A device and a detection method for bacterial integrated separation and multi-target detection

Abstract

This invention discloses a device and detection method for integrated bacterial isolation and multi-target detection. The device fabricates vertically aligned carbon nanotubes (VACNTs) on a multi-layered ring platform via chemical vapor deposition (CVD), and modifies them using layer-by-layer (1bl) self-assembly methods to attach specific aptamers to their surfaces. After injecting a liquid sample at the top of the device, the first layer of ring-shaped VACNTs can separate bacteria, while other layers of VACNTs can specifically capture bacterial secretions, enabling specific detection of bacteria via Raman-enhanced tagging. This invention's multi-level ring-shaped carbon nanotube array device fully utilizes the morphological advantages of VACNTs, integrating bacterial isolation and detection. Furthermore, it proposes for the first time a Raman-enhanced tag-aptamer detection method for VACNTs, improving the specificity and sensitivity when detecting specific bacteria.

Description

Technical Field

[0001] This invention relates to a technique for integrated separation and multi-target detection of bacteria using a multi-level ring carbon nanotube array device. Background Technology

[0002] The presence of some bacteria can lead to very serious diseases in humans, causing enormous harm. Although the advent of antibiotics once suppressed the harm caused by bacteria, various drug-resistant "superbugs" pose an even more threatening challenge to humanity. For patients with bacterial infections, rapid identification of bacterial species is crucial. Because traditional culture methods are too time-consuming, several new methods have been developed for bacterial detection, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA). However, these technologies are not yet fully mature, requiring complex operations, expensive equipment, and highly skilled operators. These problems hinder the rapid adoption of these technologies. Therefore, next-generation bacterial detection biosensors with features such as miniaturization, short response time, simple operation, high sensitivity, and selectivity have become a research hotspot.

[0003] For example, CN202211038789.0 discloses a single-particle click chemical sensor for rapid detection of bacteria in body fluids; CN202111308202.9 discloses an electrochemical detection method, sensor, and preparation method for Gram-negative bacteria; CN202210212890.7 discloses a meat bacteria detection sensor and its mechanism. However, the functions of the above sensors are relatively simple. Summary of the Invention

[0004] The purpose of this invention is to provide a device for integrated bacterial isolation and detection, which improves upon the problems of long time consumption, low concentration, poor sensitivity and specificity in conventional bacterial detection processes.

[0005] The technical solution of the present invention is as follows:

[0006] An apparatus for integrated bacterial isolation includes a substrate, wherein the substrate has a plurality of platforms and a plurality of grooves alternately arranged from the center outward; and the height of the plurality of platforms gradually decreases from the center outward; the height of the plurality of grooves also gradually decreases from the center outward.

[0007] Each of the aforementioned platforms is equipped with a carbon nanotube array. The carbon nanotube arrays on the platforms other than the top platform are modified to bind with bacterial aptamers. Preferably, vertically aligned carbon nanotubes (VACNTs) can be prepared on the platforms using chemical vapor deposition (CVD) and modified using methods such as layer-by-layer self-assembly (lbl) to bind specific aptamers to their surfaces.

[0008] In a preferred embodiment of the present invention, the platform and the groove are both circular.

[0009] In a preferred embodiment of the present invention, the device has a height range of 5-30mm, a bottom diameter range of 30-150mm, and a top platform diameter range of 5-30mm; the width of each platform is 1-8mm, and the inner wall radius of each groove is 1-5mm; the grooves and platforms are arranged in a gradient from top to bottom, with a height difference of 1-8mm.

[0010] In a preferred embodiment of the invention, a Raman enhancement tag capable of specifically capturing biological targets is also included, wherein the Raman enhancement tag comprises a Raman enhancement substrate and a Raman signal tag.

[0011] In a preferred embodiment of the present invention, the Raman-enhancing substrate comprises at least one of gold nanoparticles, gold nanorods (AuNRs), gold nanoflowers, silver nanoparticles, and a gold nanoparticle-silica core-shell structure; the Raman signal tag comprises at least one of mercaptobenzoic acid, 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), rhodamine, and crystal violet.

[0012] Another technical solution of the present invention is:

[0013] The method for integrated bacterial isolation and multi-target detection includes the following steps:

[0014] Step 1: Prepare a device for integrated bacterial isolation. The device includes a substrate with multiple platforms and grooves alternately arranged from the center outwards. The height of the multiple platforms gradually decreases from the center outwards, and the height of the multiple grooves gradually decreases from the center outwards. Each platform is provided with a carbon nanotube array. Except for the top platform, the carbon nanotube arrays on the other platforms are modified to bind to bacterial aptamers.

[0015] Step 2: Configure a Raman-enhanced tag capable of specifically capturing biological targets; the Raman-enhanced tag includes a Raman-enhancing substrate and a Raman signal tag; combine the Raman-enhanced tag and aptamer to prepare a Raman-enhanced tag-aptamer solution;

[0016] Step 3: Use a turbidimeter to culture to 10 8 CFU mL -1 The above concentrations (e.g., 10) 8 CFU mL -1 -10 10 CFUmL -1The bacteria were diluted, and the diluted solution was used as the test bacterial solution; a mixed bacterial solution without the target bacteria was prepared as a control; the same volume of each group was added to the center of the device in step one by a syringe pump at a uniform rate; after the injection was completed, all bacterial solutions in the groove were removed, and Raman-enhanced tag-aptamer solutions corresponding to different bacterial targets were added to the second and subsequent platforms on the device and left to stand.

[0017] Step 4: Under rotating conditions, inject PBS buffer to remove excess Raman-enhancing tag-aptamers from the carbon nanotube array; extract samples from the second and subsequent layers of the carbon nanotube array, detect the Raman signal under a Raman detector, and identify bacteria or targets.

[0018] In a preferred embodiment of the present invention, in step two, a Raman substrate suspension is taken, a Raman signal tag solution is added, and after mixing and reaction, the mixture is centrifuged at 5000-20000 rpm for 5-30 min, the supernatant is discarded, and the same volume of deionized water is added. This process is repeated twice to prepare a Raman-enhanced tag solution.

[0019] In a preferred embodiment of the present invention, an aqueous solution of an aptamer, including a 5' or 3' end modified thiol group and a disulfide bond, which can bind to the Raman enhancement tag is added. After the reaction, the mixture is centrifuged at 5000-20000 rpm for 5-30 min, the supernatant is discarded, and the same volume of deionized water is added. This process is repeated twice to prepare a Raman enhancement tag-aptamer solution.

[0020] In a preferred embodiment of the present invention, in step four, the rotational speed is 10-400 r / min.

[0021] In a preferred embodiment of the present invention, in step three, the bacterial solution to be tested is injected from the top of the device using a syringe pump; the flow rate is controlled at 0.1-1 mL / min.

[0022] The beneficial effects of this invention are:

[0023] 1. In the device of this invention, after injecting the sample at the top, the first layer of carbon nanotube array can separate bacteria, while other layers of carbon nanotube array can specifically capture bacterial secretions, and specific detection of bacteria is achieved through Raman-enhanced tagging. The device designed in this invention fully utilizes the morphological advantages of carbon nanotube arrays, integrating bacterial isolation and detection. The device designed in this invention for integrated bacterial isolation is easy to store after modification; it only needs to be refrigerated in PBS buffer.

[0024] 2. The separation and detection method described in this invention is time-efficient and can be completed within 30 minutes.

[0025] 3. This invention is the first to propose a Raman-enhanced tag-aptamer detection method using VACNT, which can improve the specificity and sensitivity when detecting specific bacteria. The content of this invention verifies that the secondary capture of biomolecule signals via Raman tagging in carbon nanotube arrays has high intensity.

[0026] 4. This invention employs a carbon nanotube array in the substrate. Carbon nanotubes offer three major advantages in the field of biosensors: designable morphology, multiple selectable excitation signals, and diverse modification methods. Designable morphology is reflected in the patterned growth of carbon nanotube arrays and the adjustable diameter, length, and density of the carbon nanotubes; multiple selectable excitation signals are specifically reflected in the excellent conductivity of carbon nanotubes, near-infrared fluorescence excitation, fluorescence resonance energy transfer, and their ability to serve as Raman enhancement substrates for Raman signal excitation; diverse modification methods are reflected in the covalent and non-covalent modification of carbon nanotube materials, with a large aspect ratio and large specific surface area providing more functionalization sites. These advantages enable carbon nanotube biosensors to separate, enrich, and amplify detection signals for different biological targets, thereby reducing the detection limit. The Raman enhancement detection method described in this invention has high sensitivity and specificity (detection limit for Staphylococcus aureus: 2 CFU / mL; specificity: within 10...). 2 At a concentration of CFU / mL, Staphylococcus aureus showed a distinct signal peak, while the control group of Escherichia coli showed almost none. Attached Figure Description

[0027] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0028] Figure 1 The image shows the design drawing (left) and the actual manufactured object (right) of the quartz-based device.

