An SSR marker for identifying the authenticity of 'Tiny Double You' and Lanzhou lily hybrids and its application

Abstract

This invention discloses an SSR marker for identifying the authenticity of 'Tiny Double You' and Lanzhou lily hybrids and its application. The invention obtains a suitable SSR marker primer pair for identifying the authenticity of offspring through screening. This marker (SSR015) primer pair amplifies a specific band in the hybrid offspring that is identical to the paternal parent. Hybrids exhibiting the paternal-specific band are considered authentic hybrids. The method provided by this invention can quickly and accurately identify the authenticity of 'Tiny Double You' and Lanzhou lily hybrids, featuring short identification time, high accuracy, and strong specificity. It can replace traditional morphological identification methods, effectively improving the efficiency of lily hybrid identification and providing a valid basis for the identification research of hybrids with different parental combinations of lilies, which is beneficial for the genetic improvement of lily varieties.

Description

Technical Field

[0001] This invention belongs to the field of lily hybrid identification technology, and in particular relates to an SSR marker for identifying the authenticity of 'Tiny doubleyou' and Lanzhou lily hybrids and its application. Background Technology

[0002] Lilies (Lilium L.) have important ornamental, medicinal, and edible value. Their elegant flowers and rich colors make them suitable for landscaping and home gardening. The scales are highly edible, rich in nutrients such as starch, protein, calcium, and phosphorus, and can be used to make dried lilies, lily powder, and other dietary supplements. In addition, modern research has found that lilies contain functional components such as steroidal saponins (Munafo and Gianfagna, 2015), alkaloids (Li Hongjuan, 2007; Jiao Haolin, 2014), phenolic substances (Tong Xiaocui, 2008), and flavonoids (Francis et al., 2004), which have the effects of tonifying the middle energizer, nourishing yin and moistening the lungs, relieving cough and asthma.

[0003] Hybrid breeding remains the primary method for selecting new lily varieties. Generally, it takes at least 3-4 years for the F1 generation of lily hybrids to flower from sowing, resulting in a long growth cycle. Therefore, it's difficult to accurately detect the authenticity of lily hybrids in their early stages, affecting the efficiency of hybridization work. Sometimes, the morphological differences between parents and offspring are small, leading to poor reliability, accuracy, and efficiency in morphological identification. With the development of modern molecular biology techniques, molecular marker technologies such as RAPD, AFLP, ISSR, and SSR have been widely applied in the early identification of plant hybrid offspring. Compared to other molecular marker technologies, SSR markers offer good stability, high polymorphism, and ease of use. They are currently widely used in identifying the authenticity and purity of hybrid offspring in plants such as eggplant, tomato, potato, watermelon, lycoris radiata, and ginger lily, as well as constructing genetic maps. Furthermore, EST-SSR markers developed from transcriptome data are more beneficial for research based on plant functional traits. Some studies on lilies have already used SSR markers to identify the authenticity of hybrid offspring. For example, Li Zhuoyi (Breeding of New Ornamental and Edible Lily Varieties [D]. Beijing Forestry University, 2019) successfully identified 15 true hybrids of Lanzhou lily × 'Prunotto', 2 hybrids whose authenticity could not be determined, and 1 false hybrid inferred to be Lanzhou lily using SSR molecular markers. Hu Weirong (Research on Hybrid Breeding of Lilies for Both Ornamental and Edible Use [D]. Beijing Forestry University, 2021) used SSR to identify the authenticity of offspring of 31 Lanzhou lily × 'Teresina' and 69 Lanzhou lily × 'PinkFlavour', finding that 23 offspring of Lanzhou lily × 'Teresina' and 62 offspring of Lanzhou lily × 'PinkFlavour' were true hybrids. However, due to different hybrid parents, primer screening is still needed based on specific combinations. Summary of the Invention

[0004] Purpose of the invention: To overcome the defects and shortcomings of traditional morphological methods for identifying hybrid offspring, this invention provides an SSR marker for identifying the authenticity of 'Tiny Double You' and Lanzhou Lily hybrids and its application. The method of using EST-SSR markers to identify the authenticity of 'Tiny Double You' and Lanzhou Lily F1 hybrids has the advantages of high specificity, rapid identification, and good repeatability. It can screen out true hybrids at an early stage and can replace traditional morphological identification methods, effectively improving the efficiency of hybrid identification.

