Collagen type iii production promoters and anti-aging cosmetic
By combining isostearyl ascorbate phosphate and hydrolyzed eggshell membrane components, a nano-encapsulated formulation is formed, which solves the problems of unstable ingredients and strong skin irritation in existing anti-wrinkle cosmetics, and achieves significant effects in type III collagen production and anti-aging.
Patent Information
- Application Number
- CN202180079784.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-11-30
- Filing Date
- 2021-11-24
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2041-11-24
AI Technical Summary
The ingredients used in existing anti-wrinkle cosmetics, such as retinol, retinoic acid derivatives, and ascorbic acid, are highly irritating and unstable to the skin, making it difficult to effectively promote the production of type III collagen, resulting in insignificant anti-aging effects.
Isostearyl ascorbate phosphate or its metal salt is combined with hydrolyzed eggshell membrane components to form a synergistic type III collagen production promoter, and skin permeability is improved by nano-sized microparticle encapsulation formulation.
Significantly improves wrinkles and sagging caused by aging, provides a safe and effective boost to type III collagen production, and enhances the practicality of anti-aging cosmetics.
Smart Images

Figure CN116600782B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a type III collagen production promoter obtained using a prescribed ascorbic acid derivative and eggshell membrane component, and an anti-aging cosmetic containing the type III collagen production promoter. BACKGROUND
[0002] Skin is often exposed to the outside world, and with age, wrinkles, sagging, dullness, pigmentation, and other signs of aging occur. Among these, changes in the appearance of the skin such as wrinkles and sagging are considered to be greatly influenced by collagen, which accounts for more than 90% of the dermal matrix.
[0003] The amount of dermal collagen decreases with age, and the formation of the dermal structure becomes incomplete due to the decrease in collagen, and thus the skin ages. In addition, the collagen amount of so-called "photoaged skin" is also known to be significantly decreased compared to normal skin, and is one of the important factors of wrinkles and sagging.
[0004] It is considered that collagen, particularly type III collagen, has a role in imparting softness, and it is known that the amount of type III collagen present is extremely high in the dermal tissue of infants compared to that of adults, and there is a tendency for the amount to rapidly decrease with age.
[0005] In addition, it is also known that in the clinical symptoms of Ehlers-Danlos syndrome, which is caused by incomplete synthesis of type III collagen, i.e., abnormal collagen fiber formation mechanism, as a result of aging, symptoms in which wrinkles in the skin are apparent are seen.
[0006] However, as an effective ingredient of a medicament or anti-wrinkle cosmetic for preventing changes in the appearance of the skin due to aging, retinol and retinoic acid derivatives have been used, and their collagen production-promoting effects are known.
[0007] However, the conventional anti-wrinkle cosmetics containing such effective ingredients have the disadvantages that the skin irritation is strong, and the effective ingredients are very unstable substances.
[0008] In addition, ascorbic acid is known as an effective ingredient having a collagen production-promoting effect in addition to the above-mentioned effective ingredients, but since the skin permeability of this substance is not sufficient, and it is very unstable to heat and oxidation, it is easily inactivated or decomposed before or during use, and thus a sufficient physiological effect is not always obtained.
[0009] In order to improve the skin permeability of ascorbic acid, a collagen production promoter composed of an ascorbic acid derivative in which the phosphate moiety is composed of L-ascorbic acid-2-phosphate having a branched alkyl group or a salt thereof is known (Patent Document 1).
[0010] In addition, as a derivative for improving the instability of ascorbic acid, a glycoside derivative is known (Patent Document 2).
[0011] On the other hand, as a material effective for collagen production or wrinkle improvement, an eggshell membrane is known.
[0012] The eggshell membrane is a membrane on the inside of an eggshell of a bird such as a chicken, and is composed of two layers of an outer eggshell membrane and an inner eggshell membrane. The outer eggshell membrane is attached to the inner surface of the eggshell, and the inner eggshell membrane covers egg white, and protects a developing embryo from infection by antibacterial properties.
