A method for constructing a multiplex visual nucleic acid detection system and a detection strip
By combining LAMP and LFD technologies with a multi-visual nucleic acid detection system, specific primers and assimilation probes are designed to achieve dual-visual detection of UU and MH, solving the problems of long detection time and expensive equipment in existing technologies, and providing a fast, simple and highly sensitive detection solution.
Patent Information
- Application Number
- CN202310395790.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-13
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2043-04-13
AI Technical Summary
In existing technologies, the detection methods for Ureaplasma urealyticum (UU) and Mycoplasma hominis (MH) are time-consuming, require expensive equipment, and lack sufficient sensitivity and specificity, making them difficult to apply effectively in resource-scarce areas.
A multi-visual nucleic acid detection system was adopted, combining loop-mediated isothermal amplification (LAMP) and immunochromatographic strips (LFD). Primers and assimilation probes were designed using specific conserved gene sequences to achieve dual-visual detection of UU and MH, and amplification products were distinguished by different colorimetric systems.
It enables rapid, simple, and visual detection of UU and MH, reduces equipment costs and technical requirements, and improves detection sensitivity and specificity.
Smart Images

Figure CN116640836B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of nucleic acid detection equipment technology, specifically a method for constructing a multiplex visual nucleic acid detection system and detection strips. Background Technology
[0002] Ureaplasma urealyticum (UU) and Mycoplasma hominis (MH) are two common clinical pathogens, and their infection has been proven to cause human infertility.
[0003] In women, mycoplasma infection can lead to refractory bacterial vaginosis. It may also be a risk factor for ectopic pregnancy and tubal infertility. While the presence of Ureaplasma urealyticum (UU) and Mycoplasma hirsutum (MH) alone in the vaginal flora may not be sufficient to cause pathological problems, their combination with other factors (such as bacterial vaginosis and cervical lesions) may induce premature birth. In men, UU and MH infection can affect sperm quality, leading to male infertility.
[0004] Surveillance of infectious diseases is crucial for effective prevention and treatment. Clinical detection of Ureaplasma urealyticum (UU) and Mycobacterium methylprednisolone (MH) primarily relies on microbial culture and PCR (polymerase chain reaction). However, microbial culture is time-consuming, requiring approximately 48 hours; while PCR is faster, the diversity of genes imposes technical and methodological limitations on PCR and sequencing analysis, leading to unreliable results in mixed infection detection and restricting the identification of multiple pathogens in the same sample. Furthermore, PCR equipment is expensive and requires highly skilled laboratory technicians, making it difficult to implement in resource-scarce countries or regions. Therefore, developing a rapid and convenient method for detecting UU and MH is essential. Summary of the Invention
[0005] The purpose of this invention is to provide a method for constructing a multiplex visualized nucleic acid detection system to solve the problems mentioned in the background art.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] The construction method of a multiplex visualization nucleic acid detection system includes the following steps:
[0008] S1, screening for specific conserved gene sequences of multiple target analytes;
[0009] S2, Design specific LAMP primers based on the specific conserved gene sequences of multiple target analytes selected in S1;
[0010] S3, label the specific loop primers designed in S2 and design specific assimilation probes;
[0011] S4: The primers, labeled primers, assimilation probes, and multiple nucleic acid templates formed in S2 and S3 are placed in the same system for LAMP amplification to form an amplification product containing multiple labels;
[0012] S5, the amplification products containing multiple markers in S4 are placed into the binding pad of the detection strip, and different amplification products bind to the corresponding labeled colloidal gold particles in the binding pad;
[0013] S6, under chromatography, the amplified product-labeled colloidal gold complex is captured by the corresponding antibody through the detection band, thus developing color.
[0014] As a further aspect of the present invention: the target detection substances in step S1 are Ureaplasma urealyticum and Mycoplasma hominis, and the specific conserved gene sequences of UU and MH are selected using NCBI blast;
[0015] In step S2, when designing specific primers for the specific conserved gene sequences of the target analyte, the online primer design software Primer Explorer V5 was used to design specific primers for the conserved genes UU and MH. The specific primers include outer primers, inner primers, and loop primers. The outer primers include F3 and B3, the inner primers include FIB and BIP, and the loop primers include LF and LB.
[0016] In step S3, the probe type is an assimilation probe, which consists of two inversely complementary oligonucleotide chains. One chain is labeled with a fluorescein group as a fluorescent probe, and the other is labeled with a quencher group as a quencher probe. We added an oligonucleotide sequence different from the UU gene to the 5' end of the UU loop primer LB and labeled it with the fluorescein group TAMRA to obtain the UU fluorescent probe. We then designed a specific sequence inversely complementary to the added oligonucleotide sequence and labeled the 3' end with the TAMRA-quenching group BHQ2 to obtain the UU quencher probe. Similarly, we added another oligonucleotide sequence different from the MH gene to the 5' end of the MH loop primer LF and labeled it with the fluorescein group FAM to obtain the MH fluorescent probe. We then designed an inversely complementary sequence corresponding to the added oligonucleotide sequence in MH and labeled the 3' end with the FAM-quenching group BHQ1 to obtain the MH quencher probe. Additionally, to meet the requirements of subsequent visualization experiments, the UU loop primer LF was labeled with Digoxin, and the MH loop primer LB was labeled with Biotin.