[0005] Technical solution: To achieve the above-mentioned objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides an SSR marker for identifying the authenticity of 'Tiny double you' and Lanzhou lily hybrids, the SSR marker being amplified by the following primer pair:

[0007] SSR015-F: CCGTCCAGCAAACACCATTG (SEQ ID NO.5);

[0008] SSR015-R: CCCATGATCGCAGGACTCTC (SEQ ID NO. 6).

[0009] Secondly, this invention provides an SSR marker primer pair for identifying the authenticity of 'Tiny double you' and Lanzhou lily hybrids, as shown below:

[0010] SSR015-F: CCGTCCAGCAAACACCATTG (SEQ ID NO.5);

[0011] SSR015-R: CCCATGATCGCAGGACTCTC (SEQ ID NO. 6).

[0012] Thirdly, the present invention provides a kit comprising the aforementioned primer pair.

[0013] Fourthly, this invention provides the application of the aforementioned SSR marker in identifying the authenticity of 'Tiny double you' and Lanzhou lily hybrids.

[0014] Fifthly, the present invention provides the application of the primer pair or the kit described herein in identifying the authenticity of 'Tiny doubleyou' and Lanzhou lily hybrids.

[0015] Sixthly, the present invention provides a method for identifying the authenticity of 'Tiny Double You' and Lanzhou lily hybrids, characterized by comprising the following steps:

[0016] S1. Genomic DNA was extracted from 'Tiny double you' and Lanzhou lily and their F1 hybrids, respectively;

[0017] S2. Using the DNA extracted in step S1 as a template, perform SSR-PCR amplification based on the primer pair described in claim 2, and collect the characteristic peaks of the amplification product;

[0018] S3. Compare the characteristic peaks of the F1 hybrid from step S2 with the characteristic peaks of the parents. If both have the characteristic peaks of the parents, then it is a true hybrid.

[0019] Preferably, in step S2, the optimal system for the PCR amplification reaction is: 20.0 μL containing 17 μL Singke TSE102 Gold Mix Ver.2, and 1 μL each of forward and reverse primers (10 μM·L⁻¹).-1 DNA 1 μL; amplification program: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 56℃ annealing for 10 s, 72℃ extension for 10 s, 35 cycles; 72℃ extension for 5 min, storage at 4℃; detection was performed by capillary electrophoresis using a PCR instrument.

[0020] Preferably, in step S1, young leaves of the parents and interspecific hybrid F1 generation are extracted, and DNA purity is detected by 1.2% agarose gel electrophoresis.

[0021] Preferably, the upstream primer 5' of the primer pair is end-tipped with a FAM fluorescent label.

[0022] This invention develops EST-SSR polymorphic markers from Illumina transcriptome data of lilies and uses them for the authenticity identification of hybrids of 'Tiny Double You' and Lanzhou lily, aiming to determine the characteristics of hybrid offspring at an early stage. It also overcomes the drawbacks of long timelines and high costs associated with field identification, reducing the problem of false hybrids increasing breeding costs. Furthermore, the development of polymorphic molecular markers provides a reference for lily germplasm resource identification and marker-assisted breeding. Using F1 hybrids obtained from 'Tiny Double You' and Lanzhou lily as parents, this invention employs EST-SSR markers to screen characteristic bands, establishing a rapid EST-SSR technology system for identifying the authenticity of F1 hybrids of 'Tiny Double You' and Lanzhou lily, providing a verification method for lily hybrid breeding and shortening the breeding cycle of lily hybrid varieties.