[0013] The eggshell membrane has a mesh structure composed of strong fibrous proteins such as collagen, glucosamine, laminin, and hyaluronic acid as main components. These proteins are relatively stable to acid, alkali, and protease, and are not soluble in water.
[0014] In addition, a collagen production promoter containing an eggshell membrane and collagen (Patent Document 3), a wrinkle improvement composition characterized by promoting the production of type III collagen containing a hydrolyzed eggshell membrane component (Patent Document 4), and a cosmetic liquid (Patent Document 5) are known.
[0015] Prior Art Documents
[0016] Patent Documents
[0017] Patent Document 1: Japanese Patent Application Laid-Open (JP-A) No. 2008-94750
[0018] Patent Document 2: Japanese Patent Application Laid-Open (JP-A) No. 03-139288
[0019] Patent Document 3: Japanese Patent Application Laid-Open (JP-A) No. 2012-153614
[0020] Patent Document 4: Japanese Patent Application Laid-Open (JP-A) No. 2018-188405
[0021] Patent Document 5: Japanese Patent Application Laid-Open (JP-A) No. 2019-137634 SUMMARY
[0022] However, the ascorbic acid derivatives described in the above Patent Documents 1 and 2 and the eggshell membranes described in Patent Documents 3 to 5 are used only individually, and at most are used only in combination with general vitamin C.
[0023] Therefore, a type III collagen production promoter and an anti-aging cosmetic having a sufficient effect on the aging phenomenon of skin tissue caused by aging are not known.
[0024] Therefore, an object of the present application is to provide a safe, excellent collagen type III production promoter which has no skin irritation and can effectively promote the production of collagen type III, a component of collagen fibers, and an anti-aging cosmetic which, in combination with the collagen type III production promoter, has a remarkably improved effect on wrinkles and slackening, which are skin aging phenomena caused by aging.
[0025] The inventors of the present application have verified synergistic effects of components known to have collagen type III production promoting effects, and as a result, have found that a mixed composition containing ascorbyl phosphoric acid isostearyl ester or a metal salt thereof and a hydrolyzed eggshell membrane component exerts an excellent synergistic effect of promoting the production of collagen type III, and have further found that a capsulated preparation in which the mixed composition is used as a capsule shell component and an oil-soluble component is enclosed exerts a more excellent effect than the above-mentioned mixed composition. In addition, an excellent effect of improving aging phenomena caused by aging, including wrinkles and slackening, has been found in an anti-aging cosmetic containing the mixed composition or the capsulated preparation of the present application, and thus the present application has been completed.
[0026] That is, the present application has been made to solve the above-mentioned problems, and a collagen type III production promoter composed of a composition containing ascorbyl phosphoric acid isostearyl ester or a metal salt thereof (ascorbyl phosphoric acid isostearyl ester metal salt) and a hydrolyzed eggshell membrane component as water-soluble components represented by the formula of Chemical Formula 1 below.
[0027] [Chemical Formula 1]
[0028]
[0029] (wherein M in the formula is a hydrogen atom or a monovalent metal ion.)
[0030] The collagen type III production promoter composed of the above-mentioned composition exerts a synergistic effect of more than the sum by combining ascorbyl phosphoric acid isostearyl ester or a metal salt thereof (ascorbyl phosphoric acid isostearyl ester metal salt) and a hydrolyzed eggshell membrane component as water-soluble components represented by the formula of Chemical Formula 1, and thus has a remarkably improved effect on wrinkles and slackening, which are skin aging phenomena caused by aging, compared to the case where each component is used alone.
[0031] In order to exert such a desired synergistic effect, the ratio of (ascorbyl phosphoric acid isostearyl ester or a metal salt thereof) / hydrolyzed eggshell membrane component in the above-mentioned composition is preferably 1 / 1 to 1 / 8 in terms of mass ratio.