[0017] As a further embodiment of the present invention: when the specific primers in S4 are used for LAMP amplification, the total volume of the amplification system is 25 μL, including 21 μL of LAMP reagent, primers, labeled primers, and assimilation probe, 2 μL each of UU and MH templates, the reaction temperature is set to 65℃, and the reaction time is 60 minutes.
[0018] The present invention also aims to provide a multiplex visual nucleic acid detection strip, including a detection strip body and a shell for mounting the detection strip body. The detection strip body is mounted inside the shell. The shell includes a shell body and a shell plug. A detection sample inlet is opened on the shell plug. The detection sample inlet is adapted to the opening of a quantitative container.
[0019] As a further embodiment of the present invention: a first fixed connection structure is provided around the inside of the test sample inlet, and a second fixed connection mechanism is provided around the opening of the quantitative container. The first fixed connection structure cooperates with the second fixed connection mechanism to install the quantitative container onto the outer shell plug.
[0020] As a further embodiment of the present invention: the test sample inlet is located above the sample pad position of the test strip body.
[0021] As a further embodiment of the present invention: the detection strip body includes a sample pad, a conjugate pad, a detection area, a conjugate pad, an absorbent pad, and a base plate, and the sample pad, conjugate pad, detection area, conjugate pad, and absorbent pad are arranged sequentially from one end of the base plate to the other end.
[0022] As a further embodiment of the present invention: the end of the sample pad that contacts the conjugate pad is pressed on top of the conjugate pad, the end of the conjugate pad that contacts the detection area is pressed on top of the detection area, and the end of the absorbent pad that contacts the detection area is pressed on top of the detection area.
[0023] As a further embodiment of the present invention: the detection area includes a detection pad and a nitrocellulose membrane, the nitrocellulose membrane being disposed above the detection pad between the absorption pad and the binding pad.
[0024] As a further embodiment of the present invention: the absorbent pad contains colloidal gold particles labeled with anti-TAMRA antibody, colloidal gold particles labeled with anti-Biotin antibody, and colloidal gold particles coated with anti-chicken antibody. The conjugate pad contains two detection lines and one control line. One detection line is coated with anti-Digoxin antibody, the other detection line is coated with anti-FAM antibody, and the control line is coated with anti-chicken secondary antibody.
[0025] As a further aspect of the present invention, the quantitative container is further provided with a measuring scale for measuring.
[0026] Compared with the prior art, the beneficial effects of the present invention are:
[0027] This invention utilizes a visual LFD detection system to achieve dual-color development, where UU and MH use their respective colorimetric systems. The conjugate pad contains colloidal gold particles labeled with anti-TAMRA and anti-Biotin antibodies, which can specifically bind to UU products carrying TAMRA and MH products carrying Biotin, respectively. The anti-Digoxin antibody within the conjugate pad captures UU products carrying Digoxin, and the anti-FAM antibody captures MH products carrying FAM, forming anti-Digoxin antibody-Digoxin-UU product-TAMRA-anti-TAMRA antibody-labeled colloidal gold complexes and anti-FAM antibody-FAM-MH product-Biotin-anti-Biotin antibody-labeled colloidal gold complexes, respectively. This enables visualized, rapid, and convenient detection of UU and MH. Attached Figure Description
[0028] Figure 1 This is a schematic diagram of mLAMP amplification.
[0029] Figure 2 This is a schematic diagram showing the location of the UU primer.
[0030] Figure 3 This is a schematic diagram of the MH primer positions.
[0031] Figure 4 This is a schematic diagram of the structure of the outer shell body and the outer shell plug.
[0032] Figure 5 This is a schematic diagram of a quantitative container.
[0033] Figure 6 This is a schematic diagram of the structure of a metering container and its outer casing plug.
[0034] Figure 7 This is a schematic diagram of the layout structure of the detection strip body.
[0035] Figure 8 This is a diagram of the overall structure of the detection strip.
[0036] Figure 9 This is a schematic diagram for interpreting the test results.
[0037] In the figure: 1-test strip body, 11-absorbent pad, 12-test area, 13-binding pad, 14-sample pad, 15-nitrocellulose membrane, 16-base plate, 2-outer shell body, 3-outer shell plug, 4-test sample inlet, 41-first fixed connection mechanism, 5-quantitative container, 51-second fixed connection mechanism, 52-measuring scale line. Detailed Implementation
[0038] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0039] Furthermore, elements in this invention are referred to as being "fixed to" or "set on" another element, which may be directly on the other element or may also include an intervening element. When an element is considered to be "connected" to another element, it may be directly connected to the other element or may also include an intervening element. The terms "vertical," "horizontal," "left," "right," and similar expressions used herein are for illustrative purposes only and do not represent the only possible implementations.