[0029] Figure 2 The images show a physical picture of a quartz-based multi-level ring carbon nanotube array device (first from the left), and SEM and TEM images of a carbon nanotube array prepared on the device by floating catalytic chemical vapor deposition (second to fourth from the left).

[0030] Figure 3 The image shows a TEM image (left) of AuNRs / DTNB / Aptamer and a 0.04 mL sample. -1 Raman signal intensity of AuNRs / DTNB / Aptamer prepared with DTNB ethanol solution and DTNB of the same concentration (right).

[0031] Figure 4 This is a schematic diagram illustrating the separation effect of a multi-stage carbon nanotube array device on Staphylococcus aureus at three different rotation speeds.

[0032] Figure 5 , Figure 6These are the variables in Examples 3, 4, and 5, specifically the concentration of Staphylococcus aureus added each time in step 14, which is 10. 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL. Figure 5 It is used to detect Staphylococcus aureus protein A (SPA). Figure 6 It is used to detect Staphylococcus aureus enterotoxin A (SEA). Detailed Implementation

[0033] The following embodiments will further illustrate the present invention with reference to the accompanying drawings.

[0034] The technical solution of the present invention includes the following:

[0035] (I) The design and fabrication scheme of a multi-level ring-shaped carbon nanotube array device is as follows:

[0036] 1) Fabricate a device with a pre-reserved carbon nanotube growth substrate. The material can be high-temperature resistant materials such as quartz or ceramics. The surface of its multi-level annular platforms must be a material suitable for carbon nanotube growth, including but not limited to alumina, silicon dioxide, quartz, and nickel. The height range is 5-30 mm, the bottom diameter range is 30-150 mm, and the top platform diameter range is 5-30 mm. The device should have interlaced annular platforms and annular grooves. The width of each annular platform is 1-8 mm, and the inner wall radius of each annular groove is 1-5 mm. The annular grooves and annular platforms are arranged in a gradient from top to bottom, with a height difference of 1-8 mm.

[0037] 2) The reserved carbon nanotube-free areas are defunctionalized, such as by spraying poisoning catalysts onto the surface of the circular area smaller than the radius of the frustum at the top of the device and all annular grooves, designing assemblable annular grooves and annular platforms, or reserving carbon nanotube preparation areas using photolithography. The fundamental purpose is to prevent carbon nanotubes from growing in the liquid injection area of ​​the top platform and in the annular grooves.

[0038] 3) VACNTs are fabricated on devices using chemical vapor deposition (CVD). Optional raw materials include, but are not limited to, ethylene, toluene, acetylene, and methane; catalysts include, but are not limited to, iron, ferrocene, nickel, magnesium, and molybdenum; and the gas phase includes, but is not limited to, hydrogen, argon, and nitrogen. The reaction temperature is 600-900℃, and the reaction time is 0-6 hours.

[0039] 4) Functionalization methods for multi-level ring carbon nanotube arrays include, but are not limited to, wet chemical methods such as mixed acid treatment with concentrated sulfuric acid and concentrated nitric acid, layer-by-layer self-assembly of positive and negative electrolytes such as polyallylamine hydrochloride (PAH), sodium polystyrene sulfonate (PSS), chitosan, and polydopamine, and non-covalent adsorption modification methods such as Tween 80 and SDS surfactants. Non-wet chemical methods such as plasma sputtering and plasma grafting can also be used. The fundamental purpose is to modify the VACNT surface with stable chemical groups, making it hydrophilic and capable of further reactions.

[0040] 5) Utilizing the frustum structure of the device itself, it can be made to rotate at a certain speed, using centrifugal force and gravity to regulate the flow of liquid on the carbon nanotube array. The specific rotational speed can be adjusted according to the size of the device, ranging from 0-400 rpm. -1 Make appropriate adjustments.

[0041] 6) Inject the bacterial solution to be tested from the top of the device using a syringe pump. The flow rate can be controlled within 0-1 mL / min depending on the size of the device and its rotational angular velocity. -1 Adjustment.

[0042] 7) Clean the device with PBS at an appropriate flow rate using a syringe pump for 10-20 min, and prepare a 100 μM bacterial aptamer aqueous solution. Add the aptamer solution dropwise to the second VACNT layer using a syringe pump at a uniform flow rate. Repeat this process to add other bacterial target aptamer solutions to the corresponding third and subsequent VACNT layers, and allow to stand for 30 min. Finally, clean the device with PBS at an appropriate flow rate using a syringe pump for 5-10 min.

[0043] (II) A method for preparing a Raman-enhanced tag capable of specifically capturing biological targets is as follows:

[0044] 8) Raman enhancement tags include Raman enhancement substrates and Raman signal tags. Raman enhancement substrates include, but are not limited to, gold nanoparticles, gold nanorods (AuNRs), gold nanoflowers, silver nanoparticles, and gold nanoparticle-silica core-shell structures. Raman signal tags include, but are not limited to, mercaptobenzoic acid, 5,5'-dithiobis(2-nitrobenzene) (DTNB), rhodamine, and crystal violet. Take the Raman substrate suspension, add the Raman signal tag solution, centrifuge at 12000 rpm for 20 min, discard the supernatant, add the same volume of deionized water, and repeat twice to prepare the Raman enhancement tag solution.

[0045] 9) Add a suitable concentration of a customized 5' or 3' end-modified thiol group, disulfide bond, or other sequence that can bind to the Raman-enhancing tag to the bacterial aptamer aqueous solution from step 7). React under specific conditions, centrifuge at 12000 rpm for 20 min, discard the supernatant, add the same volume of deionized water, and repeat twice to prepare the Raman-enhancing tag-aptamer solution. Store at 4℃. The Raman signal peak of DTNB is significantly enhanced, reaching 1360 cm⁻¹. -1 Nearby and 1650cm -1 The two nearby characteristic peaks can be used as signal peaks for detection.

[0046] (III) A method for separating bacteria using a multi-level ring-shaped carbon nanotube array device is as follows:

[0047] 10) Use a turbidimeter to culture to 10 8 CFU mL -1 The above concentration of bacteria was diluted to 10. 6 CFU mL -1 It is used as the bacterial solution to be tested.

[0048] 11) At an appropriate rotation speed, the device is injected with bacteria through a syringe pump at an appropriate flow rate until the bacterial volume in the bottom annular groove is saturated. 100 μL each of the original bacterial solution from the syringe and the bacterial solution to be tested from the first annular groove are spread onto culture medium. After incubation for at least 24 hours, the bacteria are counted, and the separation efficiency is calculated.

[0049] (iv) A method for detecting bacteria using Raman enhancement via a multi-level ring-shaped carbon nanotube array device is as follows:

[0050] 12) Based on step 10), configure 10 5 10 4 10 3 10 2 10 CFU / mL -1 Bacterial culture solution, and prepared 10 2 CFU mL -1 Five mixed bacteria containing the target bacteria and four mixed bacteria not containing the target bacteria were used as controls. 5 mL of each was added to the device at a uniform drip rate using a syringe pump. After injection, all bacterial solution in the groove was aspirated and removed. 1 mL of Raman-enhanced tag-aptamer solution corresponding to different bacterial targets was then manually and slowly added dropwise to the second and subsequent ring-shaped VACNTs on the device, and allowed to stand for 20 min.

[0051] 13) At an appropriate rotation speed, PBS buffer was injected into the carbon nanotube array at an appropriate flow rate using a syringe pump to remove excess Raman-enhancing tag-aptamers. Samples of the second and subsequent layers of carbon nanotube arrays were collected, and Raman signals were detected using a handheld Raman detector. The results were recorded over 10 minutes.5 10 4 10 3 10 2 10 CFU / mL -1 The signal intensity of the bacteria was compared with the signal intensity of all control groups in step 12) to verify sensitivity and specificity.