[0032] In addition, since the above-mentioned collagen type III production promoter is more excellent in effect by using a dosage form of a microcapsule preparation of nano size, it is preferred that the collagen type III production promoter is constituted of a microcapsule preparation in which the above-mentioned composition is used as a component of a microcapsule and an oil-soluble component is encapsulated in the above-mentioned microcapsule.
[0033] In addition, by producing an anti-aging cosmetic containing the collagen type III production promoter thus obtained as an effective component, the practicality of anti-aging is improved, and the improvement effect of wrinkles and slackening is sufficiently obtained.
[0034] The collagen type III production promoter of the present application is constituted of a composition in which the isostearyl ascorbyl phosphate represented by the above-mentioned formula 1 or a metal salt thereof and a hydrolyzed eggshell membrane component are mixed as water-soluble components, and thus is a safe and excellent collagen type III production promoter which has no irritation to the skin and can effectively promote the production of the amount of collagen type III which is a component of collagen fibers. Furthermore, the anti-aging cosmetic in which the collagen type III production promoter is incorporated has the advantage of having a remarkable improvement effect on wrinkles and slackening which are skin aging phenomena caused by aging. BRIEF DESCRIPTION OF DRAWINGS
[0035] Figure 1 is a graph showing the relative ratio of the collagen type III production promotion effect of Examples 1 and 2 and Comparative Examples 1 and 2 to the control.
[0036] Figure 2 is a graph showing the relative ratio of the collagen type III production promotion effect of Examples 2 to 5 to the control. DETAILED DESCRIPTION
[0037] The embodiment of the collagen type III production promoter of the present application is constituted of a composition in which the isostearyl ascorbyl phosphate represented by the above-mentioned formula 1 or a metal salt thereof and a hydrolyzed eggshell membrane component are mixed as water-soluble components.
[0038] In addition, a microcapsule preparation in which the above-mentioned mixed composition is used as a component of a capsule shell and an oil-soluble component is encapsulated is another embodiment, and furthermore, an anti-aging cosmetic containing these collagen type III production promoters as effective components is also described later as another embodiment.
[0039] The isostearyl ascorbyl phosphate or metal salt thereof (isostearyl ascorbyl phosphate 2 metal salt) used in the present application is L-ascorbic acid-2-phosphate having a branched alkyl group in the phosphate group, which has a proper liposolubility and is easily taken into cells, and at this time is rapidly decomposed into L-ascorbic acid and phospholipids or the like by phosphatases widely distributed in the organism, and has an excellent collagen type III production promoting effect in fibroblasts of the skin.
[0040] As a specific example of the isostearyl ascorbyl phosphate metal salt, the isostearyl ascorbyl phosphate disodium salt represented by the structural formula of Chemical Formula 2 below can be given, and as other alkali metal salts, potassium salts or the like can also be given.
[0041] [Chemical Formula 2]
[0042]
[0043] The hydrolyzed eggshell membrane component used in the present application can be prepared by a known hydrolysis method in which an eggshell membrane or a powder containing the eggshell membrane is subjected to hydrolysis of proteins into peptides, oligopeptides, amino acids as needed, using a solution containing an acid, a base, an alkaline organic solvent, and a protein-decomposing enzyme, and has high affinity with the skin due to solubility in an aqueous phase and an oil phase, and also has good adhesion with skin cells, and even alone exhibits a certain degree of collagen type III production promoting effect.
[0044] The hydrolyzed eggshell membrane component used in the present application can use a hydrolyzed eggshell membrane component manufactured by any of the above methods. In addition, an extract extracted from a hydrolyzed eggshell membrane using an alcohol, an aqueous solvent, or the like is often used in a powder form obtained by a drying method such as freeze-drying, and in order to be used in the present application, can also be used as a liquid material dissolved in a solvent such as water, butylene glycol, or the like. In addition, commercially available hydrolyzed eggshell membrane components as described in Patent Documents 4 and 5 are known.
