Photoelectrically active heterojunction material and its preparation method and application

Abstract

The present invention relates to a photoelectrically active heterojunction material, its preparation method, and its application, belonging to the technical field of photoelectrically active heterojunction material preparation. The present invention primarily involves adding MoSe₂ to CdSe to form a photoelectrically active heterojunction material (MoSe₂ / CdSe, i.e., an MC heterojunction material). This material can further improve the photoelectric performance of CdSe and reduce the photogenerated electron-hole recombination rate. Furthermore, due to the matching of the valence and conduction bands between the materials, the recombination of photogenerated electron-hole pairs within the heterojunction materials is significantly suppressed, improving the material's charge separation efficiency. Consequently, the material exhibits excellent light absorption and a high photoresponse current, showing promising application prospects in the preparation of photoelectrochemical biosensors.

Description

Technical Field

[0001] The present invention belongs to the technical field and relates to a photoelectrically active heterojunction material and a preparation method and application thereof. Background Art

[0002] In recent years, various sensitive tests based on disease markers have flourished. Early detection of disease can improve patients' quality of life and survival rates, making it a hot topic in basic research and clinical diagnosis. Research has revealed that the human tumor suppressor gene (p53) is one of the most important tumor suppressor genes, playing a crucial role in regulating cell cycle, apoptosis, DNA repair, preventing carcinogenesis, and helping cells repair genetic damage. Abnormal expression of p53 in human tissues and blood is closely associated with the development of cancer. Therefore, rapid and sensitive detection of the p53 gene in biological samples is of great significance for the prevention of early-stage cancer.

[0003] As a new analytical detection technology, photoelectrochemical (PEC) biosensors have been widely used in biology, medicine and other fields in recent years due to their advantages such as simple operation, good stability, and separation of optical signals (input signals) and electrical signals (detection signals) during the detection process, resulting in lower background signals and higher detection sensitivity. The unique charge transfer mechanism between photoactive materials, targets and electrodes under light irradiation involved in the detection process provides a new detection platform for biological analysis. The performance of photoelectrochemical (PEC) biosensors mainly depends on the photoelectric properties of the materials and the DNA signal amplification strategy involved. In order to effectively improve the photocurrent response signal and thus improve the sensitivity, various amplification strategies are usually adopted, such as the design of efficient DNA recycling methods and strategies, the participation of electron donors / acceptors, etc. The synthesis of photoelectric materials with high photoelectric conversion efficiency can also improve the sensitivity of the sensor.

[0004] CdSe is a common photoelectrically active material with high visible light absorption efficiency; however, photogenerated electrons and holes easily recombine, which limits its application in the field of photoelectric sensors.

[0005] Therefore, it is necessary to further improve the photoelectric properties of CdSe, reduce the recombination rate of photogenerated electrons and holes, inhibit the recombination of photogenerated electron-hole pairs between heterojunction materials, and improve the charge separation efficiency of the material, thereby exhibiting excellent light absorption ability and higher photoresponse current response, thereby further constructing a photoelectrochemical (PEC) biosensor for the disease marker (p53) and realizing efficient and sensitive detection of the p53 gene. Summary of the Invention

[0006] In view of this, one object of the present invention is to provide a photoelectrically active heterojunction material; a second object of the present invention is to provide a method for preparing a photoelectrically active heterojunction material; a third object of the present invention is to provide an application of a photoelectrically active heterojunction material in the preparation of a photoelectrochemical biosensor; a fourth object of the present invention is to provide a photoelectrochemical biosensor; a fifth object of the present invention is to provide a method for preparing a photoelectrochemical biosensor; and a sixth object of the present invention is to provide an application of a photoelectrochemical biosensor in the preparation of a detection reagent for detecting a human tumor suppressor gene (p53 gene).

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] 1. A photoelectrically active heterojunction material, comprising MoSe2 and CdSe in a molar ratio of 0.038:0.063.