[0040] Nucleic acid amplification technology is a commonly used gene detection technique in clinical practice. Traditional nucleic acid amplification techniques, such as polymerase chain reaction (PCR), are limited in their application in grassroots areas and point-of-care testing due to factors such as long reaction times, expensive equipment, and high requirements for technicians. To meet the demands of modern molecular diagnostics for speed and convenience, a series of isothermal nucleic acid amplification techniques have emerged. Currently, the most widely studied isothermal nucleic acid amplification techniques include loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), helicase-dependent amplification (HDA), and rolling circle amplification (RCA). Among the aforementioned isothermal nucleic acid amplification techniques, loop-mediated isothermal amplification (LAMP) was proposed in 2000 by Japanese scientists Notomi et al. It includes one pair each of basic outer primers (F3, B3) and inner primers (FIP, BIP), and one pair of accelerated loop primers (LF, LB). It boasts advantages such as high sensitivity, strong specificity, and rapid reaction speed. Furthermore, the entire reaction is carried out at a constant temperature, requiring only simple instruments such as a temperature-controlled water bath or metal incubator. In the field of medical research, LAMP technology can be used to detect infectious diseases caused by bacteria, fungi, and viruses, and its results have higher reliability compared to routine clinical testing methods.
[0041] Immunochromatographic test strips, also known as lateral flow dipsticks (LFD), are a strip-based chromatographic detection method that primarily relies on the interaction between antigens and antibodies or ligands on the test strip and markers on specific amplification products. In recent years, LAMP technology has been combined with LFD for rapid, on-site, visualized nucleic acid detection, saving on the expensive equipment costs of nucleic acid amplification and reducing the technical difficulty of result interpretation. The combined application of LAMP and LFD offers advantages such as visualized nucleic acid detection results, detection of multiple genes, improved work efficiency, and reduced equipment and reagent costs. Simultaneously using multiplex LAMP detection systems and multiplex LFD technology allows for the simultaneous, rapid, and visualized detection of multiple nucleic acid targets. For example, studies by Sharma S et al. and Jiang Y et al. have demonstrated the effectiveness of this technology in detecting two malaria parasites and Salmonella, as well as Kronobacter and Staphylococcus aureus, respectively.
[0042] To maximize the potential of the LAMP and LFD combination, further improvements to the reaction system are needed. Assimilation probes are a highly specific sequence analysis method based on fluorescence resonance energy transfer (FRET), which can increase specificity and minimize the risk of false positives. This method ensures high sensitivity and specificity, eliminating false positives caused by primer dimer indistinguishability or primer-template mismatch in traditional LAMP.
[0043] Please see Figure 1-3 This invention discloses a method for constructing a multiplex visualization nucleic acid detection system, specifically a dual detection colorimetric method for Ureaplasma urealyticum (UU) and Mycoplasma hominis (MH). In its most specific implementation, LAMP technology is used to amplify the nucleic acids of UU and MH. This method only requires a simple isothermal incubation system and has the advantages of rapid amplification, high sensitivity, and high specificity, which meet the needs of modern molecular detection.
[0044] First, specific conserved gene sequences of UU and MH were selected using NCBI blast.
[0045] The selected UU conserved sequence is: cgaaattgtg atgaacgaag gtagagaagc aaaagtaatcagcattaaaa atactggtga ccgtcctatc caagttggat cacatttcca cttatttgaa acaaatagtgcattagtatt ctttgatgaa aaaggaaacg aagacaaaga acgtaaagtt gctttggac gtcgtttcgatattccatca ggtactgcta ttcgttttga accaggagac aaaaaagaag tttcagttat tggtttagtcggaacacgtg aagtttgagg tgtaaacggc ttagttaacg gaaaacttaa aaaataatct atttacaagtttctatatag acgaagggga acattatgtt taaaatttca agaaaaaatt actcagatct atatggtatcacaactggtg atagcgttag attaggag.
[0046] The selected MH conserved sequence is: ctgttttaag gtgcaacatt tctgtcattg gtactggaactaacttctta ccaatttttg ctaatatatt gtggaattgt ctaattccgt cacgattagt tctttcggacataccaatgt agtatgtatc tccaaccatc ataacatctc ccccgtcaac agttccggga gcttcaatttttgcaatgtg tccatcatca aagtatttct ttaatgcagg aagcatttca actttttctc cattacgtgttttagcacct ggattagtta aaatagctag ttcacctgga ataataacag cagtatcttc.
[0047] Then, specific primers for the conserved genes of UU and MH were designed using the online primer design software Primer Explorer V5, including outer primers (F3 and B3), inner primers (FIB and BIP), and loop primers (LF and LB), as detailed in Table 1 below:
[0048] Table 1. Primer and probe sequences for UU and MH
[0049] Tab.1 Primers and probe sequences of UU and MH
[0050]
[0051]
[0052] This invention applies assimilation probes to a multiplex LAMP detection system, combining assimilation probe-based multiplex LAMP with the LFD method for visual detection, and simultaneously detecting two pathogens, MH and UU.