[0045] As a composition example of the collagen type III production promoter of the present application, the isostearyl ascorbyl phosphate or metal salt thereof (isostearyl ascorbyl phosphate disodium salt) 1 to 10 mass% and the hydrolyzed eggshell membrane component 1 to 10 mass% can be mixed and stirred with an aqueous solvent such as a glycerol aqueous solution, and an oily component 1 to 30 mass% can be added thereto as needed, and a homogeneous composition can be prepared by dispersing and emulsifying using a homogenizer.
[0046] Further, by subjecting the obtained homogeneous composition to micronization using a general micronization device such as a film rotation type high-speed mixer, a high-pressure emulsifier, or the like, a nanoparticle encapsulated preparation having excellent skin permeability can be manufactured.
[0047] In addition, the collagen type III production promoter of the present application has a collagen type III production promoting function as confirmed by the evaluation test of the examples described later, and is useful as a collagen type III production promoter.
[0048] The collagen type III production promoter of the present application can be used as an effective ingredient in cosmetics, and can also be used in combination with other skin external agents, and has a function of promoting the production of collagen type III in fibroblasts, and has an anti-aging effect such as an improvement effect on wrinkles and sagging caused by aging, and the like, and can be used in the production of an anti-aging skin external agent or the like.
[0049] When the collagen type III production promoter of the present application is used in an anti-aging cosmetic, one or more kinds of the collagen type III production promoters can be used in combination, and the amount of the combination is preferably 0.05% by mass or more, for example, 0.05 to 80% by mass, and more preferably 0.5 to 50% by mass, based on the total amount of the anti-aging cosmetic, and the efficiency of the combination is also good.
[0050] In addition, the components known to be safe can be used in an excessive amount without any problem in safety, and can be used in a cosmetic at a concentration that does not cause skin irritation and does not impair the practicality.
[0051] In the anti-aging cosmetic of the present application, in addition to the above-mentioned essential components, various components used in general cosmetics, quasi-drugs, drugs, and the like, such as an oily component, an emulsifier, a humectant, a viscosity increasing agent, a pharmaceutical ingredient, a preservative, a pigment, a powder, a pH adjustor, an ultraviolet absorber, an antioxidant, a perfume, and the like, can be appropriately used in combination.
[0052] As the above-mentioned oily component, liquid paraffin, vaseline, microcrystalline wax, squalane, jojoba oil, beeswax, carnauba wax, lanolin, olive oil, coconut oil, higher alcohols, esters of higher alcohols and fatty acids, silicone oil, and the like can be used.
[0053] As the above-mentioned emulsifier, for example, nonionic surfactants such as polyoxyethylene alkyl ether, polyoxyethylene fatty acid ester, polyoxyethylene sorbitan fatty acid ester, sorbitan fatty acid ester, glycerin fatty acid ester, polyglycerin fatty acid ester, and polyoxyethylene hydrogenated castor oil; anionic surfactants such as sodium stearoyl lactate; amphoteric surfactants such as soybean phospholipid; and cationic surfactants such as alkyltrimethylammonium chloride can be used.
[0054] As the above-mentioned humectant, for example, glycerin, sorbitol, xylitol, maltitol, propylene glycol, polyethylene glycol, 1,3-butanediol, 1,2-pentanediol, and the like can be used.
[0055] As the above tackifier, for example, carboxyvinyl polymer, (acrylate / alkyl acrylate) cross-linked polymer, xanthan gum, methyl cellulose, polyvinyl pyrrolidone, gelatin, clay mineral such as bentonite, and the like can be mentioned.
[0056] As other pharmaceutical ingredients, for example, various vitamins and derivatives thereof, allantoin, glycyrrhizic acid and derivatives thereof, anti-aging agents such as various animal and plant extracts, moisturizing agents, hair growth agents, hair restorers, transdermal absorption promoters, ultraviolet absorbers, cell activators, anti-inflammatory agents, whitening agents, antiseptic and mold-proof agents.