[0009] 2. A method for preparing the above-mentioned photoelectrically active heterojunction material, the method comprising the following steps:

[0010] (1) Mixing a mixed solution A formed by hydrazine hydrate and selenium powder with a mixed solution B and stirring them to form a homogeneous solution, wherein the mixed solution B is formed by mixing a divalent cadmium ion salt and a molybdate in N,N-dimethylformamide (DMF);

[0011] (2) placing the homogeneous solution in a polytetrafluoroethylene high-pressure reactor and reacting at 180° C. for 12 to 14 hours to obtain a reaction product;

[0012] (3) The reaction product is cooled at room temperature and centrifuged at a speed of 10,000 to 12,000 rpm to obtain a black solid, which is repeatedly washed with deionized water and dried in an oven at 60°C for 12 h to obtain a black powder, which is a photoelectrically active heterojunction material (MC heterojunction material).

[0013] Preferably, the divalent cadmium ion salt is CdCl2, and the molybdate is Na2MoO4.

[0014] Preferably, the mixed solution A is prepared as follows: add selenium powder to hydrazine hydrate, and stir and mix uniformly at 75-80°C;

[0015] The volume molar ratio of the hydrazine hydrate and selenium powder is 5:0.164, mL:mmol.

[0016] Preferably, the mixed solution A is prepared as follows: divalent cadmium ion salt and molybdate are sequentially added to N,N-dimethylformamide (DMF) under vigorous stirring and mixed evenly;

[0017] The molar ratio of the divalent cadmium ion in the divalent cadmium ion salt to the molybdenum ion in the molybdate is 0.038:0.063~0.065.

[0018] Preferably, the volume ratio of the mixed solution A to the mixed solution B is 1:3~3.2.

[0019] 3. Application of the above-mentioned photoelectrically active heterojunction materials in the preparation of photoelectrochemical biosensors.

[0020] 4. A photoelectrochemical biosensor, wherein the glassy carbon electrode of the photoelectrochemical biosensor is modified with the above-mentioned photoelectrically active heterojunction material.

[0021] 5. A method for preparing the above-mentioned photoelectrochemical biosensor, comprising the following steps:

[0022] (1) dropping the above-mentioned photoelectrically active heterojunction material onto the surface of the pretreated glassy carbon electrode, and then dropping gold nanoparticles with a diameter of 16 nm to modify the surface to obtain a modified electrode;

[0023] (2) sequentially adding the AuNPs solution and the PBS buffer solution of H1 dimer to the surface of the modified electrode in step (1), assembling the H1 dimer on the surface of the modified electrode in step (1) through the Au-S bond, wherein the H1 dimer is formed by self-hybridization of the specific tail sequence of H1, wherein the 5' end of H1 is modified with a thiol (SH) group and the nucleotide sequence of H1 is as shown in SEQ ID NO. 1;

[0024] (3) The nonspecific adsorption sites of the modified electrode obtained in step (2) were blocked with 1% by mass of mercaptohexanol, and then washed with deionized water for 30 to 40 minutes to obtain a photoelectrochemical biosensor.

[0025] 6. Use of the above-mentioned photoelectrochemical biosensor in the preparation of a detection reagent for detecting a human tumor suppressor gene (p53 gene), the nucleotide sequence of which is shown in SEQ ID NO. 7.

[0026] The beneficial effects of the present invention are:

[0027] 1. The present invention discloses a photoelectrically active heterojunction material, which mainly forms a photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material) by adding MoSe2 material to CdSe material. This can further improve the photoelectric performance of CdSe and reduce the recombination rate of photogenerated electrons and holes. At the same time, due to the mutual matching of the valence band and conduction band between the materials, the recombination of photogenerated electron-hole pairs between the heterojunction materials is significantly inhibited, thereby improving the charge separation efficiency of the material, thereby exhibiting excellent light absorption capacity and high photoresponse current response, and has good application prospects in the preparation of photoelectrochemical biosensors.