[0052] Example 1

[0053] 1) Design a pure quartz-based tri-level ring-shaped carbon nanotube device with a height of 12.5 mm, a bottom diameter of 66 mm, and a top platform diameter of 16 mm. Three ring-shaped platforms and three ring-shaped grooves are interspersed along the height. Each ring-shaped platform is 4 mm wide, and each ring-shaped groove has an inner wall radius of 2.5 mm. The radii of the three ring-shaped grooves from top to bottom are 10.5 mm, 19.5 mm, and 28.5 mm, respectively. The radii of the three ring-shaped platforms from top to bottom are 6 mm, 15 mm, and 24 mm, respectively. Design schematics and physical images are shown below. Figure 1 As shown.

[0054] 2) A modified stirring device can provide the quartz instrument with a rotation speed, set to 300 rpm. -1 The pump speed was set to regulate the fluid flow rate, and the injection rate was set to 0.4 mL / min. -1 .

[0055] 3) Carbon nanotube arrays were fabricated on the device using chemical vapor deposition (CVD). 30g of toluene and 1g of ferrocene were weighed as the carbon source and catalyst, respectively, and then sonicated for 15 min. The three grooves of the device were platinum-plated and placed inside a muffle furnace quartz tube. Argon gas was selected as the gas phase, with a flow rate of 0.4 ms. -1 The injection temperature for toluene-ferrocene was set at 105℃, and the injection rate was 6.5 mL / h. -1 Total injection time: 3 hours. Muffle furnace temperature: 740℃, reaction time: 3 hours.

[0056] 4) Prepare seed culture: Dissolve 0.3645g of cetyltrimethylammonium bromide (CTAB) in 5mL of deionized water, then weigh 25μL of 0.1M HAuCl4 and dissolve it in 5mL of deionized water. Mix them together to prepare solution A. Dissolve 3.8mg of NaBH4 in 1mL of ice water, and take 0.6mL to dilute to 1mL to prepare solution B. Mix solutions A and B and stir rapidly for 2min, then let stand for 0.5h. Then prepare growth medium: Weigh 1.4g of CTAB and 0.2468g of sodium oleate and dissolve them in 50mL of water. Dissolve and cool at 60℃ to prepare solution C. Weigh 0.0068g of AgNO3 and dissolve it in 10mL of water. Take 4.8mL and add it to 50mL of 1mM HAuCl4 to prepare solution D. Mix solutions C and D and let stand for 15min, then stir at 700rpm for 1.5h. Add 0.3 mL of hydrochloric acid and stir slowly for 15 min. Then add 64 mM, 0.25 mL of ascorbic acid solution and stir rapidly for 30 s. Add 0.2 mL of seed solution and stir slowly for 30 s. Let stand in a 30 °C water bath for 12 h. Centrifuge at 12000 rpm for 20 min, repeat twice, and store in a 4 °C refrigerator. A gold nanorod suspension was prepared.

[0057] 5) Take 5 mL of gold nanorod suspension and add 15 μL of 0.4 mL solution dissolved in ethanol. -1 The DTNB solution was shaken for 12 hours, centrifuged at 12000 rpm for 20 minutes, the supernatant was discarded, and the same volume of deionized water was added. This process was repeated twice to prepare the AuNRs / DTNB solution.

[0058] 6) Custom-designed Staphylococcus aureus A protein aptamers and Staphylococcus aureus enterotoxin A aptamers with 3'-terminal thiol modifications. Their sequences are as follows:

[0059] 3'ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG5',

[0060] Add 500 μL of 100 μM 3'-terminal thiol-modified Staphylococcus aureus A protein aptamer or 3'-terminal thiol-modified Staphylococcus aureus enterotoxin A aptamer, shake for 6 h, centrifuge at 12000 rpm for 20 min, discard the supernatant, add the same volume of deionized water, repeat twice to prepare AuNRs / DTNB / Aptamer solution, and store at 4 °C.

[0061] 7) Prepare 10mg mL -1 Sodium dodecylbenzenesulfonate (SDBS) solution was injected from the top of the device using a syringe pump. The device was secured to a modified stirrer and maintained at 300 rpm. -1 The device is allowed to rotate until all steps are complete. The solution is then allowed to flow uniformly through the three-layer carbon nanotube array under the influence of gravity and centrifugal force. After complete wetting for 5 minutes, the device is immersed in SDBS solution overnight. Deionized water with pH 9.3 is prepared and injected at 0.4 mL / min using a syringe pump. -1 Rinse the device for 10 min at a given flow rate. Prepare a 1 mg / mL solution. -1 Polyallylamine hydrochloride (PAH) solution with 1 mg mL -1 Sodium polystyrene sulfonate (PSS) solution, pH adjusted to 9.3. Injected via syringe pump at 0.4 mL / min. -1 PAH solution was injected into the top of the device at a flow rate of 10 min for 10 min, then replaced with deionized water (pH = 9.3) and rinsed at the same flow rate for 10 min. The solution was then injected via a syringe pump at a rate of 0.4 mL / min. -1 PSS solution was injected into the top of the device at a certain flow rate for 10 min, and then the device was cleaned with deionized water at pH 9.3 at the same flow rate for 10 min.

[0062] 8) Repeat the PAH and PSS self-assembly process 3.5 times, so that each carbon nanotube surface self-assembles 3.5 layers (one layer is counted as one positive and negative electrolyte assembly, and after three layers, a positive electrolyte is added again, equivalent to half a layer) of polyelectrolyte membrane. All subsequent steps are performed only on the second and third VACNT layers. Prepare deionized water (pH=2.5) using hydrochloric acid, and inject at 0.4 mL / min using a syringe pump. -1 The ammonium was injected into the first groove of the device at a flow rate of 15 min and then soaked in the second and third VACNT layers for 20 min to expose the amino group to the outer layer of the membrane.

[0063] 9) Weigh 10 mg of Biotin-NHS and dissolve it in 6 mL of dimethyl sulfoxide (DMSO) to prepare a 5 mM solution. -1 The solution was injected into the device under the same conditions using a syringe pump for 10 min, and then held at 0.05 mL for 1 min. -1 Let stand for 2 hours. Prepare phosphate buffered saline (PBS) solution by injecting PBS buffer into the solution at a flow rate of 0.4 mL / min using a syringe pump. -1 Clean the device at the specified flow rate for 10 min. Prepare a 6% bovine serum albumin (BSA) solution with PBS buffer and inject it into the device at the same flow rate using a syringe pump for 10 min, then maintain a flow rate of 0.05 mL. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1Wash the device with PBS at a flow rate of 10 min for 10 min. Prepare 50 μg mL -1 Avidin solution, with 6% BSA as solvent, was administered via a syringe pump at a rate of 0.4 mL / min. -1 The syringe was injected at a flow rate of 10 min, then maintained at 0.05 mL / min at 4°C. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1 The device was washed with PBS at a flow rate of 10 min. 500 μL solutions of 3'-labeled biotin-containing Staphylococcus aureus A protein aptamer and 3'-labeled biotin-containing Staphylococcus aureus enterotoxin A aptamer, each at a concentration of 100 μM, were prepared.

[0064] 10) Dissolve the Staphylococcus aureus A protein aptamer solution in 0.1 mL / min using a syringe pump. -1 The Staphylococcus aureus enterotoxin A aptamer was added dropwise to the second layer of the carbon nanotube array at a controlled rate. The same procedure was followed by adding the aptamer to the third layer of the carbon nanotube array. The mixture was allowed to stand for 30 minutes. Finally, it was injected using a syringe pump at a rate of 0.4 mL / min. -1 Clean the device with PBS at a flow rate of 10 min.

[0065] 11) Use a turbidimeter to incubate the incubator to 10... 9 CFU mL -1 Staphylococcus aureus serially diluted to 10 4 CFU mL -1 It is used as the bacterial solution to be tested.

[0066] 12) Set the device rotation speed to 0 r / min -1 0.4 mL min via syringe pump -1 Staphylococcus aureus was injected into the top of the device at a flow rate until the bacterial volume in the three annular grooves was saturated. 100 μL of the original bacterial solution from the syringe and 100 μL of the test bacterial solution from the first annular groove were then spread onto culture medium. After incubation for 24 hours, the bacterial counts were performed, and the separation efficiency was calculated.

[0067] 13) Based on steps 11) and 12), set the device rotation speed to 300 r / min. -1 Configuration 10 2 CFU mL -1 Staphylococcus aureus, and prepared 10 2 CFU mL -1 A concentration of *E. coli* was used as a control. After each injection, all bacterial culture in the groove was removed, and 1 mL of AuNRs / DTNB / Aptamer solution corresponding to *Staphylococcus aureus* protein A and *Staphylococcus aureus* enterotoxin A was taken and injected via a syringe pump at a rate of 0.1 mL / min. -1Droplets were added onto the second and third layers of the carbon nanotube array and left to stand for 20 minutes.