[0057] The anti-aging cosmetic containing the type III collagen production promoter of the present application, except for compounding the above mixed composition or encapsulated preparation as the type III collagen production promoting effective ingredient, is not particularly limited in the manufacturing conditions, and can be prepared by using the publicly known cosmetic manufacturing method.
[0058] Further, the use of the type III collagen production promoter of the present application is not limited by the laws, social environments, and the like in the country and abroad, and can be applied to quasi-drugs, external medical products, and the like, and the dosage form of the cosmetic can be selected according to the purpose, for example, cream-like, emulsion-like, liquid-like, gel-like, ointment-like, pack-like, stick-like, powder-like, and the like can be adopted.
[0059] Example
[0060] [Example 1]
[0061] A composition of Example 1 of the type III collagen production promoter was obtained by mixing and stirring 99.65 mass% of a mixed solution of isostearyl alcohol ascorbic acid phosphoric acid disodium salt (compound represented by the structural formula of the above Chemical Formula 2, the same hereinafter) 0.25 mass%, commercially available hydrolyzed eggshell membrane component (substance obtained by hydrolyzing the protein of eggshell membrane with alkali) 0.1 mass%, and glycerin / water 20 / 1 (mass ratio).
[0062] [Comparative Examples 1 and 2]
[0063] Comparative Example 1 was obtained by mixing and stirring 99.75 mass% of a mixed solution of isostearyl alcohol ascorbic acid phosphoric acid disodium salt 0.25 mass%, and glycerin / water 20 / 1 (mass ratio).
[0064] Further, Comparative Example 2 was obtained by mixing and stirring 99.9 mass% of a mixed solution of commercially available hydrolyzed eggshell membrane component (substance obtained by hydrolyzing the protein of eggshell membrane with alkali) 0.1 mass%, and glycerin / water 20 / 1 (mass ratio).
[0065] For the obtained Examples 1, Comparative Examples 1-2, to investigate the collagen type III production ability, a test was performed as follows, and the results thereof are shown in Figure 1 .
[0066] <Assessment Test of Synergistic Effect of Collagen Type III Production Ability Based on Fibroblast of Example 1, Comparative Examples 1-2>
[0067] For the fibroblast, DMEM containing 5% fetal bovine serum (FBS) was used, and exchange was performed with DMEM containing 0.5% FBS using a 96-well plate. After culturing for 72 hours with the sample-containing medium, after culturing for 24 hours, total RNA was extracted using Nucleospin RNA Plus (Machery-Nagel GmbH & Co. KG).
[0068] Reverse transcription was performed on the total RNA using Prime Script RT RCR Kit (manufactured by Takara Bio, Inc.), and cDNA was synthesized. Using the obtained cDNA as a template, the expression amount of tropoelastin, GAPDH was measured using real-time PCR (7500 Real-Time PCR System, manufactured by Applied Biosystems) using the following primers and enzymes.
[0069] The primer used Col3a1 (forward primer: TCCCCTGAGAATCTGTGTGAATC, reverse primer: TGAGTCGAATTGGGGQATGT). The reaction of PCR used SYBR Select Master Mix (manufactured by Applied Biosystems), and the analysis of gene expression was performed using the comparative Ct method.
[0070] <Results of Test>
[0071] According to the results shown in Figure 1 It was also shown that the mixture of isostearyl alcohol ascorbic acid phosphate disodium salt and the hydrolyzed eggshell membrane component exhibited a significantly high collagen type III production promotion effect compared to the case where nothing was added (control), and Examples 1, Comparative Examples 1, 2.
[0072] Furthermore, the collagen type III production promotion effect of Example 1 exhibited an effect higher than the sum of the promotion effects of Comparative Example 1 in which only isostearyl alcohol ascorbic acid phosphate disodium salt was combined, and Comparative Example 2 in which only the hydrolyzed eggshell membrane component was combined.
[0073] In summary, it was shown that Example 1 in which isostearyl alcohol ascorbic acid phosphate disodium salt and the hydrolyzed eggshell membrane component were combined exhibited a synergistic effect in the collagen type III production promotion effect.