[0028] 2. The present invention also discloses a photoelectrochemical biosensor. Based on a highly photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material) combined with a clamped hybrid chain reaction (c-HCR) nucleic acid amplification strategy, a "signal-on" PEC biosensor based on target-triggered DNA nanonet formation and thionine sensitization is constructed for highly sensitive detection of the biomarker human tumor suppressor gene (p53 gene). Specifically, a human tumor suppressor gene (p53 gene) with excellent interfacial charge transfer ability is first added as a substrate material onto a pretreated electrode surface to obtain a certain initial photocurrent signal. Then, a layer of AuNPs is drop-coated for H1 polymer (formed by self-hybridization of a specific tail sequence of H1, wherein the 5' end of H1 is modified with a thiol (SH) group and the nucleotide sequence of H1 is as shown in SEQ ID The researchers fixed the nanostructured DNA (shown in Figure 1) with a molecule (H1) and used HT to block nonspecific active sites. p53 was introduced to trigger the c-HCR reaction between H1 aggregates and H2. This in situ-triggered c-HCR hybridization chain reaction rapidly and efficiently formed a large number of DNA nanonets. Finally, thionine was immobilized within the double-stranded DNA of the nanonets. Thionine not only acts as a mediator to promote electron conduction through the helical structure of double-stranded DNA, improving DNA conductivity, but also increases light energy utilization and promotes charge separation in the MC, thereby significantly enhancing the photocurrent signal. This "signal-on" PEC biosensor, based on standard-triggered DNA nanonet formation and thionine-sensitization, possesses the advantages of self-initiation, high specificity, and in situ triggering, effectively improving sensor sensitivity and successfully detecting fragments of the human tumor suppressor gene (p53 gene).

[0029] Other advantages, objects, and features of the present invention will be described in part in the following description and, in part, will be apparent to those skilled in the art upon examination of the following description or may be learned from practice of the present invention. The objects and other advantages of the present invention may be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below with reference to the accompanying drawings, in which:

[0031] Figure 1 A is the XPS spectrum of the MC heterojunction material prepared in Example 1, B is the 3d 5 / 2 and 3d 3 / 2 orbital characterization corresponding to 52.62 eV and 53.56 eV, respectively, C is the 3d 5 / 2 and 3d 3 / 2 orbital characterization corresponding to Mo at 227.52 eV and 230.11 eV, respectively, and D is the 3d peaks at 403.81 eV and 410.57 eV derived from Cd element characterization;

[0032] Figure 2 Figure A shows the preparation process of the photoelectrochemical biosensor, and Figure B shows the formation process of the in situ triggered DNA nanonet.

[0033] Figure 3 A is the PEC characterization of the step-by-step construction process of the sensor preparation in Example 2, B is the CV characterization of the step-by-step construction process of the sensor preparation in Example 2, and C is the EIS characterization of the step-by-step construction process of the sensor preparation in Example 2, where a is bare GCE, b is dropwise addition of MC, c is dropwise addition of AuNPs, d is immobilized H1 dimer, e is immobilized HT, f is DNA nanonet, and g is incubated thionine;

[0034] Figure 4 The detection results of p53 by the photoelectrochemical (PEC) biosensor prepared in Example 2 (A) and the corresponding linear equation (B);

[0035] Figure 5 Selectivity (A) and stability (B) detection of the photoelectrochemical (PEC) biosensor prepared in Example 2;

[0036] Figure 6 This is the signal response mechanism of the photoelectrochemical biosensor prepared in Example 2. DETAILED DESCRIPTION