[0053] Previous reports have described the application of assimilation probes in dual LAMP, but these only included fluorescent probes and did not include the quenching probes found in assimilation probes. Furthermore, amplification and result interpretation still required a quantitative real-time PCR instrument. (Related article: https: / / pubmed.ncbi.nlm.nih.gov / 25741765 / ). Additionally, some literature reports the complete application of assimilation probes in LAMP amplification, but these are single-reaction systems, detecting only one pathogen per tube. Amplification and result interpretation also still require a quantitative real-time PCR instrument. (Related article: https: / / www.nature.com / articles / s41598-018-23930-1).
[0054] This invention uses an assimilation probe, enhancing the specificity of the detection system. We added an oligonucleotide sequence different from the UU gene to the 5' end of the UU loop primer LB and labeled it with the fluorescein group TAMRA to obtain a UU fluorescent probe. A specific sequence inversely complementary to the added oligonucleotide sequence was designed, and the 3' end was labeled with the TAMRA-quenching group BHQ2 to obtain a UU quenching probe. Similarly, another oligonucleotide sequence different from the MH gene was added to the 5' end of the MH loop primer LF and labeled with the fluorescein group FAM to obtain an MH fluorescent probe. A sequence inversely complementary to the added oligonucleotide sequence in MH was designed, and the 3' end was labeled with the FAM-quenching group BHQ1 to obtain an MH quenching probe. Simultaneously, to meet the requirements of subsequent visualization experiments, the UU loop primer LF was labeled with Digoxin, and the MH loop primer LB was labeled with Biotin. Therefore, after LAMP amplification, the double-labeled amplification products can be detected on an LFD.
[0055] This method designs two probes for UU and MH, using Digoxin and TAMRA-labeled primers for UU and Biotin and FAM-labeled primers for MH. Unlike the report by Zhang et al. (Zhang J, Cao J, Zhu M, Xu M, Shi F. Loop-mediated isothermal amplification-lateral-flow dipstick (LAMP-LFD) to detect Mycoplasma ovipneumoniae. World J Microbiol Biotechnol. 2019 Jan 30; 35(2):31), this system also introduces a BHQ1-labeled quenching probe to quench FAM and a BHQ2-labeled quenching probe to quench TAMRA. When specific amplification occurs, the fluorescent probe binds to the specific amplification product labeled with Digoxin or Biotin, and the quenching probe is displaced to reduce non-specific reactions.
[0056] A highly specific multiplex LAMP detection system was established by leveraging the ability of quenching probes in assimilation probes to enhance system specificity. The system comprises a total volume of 25 μL, containing 21 μL of LAMP reagents, primers, and probes, and 2 μL each of UU and MH templates. The reaction temperature was set at 65 °C, and the reaction time was 60 minutes. During the reaction, the probe concentration could be adjusted using an asymmetric strategy to optimize the entire amplification system. The entire reaction process requires only a thermostat incubator and does not require an expensive quantitative PCR instrument.
[0057] The visualization LFD detection system used in this invention is a dual-colorimetric system, where UU and MH use their respective colorimetric systems. The conjugate pad contains colloidal gold particles labeled with anti-TAMRA and anti-Biotin, which can specifically bind to UU products containing TAMRA and MH products containing Biotin, respectively. During chromatography, the anti-FAM fixed in region T1 captures the FAM bound to the MH product, resulting in color development in region T1; the anti-Digoxin fixed in region T2 captures the Digoxin bound to the UU product, resulting in color development in region T2. Simultaneously, the anti-Chicken-labeled colloidal gold particles within the conjugate pad move with the liquid flow and bind to the chicken secondary antibody fixed in the control region, resulting in color development of the control line (see schematic diagram of mLAMP and LFD dual visualization detection). Figure 4). Different from the single chromogenic system that shares chromogenic colloidal gold particles (Chen Y, Cheng N, Xu Y, Huang K, Luo Y, Xu W. Point-of-care and visual detection of P.aeruginosa and its toxin genes by multiple LAMP and lateral flow nucleic acid biosensor. Biosens Bioelectron. 2016Jul 15; 81:317-323; Sridapan T,TangkawsakulW,Janvilisri T,Luangtongkum T,Kiatpathomchai W,Chankhamhaengdecha S.Rapid and simultaneous detection ofCampylobacter spp.and Salmonella spp.in chicken samples by duplex loop-mediated isothermal amplification coupled with a lateral flow biosensorassay.PLoS One.2021Jul 1;16(7):e0254029), In the established system, the amplification products of UU and MH will not compete for the color development of colloidal gold particles, which to a certain extent avoids the problem of mutual influence between multiple amplification products.
[0058] This invention establishes a multiplex LAMP-LFD (Multiple Loop-Mediated Isothermal Amplification-Lateral Flow Dipstick, mLAMP-LFD) detection system capable of simultaneously detecting UU and MH in the same sample. This system utilizes specific assimilation and quenching probes, along with a dual-color development system within the LFD, to ensure high sensitivity and specificity during detection. Furthermore, the dual-color development system in the LFD enables single-tube, dual-visualization detection of MH and UU. The LFD allows for visualization of the detection results, making it a user-friendly detection method.