[0023] Beneficial Effects: Compared with existing technologies, this invention utilizes SSR molecular markers to effectively identify hybrids of 'Tiny Double You' and Lanzhou lily, enabling rapid and accurate identification of true F1 hybrids of 'Tiny Double You' and Lanzhou lily. This invention demonstrates that the marker primer SSR015 can effectively distinguish between parents and hybrids, exhibiting characteristic peaks of amplified fragments with good specificity. SSR015 can identify 100% of true hybrids. Compared with traditional morphological observation methods, this invention, using SSR markers, offers high specificity, excellent repeatability, and rapid identification, allowing for the screening of true hybrids at the seedling stage. It can replace traditional morphological hybrid identification methods, effectively improving the efficiency of 'Tiny Double You' and Lanzhou lily hybrid identification and reducing the error rate of traditional morphological identification methods. Attached Figure Description

[0024] Figure 1Images of 'Tiny Double You' and its parent plants, A: 'Tiny Double You' B: Lanzhou Lily.

[0025] Figure 2 Images of hybrid offspring of 'Tiny Double You' and Lanzhou lily.

[0026] Figure 3 This is an electrophoresis gel image of PCR amplification using FAM fluorescent primers.

[0027] Figure 4 Comparison of characteristic peaks of the target product amplified by marker SSR015 in parental 'Tiny double you', Lanzhou lily and some hybrid F1 generation. Detailed Implementation

[0028] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0029] Example 1: SSR tag filtering

[0030] The parent lilies used in this invention are: 'Tiny Double You' purchased from Zhejiang Haining Flower Sea Horticulture Co., Ltd., and Lanzhou lilies collected from Qilihe, Lanzhou, Gansu, which are currently preserved as germplasm resources at the Shanghai Academy of Agricultural Sciences Flower Base. Lanzhou lilies are a variant of the native species *Lilium yunnanense*, with recurved petals, orange petals without spots, large bulbs, and a sweet taste without bitterness; 'Tiny Double You' is a double-flowered Asiatic lily with bowl-shaped orange flowers and sweet bulbs. In 2022, hybridization was carried out using 'Tiny Double You' as the female parent and Lanzhou lilies as the male parent. Embryo culture was conducted 60 days after pollination, and hybrid seedlings were obtained 3 months later.

[0031] The SSR molecular markers used in this invention are derived from three pairs of SSR marker primers (SSR001, SSR007, SSR015) with good amplification polymorphism identified by the applicant's research team in the transcriptome of Lanzhou lily and lily bulb. The specific SSR marker sequences are shown in Table 2.

[0032] Genomic DNA was extracted from the parents and some F1 generation of interspecific hybrids in this example. SSR analysis was performed on a Thermo Cycler ABIPrism 3720XL PCR instrument (Applied Biosystems, Foster City, California, USA). The reaction system (20.0 μL) contained 17 μL Tsingke TSE102 Gold Mix Ver.2 (Beijing Qingke Biotechnology Co., Ltd.), 1 μL each of 10 μM forward and reverse primers, and 40 ng / μL... -1 Template DNA 1 μL. Amplification program: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 56℃ annealing for 10 s, 72℃ extension for 10 s, 35 cycles; 72℃ extension for 5 min, store at 4℃. SSR-PCR products were analyzed by capillary electrophoresis.

[0033] After screening and analysis, after amplification using the above three pairs of SSR marker primers, the bands of the three markers showed obvious polymorphism among the parents (Table 1). According to the screening results of the primers in the eight progeny generations (Table 2), SSR001 did not identify any paternal-specific amplification bands in the progeny; SSR007 identified paternal-specific bands in only three of the eight progeny generations (progeny 2, progeny 6, and progeny 7); in marker SSR015, 'Tiny double you' had characteristic peaks at 310.84bp and 312.95bp, while Lanzhou lily had characteristic peaks at 315.22bp and 316.03bp. The bands amplified by the progeny all had characteristic peaks of the paternal parent Lanzhou lily, which could well distinguish the parents from the hybrid and showed obvious polymorphism. Therefore, this invention selected marker SSR015 as the primer for identifying the authenticity of the F1 hybrid of 'Tiny double you' and Lanzhou lily. The primers and sequences used in this invention are shown in Table 2.