[0037] The following describes the embodiments of the present invention by means of specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments are only schematic illustrations of the basic concept of the present invention, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0038] The raw materials used in the following examples were obtained from the following sources: selenium powder (Se), cadmium chloride (CdCl2), and sodium molybdate dihydrate (Na2MoO4·2H2O) were purchased from Chongqing Chuandong Chemical Co., Ltd. (Chongqing, China); dimethylformamide (DMF) was purchased from Sigma (St. Louis, MO, USA); chloroauric acid (HAuCl4·4H2O) and mercaptoethanol (HT) were purchased from Chengdu Kelong Co., Ltd. (Chengdu, China); [Fe(CN)6] 3− / 4− Electrolyte (pH 7.0, 5.0 mmol·L -1 ) is 5.0 mmol·L -1 K4[Fe(CN)6], 0.1 mol·L -1 KCl and 5.0 mmol·L -1 K3[Fe(CN)6] was dissolved in PBS (pH 7.0, 0.1 mol·L -1 ). Tris-HCl buffer solution (pH = 7.4) is obtained by mixing 140 mmol·L -1 NaCl, 20 mmol·L -1 Tris, 1 mmol L -1 CaCl2, 5 mmol·L -1 KCl and 1 mmol·L -1 MgCl2 solution was mixed and phosphate buffer solution (PBS, pH 7.0, 0.1 mol·L -1 ) is 0.1 mol·L -1 KH2PO4, 0.1 mol·L -1 KCl and 0.1 mol·L -1 Prepare Na2HPO4 solution by mixing.

[0039] The H1, H2, miRNA-141, miRNA-203A, miRNA-21, Covid-19, and p53 involved in the following examples are all artificially synthesized and provided by Sangon Biotech (Shanghai) Co., Ltd., wherein the nucleotide sequences of H1, H2, MiRNA-141, miRNA-203A, miRNA-21, Covid-19, and human tumor suppressor gene (p53 gene) are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7, respectively:

[0040] H1: 5'- sh-aaaaaaaaggatcgcgatccgagtcttccagtgtgatgaaagatacatcgtcatcacactgga -3' (SEQ ID NO. 1);

[0041] H2: 5'-Tcatcacactggaagactcttttccagtgtgatgacgatgtatctttgaggttta-3' (SEQ ID NO. 2);

[0042] miRNA-141: 5'-taacactgtctggtaaagatgg-3' (SEQ ID NO.3);

[0043] miRNA-203A: 5'- agtggttcttaacagttcaacagtt -3' (SEQ ID NO.4);

[0044] miRNA-21: 5'-tagcttatcagactgatgttg -3' (SEQ ID NO.5);

[0045] Covid-19: 5'-acaccaaaagatcacattgg-3' (SEQ ID NO.6);

[0046] P53: 5'-tcatcacactggaagactc-3' (SEQ ID NO. 7).

[0047] In the following examples, PEC (photoelectrochemical) related measurements were performed by a PEC workstation (Ivium, The Netherlands) at a potential of 0.0 V and a wavelength of 460 nm using a conventional three-electrode system. 3− / 4− Cyclic voltammetry (CV) measurements were performed in solution using a CHI660e electrochemical workstation (Shanghai Chenhua Instruments, China) at a potential of −0.2 to 0.6 V and a scan rate of 100 mV / s; in 1% HAuCl4 ( w / v Au nanoparticles (depAu) were electrodeposited in aqueous solution at a constant potential of -0.2 V for 15 s. The morphology of the planar DNA tripod was investigated by atomic force microscopy (AFM, s-4800, Hitachi, Japan). In addition, the shapes of the DNA nanospheres were characterized by scanning electron microscopy (SEM, S-4800, Hitachi, Japan) and AFM. The different DNA structures were characterized by BGver MIDI electrophoresis instrument (Baygene, Beijing, China) and Doc XR +Gel images were captured using a 12% gel electrophoresis system (Bio-Rad, California, USA). The gel concentration used was 12%.

[0048] Example 1

[0049] A photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material) is prepared by the following method:

[0050] (1) First, 5 mL of hydrazine hydrate was transferred to a three-necked flask, and 0.164 mmol of selenium powder was added and mixed. The resulting mixture was stirred at 80 °C for 60 min and was labeled as solution A.

[0051] (2) Next, 0.0380 mmol CdCl2 and 0.0630 mmol Na2MoO4·2H2O were added to 15 mL DMF under stirring at 600–800 rpm, labeled as solution B.