[0068] 14) Based on step 13), the device is subjected to 300 r / min. -1 At a certain speed, the solution was dispensed via a syringe pump at a rate of 0.4 mL / min. -1 Excess AuNRs / DTNB / Aptamer in the carbon nanotube array were removed by injecting PBS buffer at a low flow rate. The second layer of the carbon nanotube array was then cut, and the Raman signal was detected under a 785 nm excitation source using a handheld Raman spectrometer. The results were recorded over 10 minutes. 2 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of the control group in step 13) to verify sensitivity and specificity.

[0069] 15) The third layer of carbon nanotube array was cut off, and the Raman signal under a 785nm excitation source was detected using a handheld Raman detector. The results were recorded for 10 minutes. 2 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of all control groups in step 13) to verify sensitivity and specificity. The detection limit for Staphylococcus aureus was 2 CFU / mL, and the specificity was: within 10... 4 At a CFU / mL concentration, Staphylococcus aureus showed a distinct signal peak, while the control group of Escherichia coli showed almost none.

[0070] Example 2

[0071] 1) Design a pure quartz-based tri-level ring-shaped carbon nanotube device with a height of 12.5 mm, a bottom diameter of 66 mm, and a top platform diameter of 16 mm. Three ring-shaped platforms and three ring-shaped grooves are interspersed along the height. Each ring-shaped platform is 4 mm wide, and each ring-shaped groove has an inner wall radius of 2.5 mm. The radii of the three ring-shaped grooves from top to bottom are 10.5 mm, 19.5 mm, and 28.5 mm, respectively. The radii of the three ring-shaped platforms from top to bottom are 6 mm, 15 mm, and 24 mm, respectively. Design schematics and physical images are shown below. Figure 1 As shown.

[0072] 2) A modified stirring device can provide the quartz instrument with a rotation speed, set to 300 rpm. -1 The pump speed was set to regulate the fluid flow rate, and the injection rate was set to 0.4 mL / min. -1 .

[0073] 3) Carbon nanotube arrays were fabricated on the device using chemical vapor deposition (CVD). 30g of toluene and 1g of ferrocene were weighed as the carbon source and catalyst, respectively, and then sonicated for 15 min. The three grooves of the device were platinum-plated and placed inside a muffle furnace quartz tube. Argon gas was selected as the gas phase, with a flow rate of 0.4 ms. -1The injection temperature for toluene-ferrocene was set at 105℃, and the injection rate was 6.5 mL / h. -1 Total injection time: 3 hours. Muffle furnace temperature: 740℃, reaction time: 3 hours.

[0074] 4) Prepare seed culture: Dissolve 0.3645g CTAB in 5mL deionized water, then weigh 25μL of 0.1M HAuCl4 and dissolve it in 5mL of deionized water. Mix them together to prepare solution A. Dissolve 3.8mg NaBH4 in 1mL ice water, and take 0.6mL to dilute to 1mL to prepare solution C. Mix solutions B and C and stir rapidly for 2min, then let stand for 0.5h. Then prepare growth medium: Weigh 1.4g CTAB and 0.2468g sodium oleate and dissolve them in 50mL of water. Dissolve and cool at 60℃ to prepare solution A. Weigh 0.0068g AgNO3 and dissolve it in 10mL of water. Take 4.8mL and add it to 50mL of 1mM HAuCl4 to prepare solution D. Mix solutions A and D and let stand for 15min, then stir at 700rpm for 1.5h. Add 0.3 mL of hydrochloric acid and stir slowly for 15 min. Then add 64 mM, 0.25 mL of ascorbic acid solution and stir rapidly for 30 s. Add 0.2 mL of seed solution and stir slowly for 30 s. Let stand in a 30 ℃ water bath for 12 h. Centrifuge at 12000 rpm for 20 min. Repeat twice. Store in a 4 ℃ refrigerator.

[0075] 5) Take 5 mL of gold nanorod suspension and add 15 μL of 0.4 mL solution dissolved in ethanol. -1 The DTNB solution was shaken for 12 hours, centrifuged at 12000 rpm for 20 minutes, the supernatant was discarded, and the same volume of deionized water was added. This process was repeated twice to prepare the AuNRs / DTNB solution.

[0076] 6) Custom-designed Staphylococcus aureus A protein aptamers and Staphylococcus aureus enterotoxin A aptamers with 3'-terminal thiol modifications. Their sequences are as follows:

[0077] 3'ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG5',

[0078] Add 500 μL of 100 μM 3'-terminal thiol-modified Staphylococcus aureus A protein aptamer or 3'-terminal thiol-modified Staphylococcus aureus enterotoxin A aptamer, shake for 6 h, centrifuge at 12000 rpm for 20 min, discard the supernatant, add the same volume of deionized water, repeat twice to prepare AuNRs / DTNB / Aptamer solution, and store at 4 °C.

[0079] 7) Prepare 10mg mL -1 SDBS solution was injected from the top of the device using a syringe pump. The device was secured to a modified stirring device and maintained at 300 rpm. -1 The device is allowed to rotate until all steps are complete. The solution is then allowed to flow uniformly through the three-layer carbon nanotube array under the influence of gravity and centrifugal force. After complete wetting for 5 minutes, the device is immersed in SDBS solution overnight. Deionized water with pH 9.3 is prepared and injected at 0.4 mL / min using a syringe pump. -1 Rinse the device for 10 min at a flow rate of [flow rate missing]. Prepare 1 mg / mL solution. -1 PAH solution and 1 mg / mL -1 PSS solution, pH adjusted to 9.3. Injected via syringe pump at 0.4 mL / min. -1 PAH solution was injected into the top of the device at a flow rate of 10 min for 10 min, then replaced with deionized water (pH = 9.3) and rinsed at the same flow rate for 10 min. The solution was then injected via a syringe pump at a rate of 0.4 mL / min. -1 PSS solution was injected into the top of the device at a certain flow rate for 10 min, and then the device was cleaned with deionized water at pH 9.3 at the same flow rate for 10 min.

[0080] 8) Continue repeating the PAH and PSS self-assembly process 3.5 times, so that each carbon nanotube surface self-assembles 3.5 layers of polyelectrolyte membrane. All subsequent steps are performed only on the second and third VACNT layers. Prepare deionized water (pH 2.5) with hydrochloric acid, and inject via a syringe pump at 0.4 mL / min. -1 The ammonium was injected into the first groove of the device at a flow rate of 15 min and then soaked in the second and third VACNT layers for 20 min to expose the amino group to the outer layer of the membrane.

[0081] 9) Weigh 10 mg of Biotin-NHS and dissolve it in 6 mL of dimethyl sulfoxide (DMSO) to prepare a 5 mM solution. -1 The solution was injected into the device under the same conditions using a syringe pump for 10 min, and then held at 0.05 mL for 1 min. -1Let stand for 2 hours. Prepare phosphate buffered saline (PBS) solution by injecting PBS buffer into the solution at a flow rate of 0.4 mL / min using a syringe pump. -1 Clean the device at the specified flow rate for 10 min. Prepare a 6% bovine serum albumin (BSA) solution with PBS buffer and inject it into the device at the same flow rate using a syringe pump for 10 min, then maintain a flow rate of 0.05 mL. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1 Wash the device with PBS at a flow rate of 10 min for 10 min. Prepare 50 μg mL -1 Avidin solution, with 6% BSA as solvent, was administered via a syringe pump at a rate of 0.4 mL / min. -1 The syringe was injected at a flow rate of 10 min, then maintained at 0.05 mL / min at 4°C. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1 The device was washed with PBS at a flow rate of 10 min. 500 μL solutions of 3'-labeled biotin-containing Staphylococcus aureus A protein aptamer and 3'-labeled biotin-containing Staphylococcus aureus enterotoxin A aptamer, each at a concentration of 100 μM, were prepared.

[0082] 10) Dissolve the Staphylococcus aureus A protein aptamer solution in 0.1 mL / min using a syringe pump. -1 The Staphylococcus aureus enterotoxin A aptamer was added dropwise to the second layer of the carbon nanotube array at a controlled rate. The same procedure was followed by adding the aptamer to the third layer of the carbon nanotube array. The mixture was allowed to stand for 30 minutes. Finally, it was injected using a syringe pump at a rate of 0.4 mL / min. -1 Clean the device with PBS at a flow rate of 10 min.