[0059] The method for detecting UU and MH using the method of this invention has the advantages of isothermal amplification, as well as the characteristics of single-tube multiplexing and result visualization. It does not require expensive and complex instruments or professional technicians. At the same time, the detection method is specific, sensitive and time-saving.
[0060] Specifically, in the embodiments of the present invention:
[0061] I. Design Intent
[0062] This invention establishes a multiplex LAMP-LFD (Multiple Loop-Mediated Isothermal Amplification-Lateral Flow Dipstick, mLAMP-LFD) detection system capable of simultaneously detecting UU and MH in the same sample. This system utilizes specific assimilation probes and a dual-colorimetric system within the LFD to ensure high sensitivity and specificity during detection. To this end, two specific assimilation probes are designed in this invention for dual-labeling UU and MH amplification products, respectively. The dual-colorimetric system within the LFD further enhances the specificity of the detection results.
[0063] This invention targets Ureaplasma urealyticum (UU) and Mycobacterium methylglycinum (MH) pathogens, combines dual LAMP and dual LFD technologies, introduces assimilation probes to increase detection specificity, and establishes and optimizes the mLAMP-LFD detection system, which can be used for early joint screening of UU and MH in clinical settings.
[0064] II. Sample Acquisition
[0065] A total of 29 clinical female genital tract secretion samples were collected, including 12 cases of double-positive UU and MH, 8 cases of UU-positive samples, and 9 normal samples. Bacterial DNA was extracted from the genital tract secretion samples using a bacterial DNA extraction kit, and the extraction concentration was determined. The samples were labeled and stored at -20°C, and reconstituted before use. Due to the limited number of clinical MH single-positive samples and the impact of the novel coronavirus, no MH single-positive samples were collected. MH standard plasmids were added to 3 double-negative samples to ensure the same matrix background as the clinical samples, simulating MH single-positive samples.
[0066] Using online NCBI BLAST software for comparison and analysis, highly conserved and highly specific MH and UU genes were selected. pUC57 plasmid DNA standards containing partial sequences of the UU gene (418 bp) and MH gene (310 bp) were cloned and synthesized and verified by Shanghai Sangon Biotech Co., Ltd.
[0067] III. Reagent Selection
[0068] The main reagents included: betaine (Sigma-Aldrich, USA), 8000U Bst WarmStart 2.0 DNA polymerase (NEB Beijing Co., Ltd.), 10× Isothermal buffer (NEB Beijing Co., Ltd.), 100mM MgSO4 (NEB Beijing Co., Ltd.), 10mM dNTPs (NEB Beijing Co., Ltd.), nuclease-free water (Life Technologies, USA), agarose (Zhicheng Chaoyuan Biotechnology Co., Ltd.), DNA loading buffer (Zhicheng Chaoyuan Biotechnology Co., Ltd.), DL1000 DNA Marker (Zhicheng Chaoyuan Biotechnology Co., Ltd.), and 50×TAE electrophoresis buffer (Beijing Solarbio Science & Technology Co., Ltd.).
[0069] IV. Selection of Instruments and Consumables
[0070] Main instruments and consumables: 1.0ml and 1.5ml EP tubes (Thermo Fisher Scientific, USA), 0.2ml eight-tube strips and caps (Thermo Fisher Scientific, USA), 10μL, 100μL, 200μL, and 1000μL enzyme-free pipette tips with filters (Sangon Biotech Co., Ltd.), 10μL, 100μL, 200μL, and 1000μL pipettes (Eppendorf, Germany), Thermostat C incubator (Eppendorf, Germany), ABI 7500HT fluorescence PCR instrument (Applied Biosystems, USA), DYY-II electrophoresis apparatus (manufactured by Beijing Liuyi Instrument Factory), GenoSens 1880 gel imaging system (Shanghai Qinxiang Co., Ltd.), double rainbow nucleic acid test strips (Beijing Baoying Tonghui Biotechnology Co., Ltd.), mini vortex mixer (Beijie Technology Co., Ltd.), and MINI-C centrifuge (Beijie Technology Co., Ltd.).
[0071] 5. Specific operations
[0072] 5.1 Formula for calculating plasmid standard concentration:
[0073] Based on the plasmid concentration provided by Shanghai Sangon Biotech Co., Ltd., the copy number of the standard plasmid was calculated using a conversion formula. The conversion formula is as follows:
[0074]
[0075] 5.2 Design and synthesis of primers and probes:
[0076] Using plasmid DNA sequences as target sequences, specific primers were designed using the LAMP primer design software PrimerExplorerV5, including outer primers (F3 and B3), inner primers (FIP and BIP), and loop primers (LF and LB).
