, PRX4, PRX25, and PRX52), CAD7 (cinnamyl-alcohol dehydrogenase 7), BCB (blue-copper binding protein), and MYB43, which are involved in lignin biosynthesis; some xyloglucan endotransglycosylase protein genes, XTH15 and XTH23 paralogous genes, which promote xyloglucan metabolism and are involved in lateral root development; some transcription factors, WRKY, MYB, and ERF, which may regulate cell wall development. For the genes ACA7, ABCB21a, PRX3, CAD7, MYB43a, BCB, XTH15a, XTH23a, CIPK7, and WAG1, the expression levels in the lateral roots of the double mutants were tested by qPCR using the wild type as a control. The results are shown in Figure 15It can be seen that the expression levels of these genes are increased to about 2.5 - 4.5 times that of the wild type, with a significant difference. Thus, it is judged that the high expression of these genes is part of the mechanism for promoting lateral root growth and other aspects in the gene knockout strain.

[0217] As is known by common technical knowledge, the present invention can be implemented by other embodiments that do not depart from its spiritual essence or essential features. Therefore, the above - disclosed embodiments are illustrative in all aspects and not exclusive. All changes within the scope of the present invention or within the scope equivalent to the present invention are encompassed by the present invention.

Claims

1. A gRNA for knocking out poplar genes through a CRISPR / Cas9 system, wherein the target sequence of the gRNA is selected from the sequence shown in SEQ ID NO: 9 and / or the sequence shown in SEQ ID NO: 10, and the poplar is Populus alba×Populus glandulosa '84K'.

2. A genetic engineering vector that can express the gRNA recited in claim 1.

3. The genetic engineering vector according to claim 2, characterized in that, The genetic engineering vector can also express the Cas9 gene.

4. A recombinant Agrobacterium containing the genetic engineering vector recited in claim 2 or 3.

5. The recombinant Agrobacterium tumefaciens according to claim 4, wherein, The host bacterium of the recombinant Agrobacterium is GV3101 or EHA105.

6. A kit containing the gRNA recited in claim 1, the genetic engineering vector recited in claim 2 or 3, or the recombinant Agrobacterium recited in claim 4 or 5.

7. A gene knockout method for poplar trees, wherein the gene knockout method is: knocking out the poplar GLR3.3a gene; the gene knockout is achieved through CRISPR / Cas9 system; the gene knockout is carried out using the gRNA described in claim 1.

8. The gene knockout method according to claim 7, wherein The poplar tree is Populus alba×Populus glandulosa '84K'.

9. The gene knockout method according to claim 7, wherein The poplar tree GLR3.3 The coding sequence of the a gene is shown in SEQ ID NO:1 and / or SEQ ID NO:

2.

10. The gene knockout method according to claim 7, wherein, The steps of gene knockout are as follows: S1: Prepare poplar explants. S2: Infect the poplar explants with Agrobacterium that can express the gRNA recited in claim 1 and the Cas9 gene. S3: Co-culture the poplar explants infected with Agrobacterium. S4: Screen and culture the poplar explants obtained by co-culture to obtain callus. S5: Differentiate and culture the callus to obtain a poplar plant with buds. S6: Culture the poplar plant with buds for rooting to obtain a gene-knockout poplar plant with roots. The medium for co-culture is based on WPM and contains 15 - 25 g / L sucrose, 6 - 10 g / L agar, 0.4 - 0.6 g / L 2-(N-morpholino)ethanesulfonic acid, and 80 - 120 μM acetosyringone, with a pH of 5.5 - 6.

5. The medium for screening and culture is based on WPM and contains 15 - 25 g / L sucrose, 6 - 10 g / L agar, 0.4 - 0.6 g / L 2-(N-morpholino)ethanesulfonic acid, 0.8 - 1.2 mg / L 2,4-D, 0.08 - 0.12 mg / L KT, 150 - 250 mg / L cefotaxime, 150 - 250 mg / L ticarcillin, and 1.2 - 1.8 mg / L hygromycin B, with a pH of 5.5 - 6.

5. The medium for differentiation and culture is based on WPM and contains 15 - 25 g / L sucrose, 6 - 10 g / L agar, 0.4 - 0.6 g / L 2-(N-morpholino)ethanesulfonic acid, 0.04 - 0.06 mg / L NAA, 0.4 - 0.6 mg / L 6-BA, 150 - 250 mg / L cefotaxime, 150 - 250 mg / L ticarcillin, and 1.2 - 1.8 mg / L hygromycin B, with a pH of 5.5 - 6.

5. The medium for rooting culture is based on WPM and contains 8 - 12 g / L sucrose, 6 - 10 g / L agar, 0.4 - 0.6 g / L 2-(N-morpholino)ethanesulfonic acid, 150 - 250 mg / L cefotaxime, 150 - 250 mg / L ticarcillin, and 1.2 - 1.8 mg / L hygromycin B, with a pH of 5.5 - 6.

5.

11. A method for improving poplar traits, which is to prepare a gene-knockout poplar by the gene knockout method recited in any one of claims 7 - 10. The improvement of poplar traits includes: Increasing the xylem width of the stem. Increase the cellulose content in the stem; Increase the phloem fiber length in the stem; Promote the appearance of a gelatinous layer within the stem cell wall; Increase the number of poplar roots; Increase the length of poplar roots; Reduce the height of poplar plants; Increase the proportion of the vascular cylinder in poplar roots; Increase the proportion of xylem in the vascular cylinder of poplar roots; Increase the lignin content in poplar root systems; and Increase the proportion of xylem in the stems of poplar plants.

Images