[0083] 11) Use a turbidimeter to incubate the incubator to 10... 9 CFU mL -1 Staphylococcus aureus serially diluted to 10 4 CFU mL -1 It is used as the bacterial solution to be tested.

[0084] 12) Set the device rotation speed to 150 r / min -1 0.4 mL min via syringe pump -1 Staphylococcus aureus was injected into the top of the device at a flow rate until the bacterial volume in the three annular grooves was saturated. 100 μL of the original bacterial solution from the syringe and 100 μL of the test bacterial solution from the first annular groove were then spread onto culture medium. After incubation for 24 hours, the bacterial counts were performed, and the separation efficiency was calculated.

[0085] 13) Based on steps 11) and 12), configure 10 2 CFU mL -1Staphylococcus aureus, and prepared 10 2 CFU mL -1 A concentration of *E. coli* was used as a control. After each injection, all bacterial culture in the groove was removed, and 1 mL of AuNRs / DTNB / Aptamer solution corresponding to *Staphylococcus aureus* protein A and *Staphylococcus aureus* enterotoxin A was taken and injected via a syringe pump at a rate of 0.1 mL / min. -1 Droplets were added onto the second and third layers of the carbon nanotube array and left to stand for 20 minutes.

[0086] 14) Based on step 13), the device is subjected to 300 r / min. -1 At a certain speed, the solution was dispensed via a syringe pump at a rate of 0.4 mL / min. -1 Excess AuNRs / DTNB / Aptamer in the carbon nanotube array were removed by injecting PBS buffer at a low flow rate. The second layer of the carbon nanotube array was then cut, and the Raman signal was detected under a 785 nm excitation source using a handheld Raman spectrometer. The results were recorded over 10 minutes. 2 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of the control group in step 13) to verify sensitivity and specificity.

[0087] 15) The third layer of carbon nanotube array was cut off, and the Raman signal under a 785nm excitation source was detected using a handheld Raman detector. The results were recorded for 10 minutes. 2 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of all control groups in step 13) to verify sensitivity and specificity.

[0088] Example 3

[0089] 1) Design a pure quartz-based tri-level ring-shaped carbon nanotube device with a height of 12.5 mm, a bottom diameter of 66 mm, and a top platform diameter of 16 mm. Three ring-shaped platforms and three ring-shaped grooves are interspersed along the height. Each ring-shaped platform is 4 mm wide, and each ring-shaped groove has an inner wall radius of 2.5 mm. The radii of the three ring-shaped grooves from top to bottom are 10.5 mm, 19.5 mm, and 28.5 mm, respectively. The radii of the three ring-shaped platforms from top to bottom are 6 mm, 15 mm, and 24 mm, respectively. Design schematics and physical images are shown below. Figure 1 As shown.

[0090] 2) A modified stirring device can provide the quartz instrument with a rotation speed, set to 300 rpm. -1 The pump speed was set to regulate the fluid flow rate, and the injection rate was set to 0.4 mL / min. -1 .

[0091] 3) Carbon nanotube arrays were fabricated on the device using chemical vapor deposition (CVD). 30g of toluene and 1g of ferrocene were weighed as the carbon source and catalyst, respectively, and then sonicated for 15 min. The three grooves of the device were platinum-plated and placed inside a muffle furnace quartz tube. Argon gas was selected as the gas phase, with a flow rate of 0.4 ms. -1 The injection temperature for toluene-ferrocene was set at 105℃, and the injection rate was 6.5 mL / h. -1 Total injection time: 3 hours. Muffle furnace temperature: 740℃, reaction time: 3 hours.

[0092] 4) Prepare seed culture: Dissolve 0.3645g CTAB in 5mL deionized water, then weigh 25μL of 0.1M HAuCl4 and dissolve it in 5mL deionized water. Mix them together to prepare solution A. Dissolve 3.8mg NaBH4 in 1mL ice water, and take 0.6mL to dilute to 1mL to prepare solution C. Mix solutions B and C and stir rapidly for 2min, then let stand for 0.5h. Then prepare growth medium: Weigh 1.4g CTAB and 0.2468g sodium oleate and dissolve them in 50mL water. Dissolve and cool at 60℃ to prepare solution A. Weigh 0.0068g AgNO3 and dissolve it in 10mL water. Take 4.8mL and add it to 50mL of 1mM HAuCl4 to prepare solution D. Mix solutions A and D and let stand for 15min, then stir at 700rpm for 1.5h. Add 0.3 mL of hydrochloric acid and stir slowly for 15 min. Then add 64 mM, 0.25 mL of ascorbic acid solution and stir rapidly for 30 s. Add 0.2 mL of seed solution and stir slowly for 30 s. Let stand in a 30 ℃ water bath for 12 h. Centrifuge at 12000 rpm for 20 min. Repeat twice. Store in a 4 ℃ refrigerator.

[0093] 5) Take 5 mL of gold nanorod suspension and add 15 μL of 0.4 mL solution dissolved in ethanol. -1 The DTNB solution was shaken for 12 hours, centrifuged at 12000 rpm for 20 minutes, the supernatant was discarded, and the same volume of deionized water was added. This process was repeated twice to prepare the AuNRs / DTNB solution.

[0094] 6) Custom-designed Staphylococcus aureus A protein aptamers and Staphylococcus aureus enterotoxin A aptamers with 3'-terminal thiol modifications. Their sequences are as follows:

[0095] 3'ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG5',

[0096] Add 500 μL of 100 μM 3'-terminal thiol-modified Staphylococcus aureus A protein aptamer or 3'-terminal thiol-modified Staphylococcus aureus enterotoxin A aptamer, shake for 6 h, centrifuge at 12000 rpm for 20 min, discard the supernatant, add the same volume of deionized water, repeat twice to prepare AuNRs / DTNB / Aptamer solution, and store at 4 °C.

[0097] 7) Prepare 10mg mL -1 SDBS solution was injected from the top of the device using a syringe pump. The device was secured to a modified stirring device and maintained at 300 rpm. -1 The device is allowed to rotate until all steps are complete. The solution is then allowed to flow uniformly through the three-layer carbon nanotube array under the influence of gravity and centrifugal force. After complete wetting for 5 minutes, the device is immersed in SDBS solution overnight. Deionized water with pH 9.3 is prepared and injected at 0.4 mL / min using a syringe pump. -1 Rinse the device for 10 min at a flow rate of [flow rate missing]. Prepare 1 mg / mL solution. -1 PAH solution and 1 mg / mL -1 PSS solution, pH adjusted to 9.3. Injected via syringe pump at 0.4 mL / min. -1 PAH solution was injected into the top of the device at a flow rate of 10 min for 10 min, then replaced with deionized water (pH = 9.3) and rinsed at the same flow rate for 10 min. The solution was then injected via a syringe pump at a rate of 0.4 mL / min. -1 PSS solution was injected into the top of the device at a certain flow rate for 10 min, and then the device was cleaned with deionized water at pH 9.3 at the same flow rate for 10 min.

[0098] 8) Continue repeating the PAH and PSS self-assembly process 3.5 times, so that each carbon nanotube surface self-assembles 3.5 layers of polyelectrolyte membrane. All subsequent steps are performed only on the second and third VACNT layers. Prepare deionized water (pH 2.5) with hydrochloric acid, and inject via a syringe pump at 0.4 mL / min. -1 The ammonium was injected into the first groove of the device at a flow rate of 15 min and then soaked in the second and third VACNT layers for 20 min to expose the amino group to the outer layer of the membrane.

[0099] 9) Weigh 10 mg of Biotin-NHS and dissolve it in 6 mL of dimethyl sulfoxide (DMSO) to prepare a 5 mM solution. -1 The solution was injected into the device under the same conditions using a syringe pump for 10 min, and then held at 0.05 mL for 1 min. -1Let stand for 2 hours. Prepare phosphate buffered saline (PBS) solution by injecting PBS buffer into the solution at a flow rate of 0.4 mL / min using a syringe pump. -1 Clean the device at the specified flow rate for 10 min. Prepare a 6% bovine serum albumin (BSA) solution with PBS buffer and inject it into the device at the same flow rate using a syringe pump for 10 min, then maintain a flow rate of 0.05 mL. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1 Wash the device with PBS at a flow rate of 10 min for 10 min. Prepare 50 μg mL -1 Avidin solution, with 6% BSA as solvent, was administered via a syringe pump at a rate of 0.4 mL / min. -1 The syringe was injected at a flow rate of 10 min, then maintained at 0.05 mL / min at 4°C. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1 The device was washed with PBS at a flow rate of 10 min. 500 μL solutions of 3'-labeled biotin-containing Staphylococcus aureus A protein aptamer and 3'-labeled biotin-containing Staphylococcus aureus enterotoxin A aptamer, each at a concentration of 100 μM, were prepared.