[0077] This experiment used assimilation probes. For UU, an oligonucleotide sequence different from the UU gene was added to the 5' end of the loop primer LB, and its 5' end was labeled with the fluorescein group TAMRA, resulting in the UU fluorescent probe UULBP. A specific sequence inversely complementary to the added oligonucleotide sequence was designed, and its 3' end was labeled with the TAMRA-quenching group BHQ2, resulting in the UU quenching probe UU Quench. Similarly, another oligonucleotide sequence different from the MH gene was added to the 5' end of the MH loop primer LF, and its 5' end was labeled with the fluorescein group FAM, resulting in the MH fluorescent probe MHLFP. An inversely complementary sequence corresponding to the added oligonucleotide sequence in MH was designed, and its 3' end was labeled with the FAM-quenching group BHQ1, resulting in the MH quenching probe MHQuench. In addition, the 5' end of the UU loop primer LF was labeled with Digoxin, and the 5' end of the MH loop primer LB was labeled with Biotin. Therefore, after LAMP amplification, the double-labeled UU and MH amplification products can be detected on the LFD. Primer and probe sequences are shown in Table 1:
[0078] Table 1. Primers and probe sequences of UU and MH
[0079]
[0080] 5.3 Establishment and optimization of the single-layer LAMP detection method:
[0081] The total volume of the reaction system is 10 μL. It contains betaine, dNTPs, isothermal amplification buffer, MgSO4, LAMP primers, Bst 2.0 Warmstart DNA polymerase, plasmid DNA template, and nuclease-free water to make up to 10 μL.
[0082] Since the detection effect of the isothermal amplification system directly affects the sensitivity and specificity of the detection, it is necessary to screen the reaction temperature and optimize the single-factor variation experiments of factors such as the ratio of inner and outer primer concentrations, dNTP concentration, and MgSO4 concentration in the reaction system. The reaction instrument is an ABI 7500 real-time PCR instrument, the reaction time is 60 minutes, and the fluorescence signal is directly collected using the fluorescent dye Sybrgreen II. The amplification curve is observed, and the earliest ct value is the best.
[0083] Reaction temperature screening: Three temperature gradients of 64, 65 and 66 were set, with a reaction time of 60 minutes. The UU and MH single-layer LAMP systems were incubated using a metal thermostat incubator. The results were verified by agarose gel electrophoresis. The reaction temperature suitable for both was selected as the temperature for subsequent experiments.
[0084] Optimization of the inner-outer primer concentration ratio: With the outer primer concentration fixed at 0.2 μM, the inner primer concentration gradient is set to 1.0 μM, 1.2 μM, 1.4 μM, 1.6 μM, 1.8 μM, and 2.0 μM, respectively. The inner-outer primer concentration ratios are 5:1, 6:1, 7:1, 8:1, 9:1, and 10:1, respectively.
[0085] dNTPs concentration optimization: The dNTPs concentration gradient was set to 0.8 mM, 1.0 mM, 1.2 mM, 1.4 mM and 1.6 mM respectively.
[0086] MgSO4 concentration optimization: Set the MgSO4 concentration gradient to 2mM, 4mM, 6mM, 8mM, and 10mM respectively.
[0087] 5.4 Establishment and optimization of the mLAMP-LFD detection method
[0088] The total volume of the reaction system was 25 μL. The reaction apparatus was a metal thermostatic incubator, the reaction temperature was 65℃, and the reaction time was 60 minutes. All reagents were used at the same final concentration as the optimized single-layer LAMP system, with the addition of UU and MH specific probes, and the volume was brought up to 25 μL with nuclease-free water. Based on the test strip principle and asymmetric strategy, the concentrations of the labeled loop primers and probes were adjusted to optimize the mLAMP-LFD reaction. After the amplification reaction, the amplified system was brought up to 150 μL with distilled water, and the test strip was inserted to complete the result detection and interpretation within ten minutes.
[0089] Specific assay using 5.5 mL AMP-LFD:
[0090] The optimized reaction system was used to specifically validate positive DNA samples from Chlamydia trachomatis, Neisseria gonorrhoeae, Escherichia coli, Staphylococcus aureus, and human papillomavirus. Nuclease-free water was used as a template for a negative control, and the results were validated by 2% agarose gel electrophoresis.
[0091] Sensitivity detection of 5.6 mL AMP-LFD:
[0092] The plasmid DNA of UU and MH was serially diluted 10-fold (10... 7 10 6 10 5 10 4 10 3 10 2(10 copies / μL), and experiments were conducted under optimized conditions.
[0093] 5.7 mL AMP-LFD clinical sample analysis:
[0094] Twenty-six clinical samples and three simulated samples were tested using the optimized mLAMP-LFD system, and the results were compared with those obtained by culture method and clinical laboratory qPCR method.
[0095] VI. Results Analysis
[0096] This study combines the advantages of rapid isothermal amplification by LAMP with the specific visualization advantages of LFD to establish a mLAMP-LFD method for simultaneous single-tube detection of UU and MH. This method uses two probes designed for UU and MH: primers labeled with Digoxin and TAMRA for UU, and primers labeled with Biotin and FAM for MH. Unlike the method reported by Zhang et al., this system also introduces a quenching probe labeled with BHQ1 to quench FAM and a quenching probe labeled with BHQ2 to quench TAMRA. During specific amplification, the fluorescent probe binds to the specific amplification product labeled with Digoxin or Biotin, displacing the quenching probe and reducing non-specific reactions. Simultaneously, an asymmetric strategy is used to adjust primer concentrations to generate more LAMP products for hybridization with the probes.