[0034] Table 1. Characteristic peak statistics of 'Tiny doubleyou' and Lanzhou lily.

[0035]

[0036]

[0037] Table 2 Primer sequences of the SSR marker SSR015 of the present invention.

[0038]

[0039] Table 33 shows the screening results for polymorphic SSR markers.

[0040]

[0041] Example 2: Identification of the authenticity of 'Tiny double you' and Lanzhou lily F1 hybrids based on SSR markers

[0042] 1. Extraction of genomic DNA

[0043] Fresh, young leaves were collected from the parent plants and F1 hybrids used in Example 1. Genomic DNA was extracted using the TSINGKE Plant DNA Extraction Kit (General Type), following the instructions. The extracted genomic DNA was then analyzed by 1.2% agarose gel electrophoresis. The electrophoretic bands were clear, without diffusion or tailing, and were suitable for subsequent SSR-PCR reactions.

[0044] 2. SSR capillary electrophoresis analysis

[0045] The 5' end of the primer labeled SSR015 obtained in Example 1 was inserted into the FAM fluorescent label, which was synthesized by Beijing Qingke Biotechnology Co., Ltd., and SSR-PCR amplification was performed. The amplification conditions and procedures were the same as in Example 1.

[0046] The amplified PCR products were first subjected to agarose gel electrophoresis (2 μL sample + 6 μL bromophenol blue) at 300 V for 12 minutes to obtain the gel image. Figure 3 The gel image is a PCR amplification electrophoresis gel image of FAM fluorescent primers. The template concentration is determined by the gel image and diluted with water to the concentration required for capillary electrophoresis.

[0047] The amplified products that showed good detection results by agarose gel electrophoresis were analyzed on a Thermo Cycler ABI Prism3720XL gene analyzer.

[0048] 3. Comparison of characteristic peaks

[0049] The characteristic peaks of the SSR markers of the F1 hybrid detected in the above steps were compared with the characteristic peaks of the parents 'Tiny double you' and Lanzhou lily to determine the authenticity of the hybrid.

[0050] The results of comparing the characteristic peaks of the target product amplified by marker SSR015 from the parental 'Tiny double you', Lanzhou lily, and some hybrid F1 generations are as follows: Figure 4 As shown in the figure, offspring exhibiting characteristic peaks of both parents are true hybrids. Table 4 shows the results of authenticity identification comparing 'Tiny Double You', Lanzhou lily, and 30 F1 hybrids. In SSR015, all 30 (100%) F1 hybrids simultaneously exhibited characteristic peaks of both parents, demonstrating high identification efficiency.

[0051] Table 4 shows the results of the identification of the authenticity of 30 F1 generation hybrids using the SSR015 marker.

[0052] Table 4 shows the results of the identification of the authenticity of 30 F1 generation hybrids using the SSR015 marker.

[0053]

[0054] Comparative Example

[0055] The SSR molecular markers used were derived from the polymorphic SSR marker primer IVFLMRE141 reported in previous studies (reference: Yuan S, Ge L, Liu C, Ming J (2013) The development of EST-SSR markers in Liliumregale and their cross-amplifcation in related species. Euphaitica 189:393-419). The authenticity of the 'Tiny double you' and Lanzhou lily F1 hybrids was determined. The specific SSR marker sequences are shown in the table below.

[0056]

[0057] Genomic DNA was extracted from the parents and some interspecific hybrid F1 generations in this embodiment, using the same method and amplification procedure as above.