[0100] 10) Dissolve the Staphylococcus aureus A protein aptamer solution in 0.1 mL / min using a syringe pump. -1 The Staphylococcus aureus enterotoxin A aptamer was added dropwise to the second layer of the carbon nanotube array at a controlled rate. The same procedure was followed by adding the aptamer to the third layer of the carbon nanotube array. The mixture was allowed to stand for 30 minutes. Finally, it was injected using a syringe pump at a rate of 0.4 mL / min. -1 Clean the device with PBS at a flow rate of 10 min.

[0101] 11) Use a turbidimeter to incubate the incubator to 10... 9 CFU mL -1 Staphylococcus aureus serially diluted to 10 4 CFU mL -1 It is used as the bacterial solution to be tested.

[0102] 12) Set the device rotation speed to 300 r / min -1 0.4 mL min via syringe pump -1 Staphylococcus aureus was injected into the top of the device at a flow rate until the bacterial volume in the three annular grooves was saturated. 100 μL of the original bacterial solution from the syringe and 100 μL of the test bacterial solution from the first annular groove were then spread onto culture medium. After incubation for 24 hours, the bacterial counts were performed, and the separation efficiency was calculated. Figure 6 The results showed that at 0.4 mL min -1 At a flow rate of 300 r / min, when the device rotation speed reaches 300 r / min -1At concentrations of 82% and above, the device achieves the highest separation efficiency for Staphylococcus aureus, reaching 82%.

[0103] 13) Based on step 11), configure 10 2 CFU mL -1 Staphylococcus aureus, and prepared 10 2 CFU mL -1 A concentration of *E. coli* was used as a control. After each injection, all bacterial culture in the groove was removed, and 1 mL of AuNRs / DTNB / Aptamer solution corresponding to *Staphylococcus aureus* protein A and *Staphylococcus aureus* enterotoxin A was taken and injected via a syringe pump at a rate of 0.1 mL / min. -1 Droplets were added onto the second and third layers of the carbon nanotube array and left to stand for 20 minutes.

[0104] 14) Based on step 13), the device is subjected to 300 r / min. -1 At a certain speed, the solution was dispensed via a syringe pump at a rate of 0.4 mL / min. -1 Excess AuNRs / DTNB / Aptamer in the carbon nanotube array were removed by injecting PBS buffer at a low flow rate. The second layer of the carbon nanotube array was then cut, and the Raman signal was detected under a 785 nm excitation source using a handheld Raman spectrometer. The results were recorded over 10 minutes. 2 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of the control group in step 13) to verify sensitivity and specificity.

[0105] 15) The third layer of carbon nanotube array was cut off, and the Raman signal under a 785nm excitation source was detected using a handheld Raman detector. The results were recorded for 10 minutes. 2 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of all control groups in step 13) to verify sensitivity and specificity.

[0106] Example 4

[0107] 1) Design a pure quartz-based tri-level ring-shaped carbon nanotube device with a height of 12.5 mm, a bottom diameter of 66 mm, and a top platform diameter of 16 mm. Three ring-shaped platforms and three ring-shaped grooves are interspersed along the height. Each ring-shaped platform is 4 mm wide, and each ring-shaped groove has an inner wall radius of 2.5 mm. The radii of the three ring-shaped grooves from top to bottom are 10.5 mm, 19.5 mm, and 28.5 mm, respectively. The radii of the three ring-shaped platforms from top to bottom are 6 mm, 15 mm, and 24 mm, respectively. Design schematics and physical images are shown below. Figure 1 As shown.

[0108] 2) A modified stirring device can provide the quartz instrument with a rotation speed, set to 300 rpm.-1 The pump speed was set to regulate the fluid flow rate, and the injection rate was set to 0.4 mL / min. -1 .

[0109] 3) Carbon nanotube arrays were fabricated on the device using chemical vapor deposition (CVD). 30g of toluene and 1g of ferrocene were weighed as the carbon source and catalyst, respectively, and then sonicated for 15 min. The three grooves of the device were platinum-plated and placed inside a muffle furnace quartz tube. Argon gas was selected as the gas phase, with a flow rate of 0.4 ms. -1 The injection temperature for toluene-ferrocene was set at 105℃, and the injection rate was 6.5 mL / h. -1 Total injection time: 3 hours. Muffle furnace temperature: 740℃, reaction time: 3 hours.

[0110] 4) Prepare seed culture: Dissolve 0.3645g CTAB in 5mL deionized water, then weigh 25μL of 0.1M HAuCl4 and dissolve it in 5mL of deionized water. Mix them together to prepare solution A. Dissolve 3.8mg NaBH4 in 1mL ice water, and take 0.6mL to dilute to 1mL to prepare solution C. Mix solutions B and C and stir rapidly for 2min, then let stand for 0.5h. Then prepare growth medium: Weigh 1.4g CTAB and 0.2468g sodium oleate and dissolve them in 50mL of water. Dissolve and cool at 60℃ to prepare solution A. Weigh 0.0068g AgNO3 and dissolve it in 10mL of water. Take 4.8mL and add it to 50mL of 1mM HAuCl4 to prepare solution D. Mix solutions A and D and let stand for 15min, then stir at 700rpm for 1.5h. Add 0.3 mL of hydrochloric acid and stir slowly for 15 min. Then add 64 mM, 0.25 mL of ascorbic acid solution and stir rapidly for 30 s. Add 0.2 mL of seed solution and stir slowly for 30 s. Let stand in a 30 ℃ water bath for 12 h. Centrifuge at 12000 rpm for 20 min. Repeat twice. Store in a 4 ℃ refrigerator.

[0111] 5) Take 5 mL of gold nanorod suspension and add 15 μL of 0.4 mL solution dissolved in ethanol. -1 The DTNB solution was shaken for 12 hours, centrifuged at 12000 rpm for 20 minutes, the supernatant was discarded, and the same volume of deionized water was added. This process was repeated twice to prepare the AuNRs / DTNB solution.

[0112] 6) Custom-designed Staphylococcus aureus A protein aptamers and Staphylococcus aureus enterotoxin A aptamers with 3'-terminal thiol modifications. Their sequences are as follows:

[0113] 3'ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG5',

[0114] Add 500 μL of 100 μM 3'-terminal thiol-modified Staphylococcus aureus A protein aptamer or 3'-terminal thiol-modified Staphylococcus aureus enterotoxin A aptamer, shake for 6 h, centrifuge at 12000 rpm for 20 min, discard the supernatant, add the same volume of deionized water, repeat twice to prepare AuNRs / DTNB / Aptamer solution, and store at 4 °C.

[0115] 7) Prepare 10mg mL -1 SDBS solution was injected from the top of the device using a syringe pump. The device was secured to a modified stirring device and maintained at 300 rpm. -1 The device is allowed to rotate until all steps are complete. The solution is then allowed to flow uniformly through the three-layer carbon nanotube array under the influence of gravity and centrifugal force. After complete wetting for 5 minutes, the device is immersed in SDBS solution overnight. Deionized water with pH 9.3 is prepared and injected at 0.4 mL / min using a syringe pump. -1 Rinse the device for 10 min at a flow rate of [flow rate missing]. Prepare 1 mg / mL solution. -1 PAH solution and 1 mg / mL -1 PSS solution, pH adjusted to 9.3. Injected via syringe pump at 0.4 mL / min. -1 PAH solution was injected into the top of the device at a flow rate of 10 min for 10 min, then replaced with deionized water (pH = 9.3) and rinsed at the same flow rate for 10 min. The solution was then injected via a syringe pump at a rate of 0.4 mL / min. -1 PSS solution was injected into the top of the device at a certain flow rate for 10 min, and then the device was cleaned with deionized water at pH 9.3 at the same flow rate for 10 min.