[0097] In addition, the visualization LFD detection system used is a dual-color development system, where UU and MH use their own separate colorimetric systems. The conjugate pad contains colloidal gold particles labeled with anti-TAMRA and anti-Biotin, which specifically bind to UU products containing TAMRA and MH products containing Biotin, respectively. During chromatography, the anti-FAM fixed in region T1 captures the FAM bound to the MH product, resulting in color development in region T1; the anti-Digoxin fixed in region T2 captures the Digoxin bound to the UU product, resulting in color development in region T2. Simultaneously, the anti-Chicken-labeled colloidal gold particles within the conjugate pad move with the liquid flow and bind to the chicken secondary antibody fixed in the control region, resulting in color development of the control line. Unlike single-color development systems that share colloidal gold particles, in this system, the amplification products of UU and MH do not compete for the colorimetric colloidal gold particles, thus avoiding the problem of mutual interference between multiplex amplification products to some extent.
[0098] The mLAMP-LFD detection system was applied to detect bacteria of reproductive tract origin and some common bacteria in clinical settings. Results showed that the system specifically amplified *Ureaplasma gondii* (UU) and *Myxomyosclerosis nephritis* (MH), while other pathogens were not amplified. The detection results were consistent with the 2% agarose gel electrophoresis results of LAMP amplification products, indicating that the reaction has high specificity. The sensitivity of mLAMP-LFD was 10 for both UU and MH. 2 The results were superior to conventional PCR, with a detection rate of copies / μL. Validation of mLAMP-LFD on clinical samples yielded results consistent with clinical microbial culture and qPCR. This demonstrates that the established mLAMP-LFD method for detecting UU and MH is sensitive, specific, and visualized.
[0099] The mLMAP-LFD method established in this experiment has advantages such as high specificity and sensitivity, simple operation, low instrument requirements, and visualization. Applying this method to the simultaneous detection of Ureaplasma urealyticum (UU) and Mycobacterium thrombosis (MH) will become a more convenient screening technique, suitable for promotion and application in primary hospitals and resource-scarce areas.
[0100] To realize the application of the multiplex visualization nucleic acid detection system in this invention, this invention also provides a multiplex visualization nucleic acid detection strip, including a detection strip body 1 and a shell for mounting the detection strip body 1. The detection strip body 1 is installed inside the shell. The detection strip body 1 includes a sample pad 14, a conjugate pad 13, a detection area 12, a conjugate pad 13, an absorption pad 11, and a base plate 16. The sample pad 14, the conjugate pad 13, the detection area 12, the conjugate pad 13, and the absorption pad 11 are arranged sequentially from one end of the base plate 16 to the other end. The visualization LFD detection system is a dual-color development system, that is, UU and MH use their own different color development systems. The conjugate pad contains colloidal gold particles labeled with anti-TAMRA and anti-Biotin, which can specifically bind UU products with TAMRA and MH products with Biotin, respectively. The liquid flows under the action of chromatography. The anti-FAM fixed in the T1 region captures the FAM bound to the MH product, and the T1 region develops color. The anti-Digoxin fixed in the T2 region captures the Digoxin bound to the UU product, and the T2 region develops color. Simultaneously, the anti-Chicken-labeled colloidal gold particles contained in the binding pad move with the liquid flow and bind to the chicken secondary antibody fixed in the quality control area, causing the quality control line to appear colored.
[0101] The outer casing includes an outer casing body 2 and an outer casing plug 3. A sample inlet 4 is provided on the outer casing plug 3, and the sample inlet 4 is adapted to the opening of the quantitative container 5. The quantitative container 5 is also provided with a measuring scale 52 for measurement. The sample inlet 4 is located above the sample pad 14 of the sample strip body 1. A first fixing connection structure 41 is provided around the inside of the sample inlet 4, and a second fixing connection mechanism 51 is provided around the opening of the quantitative container 5. The first fixing connection structure 41 cooperates with the second fixing connection mechanism 51 to install the quantitative container 5 onto the outer casing plug 3.
[0102] The sample pad 14 has one end in contact with the conjugate pad 13, which is pressed above the conjugate pad 13. The conjugate pad 13 has one end in contact with the detection area 12, which is pressed above the detection area 12. The absorbent pad 11 has one end in contact with the detection area 12, which is pressed above the detection area 12. The detection area 12 includes a detection pad and a nitrocellulose membrane 15, which is disposed above the detection pad between the absorbent pad 11 and the conjugate pad 13.
[0103] The quantitative container 5 enables precise sampling of the test strip, avoiding waste caused by excessive sampling and preventing spillage and contamination. This also helps prevent the spread of disease. In practical use, the quantitative container 5 is used for sampling. After sampling, the container 5 is installed onto the test sample inlet 4 via the cooperation of the second fixing mechanism 51 and the first fixing structure 41. The second fixing mechanism 51 and the first fixing structure 41 can be connected by a threaded connection. When installing the quantitative container 5 onto the test sample inlet 4, the opening of the container 5 can initially face upwards. After installation, the opening of the container 5 can be turned downwards. At this point, the sample inside the quantitative container 5 enters the sample pad 14. The sample on the sample pad 14 moves towards the binding pad 13, where it binds with the colloidal gold particles and is then introduced into the detection area 12 for color development.