[0058] After screening and analysis, the parents of the primer IVFLMRE141 showed significantly different bands (Table 5), making it suitable for the authenticity identification of the hybrid offspring of 'Tiny Double You' × Lanzhou lily.

[0059] Based on the screening results of primer IVFLMRE141 in 30 progeny generations (Table 5), it was shown that 'Tiny double you' had characteristic peaks at 159bp and 165bp, while Lanzhou lily had a characteristic peak at 166bp. The amplified bands from the progeny all showed characteristic peaks of the paternal parent, Lanzhou lily. Seventeen progeny generations simultaneously amplified specific bands from both the maternal and paternal parents, thus confirming them as true hybrids. Thirteen progeny generations only amplified specific bands from the maternal parent, failing to amplify specific bands from the paternal parent, making it impossible to determine whether they were true hybrids. The true hybrid identification rate was 56.67%.

[0060] Table 5 shows the amplification results of primer IVFLMRE141 on the parents and hybrid offspring.

[0061]

[0062]

[0063] In summary, the method for identifying the authenticity of hybrid F1 generations using SSR molecular markers has the following advantages:

[0064] The SSR markers screened by this invention can save time and space while identifying the authenticity of hybrids, and have high accuracy. The authenticity of hybrid offspring can be identified at the seedling stage, which is conducive to accelerating the genetic improvement process of lily varieties that are suitable for both ornamental and edible purposes.

[0065] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, simplifications, etc., made without departing from the essence and principle of the present invention are equivalent substitutions and are included within the protection scope of the present invention.

Claims

1. An SSR marker for identifying the authenticity of 'Tiny Double You' and Lanzhou lily hybrids, characterized in that, The SSR marker was amplified using the following primer pair: SSR015-F: CCGTCCAGCAAACACCATTG (SEQ ID NO.5); SSR015-R: CCCATGATCGCAGGACTCTC (SEQ ID NO. 6).

2. An SSR marker primer pair for identifying the authenticity of 'Tiny Double You' and Lanzhou lily hybrids, characterized in that, The primer pairs are shown below: SSR015-F: CCGTCCAGCAAACACCATTG (SEQ ID NO.5); SSR015-R: CCCATGATCGCAGGACTCTC (SEQ ID NO. 6).

3. A reagent kit, characterized in that, The kit includes the primer pair as described in claim 2.

4. The application of the SSR marker as described in claim 1 in identifying the authenticity of 'Tiny double you' and Lanzhou lily hybrids.

5. The application of the primer pair of claim 2 or the kit of claim 3 in identifying the authenticity of 'Tiny double you' and Lanzhou lily hybrids.

6. A method for identifying the authenticity of 'Tiny Double You' and Lanzhou lily hybrids, characterized in that, Includes the following steps: S1. Genomic DNA was extracted from 'Tiny double you' and Lanzhou lily and their F1 hybrids, respectively; S2. Using the DNA extracted in step S1 as a template, perform SSR-PCR amplification based on the primer pair described in claim 2, and collect the characteristic peaks of the amplification products; S3. Compare the characteristic peaks of the F1 hybrid from step S2 with the characteristic peaks of the parents. If both have the characteristic peaks of the parents, then it is a true hybrid.

7. The method for identifying the authenticity of 'Tiny Double You' and Lanzhou lily hybrids according to claim 6, characterized in that, In step S2, the optimal system for the PCR amplification reaction is: 20.0 µL contains 17 µL of TsingkeTSE102 Gold Mix Ver.2, 1 µL of 10 µM forward primer, 1 µL of 10 µM reverse primer, and 40 ng·µL -1 Template DNA 1µL; amplification program: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 56℃ annealing for 10 s, 72℃ extension for 10 s, 35 cycles; 72℃ extension for 5 min, storage at 4℃; detection was performed by capillary electrophoresis using a PCR instrument.

Images