[0116] 8) Continue repeating the PAH and PSS self-assembly process 3.5 times, so that each carbon nanotube surface self-assembles 3.5 layers of polyelectrolyte membrane. All subsequent steps are performed only on the second and third VACNT layers. Prepare deionized water (pH 2.5) with hydrochloric acid, and inject via a syringe pump at 0.4 mL / min. -1 The ammonium was injected into the first groove of the device at a flow rate of 15 min and then soaked in the second and third VACNT layers for 20 min to expose the amino group to the outer layer of the membrane.

[0117] 9) Weigh 10 mg of Biotin-NHS and dissolve it in 6 mL of dimethyl sulfoxide (DMSO) to prepare a 5 mM solution. -1 The solution was injected into the device under the same conditions using a syringe pump for 10 min, and then held at 0.05 mL for 1 min.-1 Let stand for 2 hours. Prepare phosphate buffered saline (PBS) solution by injecting PBS buffer into the solution at a flow rate of 0.4 mL / min using a syringe pump. -1 Clean the device at the specified flow rate for 10 min. Prepare a 6% bovine serum albumin (BSA) solution with PBS buffer and inject it into the device at the same flow rate using a syringe pump for 10 min, then maintain a flow rate of 0.05 mL. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1 Wash the device with PBS at a flow rate of 10 min for 10 min. Prepare 50 μg mL -1 Avidin solution, with 6% BSA as solvent, was administered via a syringe pump at a rate of 0.4 mL / min. -1 The syringe was injected at a flow rate of 10 min, then maintained at 0.05 mL / min at 4°C. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1 The device was washed with PBS at a flow rate of 10 min. 500 μL solutions of 3'-labeled biotin-containing Staphylococcus aureus A protein aptamer and 3'-labeled biotin-containing Staphylococcus aureus enterotoxin A aptamer, each at a concentration of 100 μM, were prepared.

[0118] 10) Dissolve the Staphylococcus aureus A protein aptamer solution in 0.1 mL / min using a syringe pump. -1 The Staphylococcus aureus enterotoxin A aptamer was added dropwise to the second layer of the carbon nanotube array at a controlled rate. The same procedure was followed by adding the aptamer to the third layer of the carbon nanotube array. The mixture was allowed to stand for 30 minutes. Finally, it was injected using a syringe pump at a rate of 0.4 mL / min. -1 Clean the device with PBS at a flow rate of 10 min.

[0119] 11) Use a turbidimeter to incubate the incubator to 10... 9 CFU mL -1 Staphylococcus aureus serially diluted to 10 4 CFU mL -1 It is used as the bacterial solution to be tested.

[0120] 12) Set the device rotation speed to 300 r / min -1 0.4 mL min via syringe pump -1 Staphylococcus aureus was injected into the top of the device at a flow rate until the bacterial volume in the three annular grooves was saturated. 100 μL of the original bacterial solution from the syringe and 100 μL of the test bacterial solution from the first annular groove were then spread onto culture medium. After incubation for 24 hours, the bacterial counts were performed, and the separation efficiency was calculated. Figure 6 The results showed that at 0.4 mL min -1 At a flow rate of 300 rpm, when the device rotation speed reaches 300 rpm -1At concentrations of 82% and above, the device achieves the highest separation efficiency for Staphylococcus aureus, reaching 82%.

[0121] 13) Based on step 11), configure 10 3 CFU mL -1 Staphylococcus aureus, and prepared 10 3 CFU mL -1 A concentration of *E. coli* was used as a control. After each injection, all bacterial culture in the groove was removed, and 1 mL of AuNRs / DTNB / Aptamer solution corresponding to *Staphylococcus aureus* protein A and *Staphylococcus aureus* enterotoxin A was taken and injected via a syringe pump at a rate of 0.1 mL / min. -1 Droplets were added onto the second and third layers of the carbon nanotube array and left to stand for 20 minutes.

[0122] 14) Based on step 13), the device is subjected to 300 r / min. -1 At a certain speed, the solution was dispensed via a syringe pump at a rate of 0.4 mL / min. -1 Excess AuNRs / DTNB / Aptamer in the carbon nanotube array were removed by injecting PBS buffer at a low flow rate. The second layer of the carbon nanotube array was then cut, and the Raman signal was detected under a 785 nm excitation source using a handheld Raman spectrometer. The results were recorded over 10 minutes. 3 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of the control group in step 13) to verify sensitivity and specificity.

[0123] 15) The third layer of carbon nanotube array was cut off, and the Raman signal under a 785nm excitation source was detected using a handheld Raman detector. The results were recorded for 10 minutes. 2 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of all control groups in step 13) to verify sensitivity and specificity.

[0124] Example 5

[0125] 1) Design a pure quartz-based tri-level ring-shaped carbon nanotube device with a height of 12.5 mm, a bottom diameter of 66 mm, and a top platform diameter of 16 mm. Three ring-shaped platforms and three ring-shaped grooves are interspersed along the height. Each ring-shaped platform is 4 mm wide, and each ring-shaped groove has an inner wall radius of 2.5 mm. The radii of the three ring-shaped grooves from top to bottom are 10.5 mm, 19.5 mm, and 28.5 mm, respectively. The radii of the three ring-shaped platforms from top to bottom are 6 mm, 15 mm, and 24 mm, respectively. Design schematics and physical images are shown below. Figure 1 As shown.

[0126] 2) A modified stirring device can provide the quartz instrument with a rotation speed, set to 300 rpm.-1 The pump speed was set to regulate the fluid flow rate, and the injection rate was set to 0.4 mL / min. -1 .

[0127] 3) Carbon nanotube arrays were fabricated on the device using chemical vapor deposition (CVD). 30g of toluene and 1g of ferrocene were weighed as the carbon source and catalyst, respectively, and then sonicated for 15 min. The three grooves of the device were platinum-plated and placed inside a muffle furnace quartz tube. Argon gas was selected as the gas phase, with a flow rate of 0.4 ms. -1 The injection temperature for toluene-ferrocene was set at 105℃, and the injection rate was 6.5 mL / h. -1 Total injection time: 3 hours. Muffle furnace temperature: 740℃, reaction time: 3 hours.

[0128] 4) Prepare seed culture: Dissolve 0.3645g CTAB in 5mL deionized water, then weigh 25μL of 0.1M HAuCl4 and dissolve it in 5mL of deionized water. Mix them together to prepare solution A. Dissolve 3.8mg NaBH4 in 1mL ice water, and take 0.6mL to dilute to 1mL to prepare solution C. Mix solutions B and C and stir rapidly for 2min, then let stand for 0.5h. Then prepare growth medium: Weigh 1.4g CTAB and 0.2468g sodium oleate and dissolve them in 50mL of water. Dissolve and cool at 60℃ to prepare solution A. Weigh 0.0068g AgNO3 and dissolve it in 10mL of water. Take 4.8mL and add it to 50mL of 1mM HAuCl4 to prepare solution D. Mix solutions A and D and let stand for 15min, then stir at 700rpm for 1.5h. Add 0.3 mL of hydrochloric acid and stir slowly for 15 min. Then add 64 mM, 0.25 mL of ascorbic acid solution and stir rapidly for 30 s. Add 0.2 mL of seed solution and stir slowly for 30 s. Let stand in a 30 ℃ water bath for 12 h. Centrifuge at 12000 rpm for 20 min. Repeat twice. Store in a 4 ℃ refrigerator.

[0129] 5) Take 5 mL of gold nanorod suspension and add 15 μL of 0.4 mL solution dissolved in ethanol. -1 The DTNB solution was shaken for 12 hours, centrifuged at 12000 rpm for 20 minutes, the supernatant was discarded, and the same volume of deionized water was added. This process was repeated twice to prepare the AuNRs / DTNB solution.

[0130] 6) Custom-designed Staphylococcus aureus A protein aptamers and Staphylococcus aureus enterotoxin A aptamers with 3'-terminal thiol modifications. Their sequences are as follows:

[0131] 3'ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG5',

[0132] Add 500 μL of 100 μM 3'-terminal thiol-modified Staphylococcus aureus A protein aptamer or 3'-terminal thiol-modified Staphylococcus aureus enterotoxin A aptamer, shake for 6 h, centrifuge at 12000 rpm for 20 min, discard the supernatant, add the same volume of deionized water, repeat twice to prepare AuNRs / DTNB / Aptamer solution, and store at 4 °C.