[0104] Multiplex visualization nucleic acid detection strips enable rapid detection with high accuracy. UU and MH use their own different color development systems. The binding pad contains colloidal gold particles labeled with anti-TAMRA and anti-Biotin, which can specifically bind to UU products with TAMRA and MH products with Biotin, respectively, enabling rapid and convenient detection of UU and MH.
[0105] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.
[0106] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. Use of LAMP primers for simultaneous detection of UU and MH in the preparation of a multiplex visual nucleic acid detection reagent, characterized in that, Comprising the following steps: S1, selecting specific conservative gene sequences of multiple target detection objects; The target detection objects in the S1 step are Ureaplasma urealyticum and Mycoplasma hominis, and the specific conservative gene sequences of UU and MH are selected using NCBI blast; The selected UU conservative sequence is: cgaaattgtg atgaacgaag gtagagaagc aaaagtaatc agcattaaaaatactggtga ccgtcctatc caagttggat cacatttcca cttatttgaa acaaatagtg cattagtattctttgatgaa aaaggaaacg aagacaaaga acgtaaagtt gcttatggac gtcgtttcga tattccatcaggtactgcta ttcgttttga accaggagac aaaaaagaag tttcagttat tggtttagtc ggaacacgtgaagtttgagg tgtaaacggc ttagttaacg gaaaacttaa aaaataatct atttacaagt ttctatatagacgaagggga acattatgtt taaaatttca agaaaaaatt actcagatct atatggtatc acaactggtgatagcgttag attaggag; The selected MH conservative sequence is: ctgttttaag gtgcaacatt tctgtcattg gtactggaac taacttcttaccaatttttg ctaatatatt gtggaattgt ctaattccgt cacgattagt tctttcggac ataccaatgtagtatgtatc tccaaccatc ataacatctc ccccgtcaac agttccggga gcttcaattt ttgcaatgtgtccatcatca aagtatttct ttaatgcagg aagcatttca actttttctc cattacgtgt tttagcacctggattagtta aaatagctag ttcacctgga ataataacag cagtatcttc; S2, designing specific primers using the primer design software Primer Explorer V5 according to the specific conservative gene sequences of multiple target detection objects selected in S1; S3, labeling the multiple specific loop primers designed in S2 and designing corresponding assimilation probes; S4, using the primers, labeled primers, assimilation probes and different nucleic acid templates designed in S2 and S3 to perform LAMP amplification to form a plurality of LAMP amplification products containing labels; S5, placing the amplification products containing a plurality of labels in S4 into the conjugate pad of the multiplex visual nucleic acid detection strip, and different amplification products bind to corresponding labeled colloidal gold particles in the conjugate pad; S6, under the action of chromatography, the amplification product-labeled colloidal gold complex is captured by the corresponding antibody through the detection zone to develop color; In the step S2, the specific primer is designed for the specific conserved gene sequence of the target detection object, and the online primer design software Primer Explorer V5 is used to design specific primers for UU and MH conserved genes. The specific primers specifically include outer primers, inner primers and loop primers. The outer primers include F3 and B3, the inner primers include FIB and BIP, and the loop primers include LF and LB. In the step S3, the probe type is an assimilation probe, which contains two reverse complementary oligonucleotide chains. One is labeled with a fluorescein group as a fluorescent probe, and the other is labeled with a quencher group as a quencher probe. A segment of oligonucleotide sequence different from the UU gene is added to the 5' end of the UU loop primer LB, and labeled with a fluorescein group TAMRA to obtain a UU fluorescent probe. A specific sequence complementary to the added oligonucleotide sequence is designed, and the 3' end is labeled with a quencher group BHQ2 that can quench TAMRA to obtain a UU quencher probe. Another segment of oligonucleotide sequence different from the MH gene is added to the 5' end of the MH loop primer LF, and labeled with a fluorescein group FAM to obtain an MH fluorescent probe. A reverse complementary sequence corresponding to the added oligonucleotide sequence of MH is designed, and the 3' end is labeled with a quencher group BHQ1 that can quench FAM to obtain an MH quencher probe. The UU loop primer LF is labeled with Digoxin, and the MH loop primer LB is labeled with Biotin. The sequences of the primers are shown in SEQ ID NO. 3-18.
2. Use of the LAMP primer for simultaneously detecting UU and MH according to claim 1 in the preparation of a multiplex visual nucleic acid detection reagent, characterized in that, In the step S4, when the specific primers are used for LAMP amplification, the volume of the amplification system is 25 μL, which contains 21 μL of LAMP reagents, primers, labeled primers, assimilation probes, 2 μL of UU template and 2 μL of MH template. The reaction temperature is set to 65℃, and the reaction time is 60 minutes.
Citation Information
Patent Citations
Multiple visual nucleic acid detection strip
CN220246115U