[0074] [Examples 2, 3]
[0075] The isostearyl alcohol ascorbic acid dipotassium phosphate salt 1.0 mass%, a commercially available hydrolyzed eggshell membrane component (a substance obtained by hydrolyzing the protein of an eggshell membrane with an alkali) 4.0 mass%, and a mixed solution of glycerin / water = 20 / 1 (mass ratio) 70.0 mass% were mixed, and 25.0 mass% of isostearyl alcohol was added thereto, and dispersed and emulsified using a homogenizer, whereby a type III collagen production promoter of Example 2 composed of the mixed composition A was obtained.
[0076] In addition, the type III collagen production promoter of Example 2 was micronized using a thin film rotating type high-speed mixer, whereby a type III collagen production promoter of Example 3 composed of a microcapsule preparation A was obtained.
[0077] For the obtained Examples 2, 3, the particle diameter was measured using a laser diffraction / scattering type particle size distribution measuring device (HORIBA: LA-950), and as a result, the average particle diameter of Example 2 was 14.87 μm, and the average particle diameter of Example 3 as the microcapsule preparation A was 228 nm.
[0078] [Examples 4, 5]
[0079] The isostearyl alcohol ascorbic acid dipotassium phosphate salt 1.0 mass%, a commercially available hydrolyzed eggshell membrane component (a substance obtained by hydrolyzing the protein of an eggshell membrane with an alkali) 8.0 mass%, and a mixed solution of glycerin / water = 10 / 1 (mass ratio) 70.0 mass% were mixed, and 22.0 mass% of isostearyl alcohol was added thereto, and dispersed and emulsified using a homogenizer, whereby a type III collagen production promoter of Example 4 composed of the mixed composition B was obtained.
[0080] In addition, the type III collagen production promoter of Example 4 was micronized using a high-pressure emulsifier, whereby a type III collagen production promoter of Example 5 composed of a microcapsule preparation B was obtained.
[0081] For the obtained Examples 4, 5, the particle diameter was measured using a laser diffraction / scattering type particle size distribution measuring device (HORIBA: LA-950), and as a result, the average particle diameter of Example 4 was 8.77 μm, and the average particle diameter of Example 5 as the microcapsule preparation B was 128 nm.
[0082] For the obtained Examples 2 to 5 as described above, in order to investigate the type III collagen production ability, a test was performed as follows, and the results thereof are shown in Table 1. Figure 2 .
[0083] < Type III Collagen Production Promoter (Examples 2 to 5) Fibroblast-based Type III Collagen Production Ability Evaluation >
[0084] The test was performed in the same manner as the test for evaluating synergistic effects on the collagen type III production ability of Examples 1, Comparative Examples 1 to 2, and the collagen type III production promoting effects of Examples 2 to 5 were measured.
[0085] <Results of Test>
[0086] According to the results shown in Table 1, it was found that the mixture of Example 2 (mixed composition A), Example 3 (microparticulate encapsulated preparation A), Example 4 (mixed composition B), and Example 5 (microparticulate encapsulated preparation B) exhibited significantly higher collagen type III production promoting effects than the case where nothing was added (control). Figure 2
[0087] Furthermore, with respect to the collagen type III production promoting effects, Example 3 (microparticulate encapsulated preparation A) was higher than Example 2 (mixed composition A), and microparticulate encapsulated preparation B was higher than mixed composition B, thus indicating that the skin permeability was improved by performing microparticulate encapsulation, and the collagen type III production promoting effects were improved.
[0088] [Examples 6 to 17, Comparative Examples 3 to 5]
[0089] A cosmetic composition (cosmetic water) containing a collagen type III production promoter was prepared in accordance with the compounding proportions (total 100% by weight) shown in Table 1 (Examples 6 to 17), and Comparative Example 3 in which only ascorbic acid phosphoric acid disodium salt of isostearyl alcohol was compounded as the collagen type III production component, or Comparative Example 4 in which only a hydrolyzed eggshell membrane component was compounded, or Comparative Example 5 in which neither of these was compounded.