[0133] 7) Prepare 10mg mL -1 SDBS solution was injected from the top of the device using a syringe pump. The device was secured to a modified stirring device and maintained at 300 rpm. -1 The device is allowed to rotate until all steps are complete. The solution is then allowed to flow uniformly through the three-layer carbon nanotube array under the influence of gravity and centrifugal force. After complete wetting for 5 minutes, the device is immersed in SDBS solution overnight. Deionized water with pH 9.3 is prepared and injected at 0.4 mL / min using a syringe pump. -1 Rinse the device for 10 min at a flow rate of [flow rate missing]. Prepare 1 mg / mL solution. -1 PAH solution and 1 mg / mL -1 PSS solution, pH adjusted to 9.3. Injected via syringe pump at 0.4 mL / min. -1 PAH solution was injected into the top of the device at a flow rate of 10 min for 10 min, then replaced with deionized water (pH = 9.3) and rinsed at the same flow rate for 10 min. The solution was then injected via a syringe pump at a rate of 0.4 mL / min. -1 PSS solution was injected into the top of the device at a certain flow rate for 10 min, and then the device was cleaned with deionized water at pH 9.3 at the same flow rate for 10 min.

[0134] 8) Continue repeating the PAH and PSS self-assembly process 3.5 times, so that each carbon nanotube surface self-assembles 3.5 layers of polyelectrolyte membrane. All subsequent steps are performed only on the second and third VACNT layers. Prepare deionized water (pH 2.5) with hydrochloric acid, and inject via a syringe pump at 0.4 mL / min. -1 The ammonium was injected into the first groove of the device at a flow rate of 15 min and then soaked in the second and third VACNT layers for 20 min to expose the amino group to the outer layer of the membrane.

[0135] 9) Weigh 10 mg of Biotin-NHS and dissolve it in 6 mL of dimethyl sulfoxide (DMSO) to prepare a 5 mM solution. -1 The solution was injected into the device under the same conditions using a syringe pump for 10 min, and then held at 0.05 mL for 1 min.-1 Let stand for 2 hours. Prepare phosphate buffered saline (PBS) solution by injecting PBS buffer into the solution at a flow rate of 0.4 mL / min using a syringe pump. -1 Clean the device at the specified flow rate for 10 min. Prepare a 6% bovine serum albumin (BSA) solution with PBS buffer and inject it into the device at the same flow rate using a syringe pump for 10 min, then maintain a flow rate of 0.05 mL. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1 Wash the device with PBS at a flow rate of 10 min for 10 min. Prepare 50 μg mL -1 Avidin solution, with 6% BSA as solvent, was administered via a syringe pump at a rate of 0.4 mL / min. -1 The syringe was injected at a flow rate of 10 min, then maintained at 0.05 mL / min at 4°C. -1 Let stand for 1 hour. Inject at a flow rate of 0.4 mL / min using a syringe pump. -1 The device was washed with PBS at a flow rate of 10 min. 500 μL solutions of 3'-labeled biotin-containing Staphylococcus aureus A protein aptamer and 3'-labeled biotin-containing Staphylococcus aureus enterotoxin A aptamer, each at a concentration of 100 μM, were prepared.

[0136] 10) Dissolve the Staphylococcus aureus A protein aptamer solution in 0.1 mL / min using a syringe pump. -1 The Staphylococcus aureus enterotoxin A aptamer was added dropwise to the second layer of the carbon nanotube array at a controlled rate. The same procedure was followed by adding the aptamer to the third layer of the carbon nanotube array. The mixture was allowed to stand for 30 minutes. Finally, it was injected using a syringe pump at a rate of 0.4 mL / min. -1 Clean the device with PBS at a flow rate of 10 min.

[0137] 11) Use a turbidimeter to incubate the incubator to 10... 9 CFU mL -1 Staphylococcus aureus serially diluted to 10 4 CFU mL -1 It is used as the bacterial solution to be tested.

[0138] 12) Set the device rotation speed to 300 r / min -1 0.4 mL min via syringe pump -1 Staphylococcus aureus was injected into the top of the device at a flow rate until the bacterial volume in the three annular grooves was saturated. 100 μL of the original bacterial solution from the syringe and 100 μL of the test bacterial solution from the first annular groove were then spread onto culture medium. After incubation for 24 hours, the bacterial counts were performed, and the separation efficiency was calculated. Figure 6 The results showed that at 0.4 mL min -1 At a flow rate of 300 rpm, when the device rotation speed reaches 300 rpm -1At concentrations of 82% and above, the device achieves the highest separation efficiency for Staphylococcus aureus, reaching 82%.

[0139] 13) Based on step 11), configure 10 4 CFU mL -1 Staphylococcus aureus, and prepared 10 4 CFU mL -1 A concentration of *E. coli* was used as a control. After each injection, all bacterial culture in the groove was removed, and 1 mL of AuNRs / DTNB / Aptamer solution corresponding to *Staphylococcus aureus* protein A and *Staphylococcus aureus* enterotoxin A was taken and injected via a syringe pump at a rate of 0.1 mL / min. -1 Droplets were added onto the second and third layers of the carbon nanotube array and left to stand for 20 minutes.

[0140] 14) Based on step 13), the device is subjected to 300 r / min. -1 At a certain speed, the solution was dispensed via a syringe pump at a rate of 0.4 mL / min. -1 Excess AuNRs / DTNB / Aptamer in the carbon nanotube array were removed by injecting PBS buffer at a low flow rate. The second layer of the carbon nanotube array was then cut, and the Raman signal was detected under a 785 nm excitation source using a handheld Raman spectrometer. The results were recorded over 10 minutes. 4 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of the control group in step 13) to verify sensitivity and specificity.

[0141] 15) The third layer of carbon nanotube array was cut off, and the Raman signal under a 785nm excitation source was detected using a handheld Raman detector. The results were recorded for 10 minutes. 2 CFU mL -1 The signal intensity of Staphylococcus aureus was compared with that of all control groups in step 13) to verify sensitivity and specificity.

Claims

1. A method for integrated bacterial isolation and multi-target detection, comprising the following steps: Step 1: Prepare a device for integrated bacterial isolation. The device includes a substrate with multiple platforms and grooves alternately arranged from the center outwards. The height of the multiple platforms gradually decreases from the center outwards, and the height of the multiple grooves gradually decreases from the center outwards. Each platform is provided with a carbon nanotube array. Except for the top platform, the carbon nanotube arrays on the other platforms are modified to bind to bacterial aptamers. Step 2: Configure a Raman-enhanced tag capable of specifically capturing biological targets; the Raman-enhanced tag includes a Raman-enhancing substrate and a Raman signal tag; combine the Raman-enhanced tag and aptamer to prepare a Raman-enhanced tag-aptamer solution; Step 3: Use a turbidimeter to culture to 10 8 CFU mL -1 The bacteria at the above concentrations were diluted, and the diluted solution was used as the test bacterial solution; a mixed bacterial solution without the target bacteria was prepared as a control; the same volume of each group was added to the center of the device in step one by a syringe pump at a uniform rate; after the injection was completed, all bacterial solutions in the groove were removed, and Raman-enhanced tag-aptamer solutions corresponding to different bacterial targets were added to the second and subsequent platforms on the device and allowed to stand. Step 4: Under rotating conditions, inject PBS buffer to remove excess Raman-enhancing tag-aptamers from the carbon nanotube array; extract samples from the second and subsequent layers of the carbon nanotube array, detect the Raman signal under a Raman detector, and identify bacteria or targets.

2. The method for integrated bacterial isolation and multi-target detection as described in claim 1, characterized in that: In step two, take the Raman substrate suspension, add the Raman signal tag solution, mix and react, centrifuge at 5000-20000 rpm for 5-30 min, discard the supernatant, add the same volume of deionized water, repeat twice to prepare the Raman enhanced tag solution.

3. The method for integrated bacterial isolation and multi-target detection as described in claim 2, characterized in that: It also includes adding an aqueous solution of an aptamer that can bind to the Raman-enhancing tag, including 5' or 3' end modified thiol groups and disulfide bonds. After the reaction, the solution is centrifuged at 5000-20000 rpm for 5-30 min, the supernatant is discarded, and the same volume of deionized water is added. This process is repeated twice to prepare the Raman-enhancing tag-aptamer solution.

4. The method for integrated bacterial isolation and multi-target detection as described in claim 1, characterized in that: In step four, the rotation speed is 10-400 r / min.

5. The method for integrated bacterial isolation and multi-target detection as described in claim 1, characterized in that: In step three, the bacterial solution to be tested is injected from the top of the device using a syringe pump; the flow rate is controlled at 0.1-1 mL / min.

Images