[0090] The following test was performed on these Examples 6 to 17, Comparative Examples 3 to 5, and the anti-aging effects on humans were evaluated.
[0091] <Anti-aging Effects on Humans>
[0092] Twenty subjects who had concerns about skin aging due to aging were grouped, and the cosmetic products of Examples 6 to 17, Comparative Examples 3 to 5 were applied every morning and evening for 3 months, and after 3 months, the cumulative application effects were self-evaluated in accordance with the following evaluation criteria, and the evaluation results were evaluated in accordance with the following criteria, and the results were collectively recorded in Table 1.
[0093] [Evaluation]
[0094] ◎: The proportion (efficiency) of subjects exhibiting significant effectiveness and effectiveness was 80% or more.
[0095] O: The proportion (efficiency) of subjects exhibiting significant effectiveness and effectiveness was 60% or more and less than 80%.
[0096] Δ: The ratio (efficacy rate) of subjects showing remarkable efficacy or efficacy is 40% or more and less than 60%.
[0097] X: The ratio (efficacy rate) of subjects showing remarkable efficacy or efficacy is less than 40%.
[0098] The criteria for efficacy are as follows.
[0099] Remarkable efficacy: Wrinkles and slackness become almost unnoticeable.
[0100] Efficacy: Wrinkles and slackness become a little unnoticeable.
[0101] Slight efficacy: Wrinkles and slackness become slightly unnoticeable.
[0102] No efficacy: No change.
[0103] [Table 1]
[0104]
[0105] It is also shown from the results shown in Table 1 that the cosmetic (dermal preparation) of Examples 6 to 17, which contains the type III collagen production promoter as an effective ingredient, is useful for the type III collagen production promotion of fibroblasts of the skin, and is useful as an anti-aging cosmetic having a function of an anti-aging effect such as improvement of wrinkles and slackness due to enrichment of the amount of type III collagen.
[0106] Hereinafter, representative formulation examples of cosmetics are shown as Examples containing a prescribed type III collagen production promoter as an effective ingredient. The numerical values at the right end of each line are the compounding ratios (wt%). Note that the resulting cosmetic formulation examples are anti-aging cosmetics containing the type III collagen production promoter as an effective ingredient and having an anti-aging effect such as improvement of wrinkles and slackness.
[0107] [Formulation Example 1] (Gel cream)
[0108]
[0109] [Formulation Example 2] (Emulsion)
[0110]
[0111] [Formulation Example 3] (Cream)
[0112]
[0113]
Claims
1. A collagen type III production promoter, which is constituted by a composition containing isostearyl ascorbyl phosphate or a metal salt thereof represented by the following formula 1 and a hydrolyzed eggshell membrane component as water-soluble components, the ratio of (isostearyl ascorbyl phosphate or a metal salt thereof) / the hydrolyzed eggshell membrane component in the composition is 1 / 1 to 1 / 8 in terms of mass ratio, [Chemical Formula 1] ###0001### wherein M in the formula is a hydrogen atom or a monovalent metal ion.
2. The type III collagen production promoter according to claim 1, wherein which is constituted by a microparticulate encapsulated preparation that is constituted by the composition as a constituent component of microparticulate capsules and has an oil-soluble component encapsulated in the microparticulate capsules.
3. An anti-aging cosmetic containing the collagen type III production promoter described in claim 1 or 2 as an effective component.
Citation Information
Patent Citations
Alpha-glycosyl-l-ascorbic acid, its production and use thereof
JP1991139288A
Collagen production promoter and Anti-aging cosmetic
JP2008094750A
Collagen production promoter
JP2012153614A
Composition for improving wrinkles containing hydrolyzed eggshell membrane component
JP2018188405A
Cosmetic liquid containing hydrolyzed eggshell membrane component
JP2019137634A