[0052] (3) After solution A and solution B were cooled to room temperature, solution A and solution B were mixed and stirred for 10 min, and then placed in a 50 mL polytetrafluoroethylene autoclave and reacted at 180 °C for 12 h to obtain a reaction product;

[0053] (4) Finally, the reaction product was washed three times with deionized water and dried in an oven at 60°C for 12 h to obtain a black powder, which is the photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material).

[0054] The chemical valence states of Mo, Se and Cd were tested by X-ray photoelectron spectroscopy (XPS). The full spectrum of the measured spectrum of the photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material) prepared above is as follows: Figure 1 As shown in A; Figure 1 Figure B shows that 52.62 eV and 53.56 eV correspond to the 3d 5 / 2 and 3d 3 / 2 orbitals of Se, respectively, indicating that the valence of Se in the heterojunction is −2; Figure 1 The C in the figure shows that 227.52 eV and 230.11 eV correspond to the 3d 5 / 2 and 3d 3 / 2 orbitals of Mo, respectively, confirming that the Mo element in the heterojunction is Mo. 4+ In addition, Figure 1 The 3d peaks at 403.81eV and 410.57eV in D are derived from the Cd element. In summary, Figure 1 The XPS spectrum in the figure verifies the successful construction of the photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material).

[0055] Example 2

[0056] The photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material) prepared in Example 1 was used to construct a photoelectrochemical biosensor (the corresponding preparation process is as follows Figure 2 The specific construction method is as follows:

[0057] (1) Preparation of H1 dimer: 2 μmol·L -1 H1 (the 5' end of H1 is modified with a sulfhydryl group (SH) and the nucleotide sequence of H1 is shown in SEQ ID NO. 1) was hybridized at 37°C for 2 h to form an H1 dimer, and the obtained H1 dimer was stored in a refrigerator at 4°C until use.

[0058] (2) Subsequently, the glassy carbon electrode (GCE) was polished with polishing powder, and then ultrasonicated with water and ethanol several times to clean the surface. A uniformly mixed MC aqueous solution (10 μL, 0.2 mg mL -1 Specifically, the photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material) prepared in Example 1 is dissolved in water and stirred evenly) and drop-coated onto the surface of the cleaned glassy carbon electrode and dried at 37°C to obtain a uniform thin film to obtain a modified electrode.

[0059] (3) Then, 10 μL of AuNPs solution with a particle size of 16 nm was added to the surface of the modified electrode, and H1 dimer (10 μL, 0.2 μmol·L-1) was added to the surface of the modified electrode and incubated at 4°C for 10 h to fix it on the surface of the modified electrode through gold-sulfur (Au-S) bonds.

[0060] (4) Blocking nonspecific binding sites: Add HT (10 μL, 2 mmol·L -1 ) onto the electrode surface treated in step (3), and incubated at 4°C for 40 min to obtain the photoelectrochemical biosensor.

[0061] The following hybridization reaction is used to study the corresponding process (DNA nanonet is generated when the target is present, and this process does not occur when there is no target) (the process is as follows Figure 2 As shown in B): When H1 (4 μL, 2 μmol·L -1 )、H2(4 μL, 2 μmol·L -1 ) and p53 gene (4 μL, 0.1 pmol·L -1 ) was added to the electrode surface and hybridized for 4 h at room temperature to obtain the DNA nanonet. Finally, thionine (10 μL, 1 mg mL -1) was added dropwise to the electrode surface and incubated at 37°C for 2 h to immobilize it in the double-stranded structure of the DNA network (in order to remove the unreacted reagent, the electrode was washed with deionized water after each step of the construction process).

[0062] The determination of PEC, CV and EIS signals can be used to characterize the construction process of the sensor, and the results are as follows Figure 3 As shown, A is the PEC characterization of the step-by-step construction process of the sensor preparation in Example 2, B is the CV characterization of the step-by-step construction process of the sensor preparation in Example 2, and C is the EIS characterization of the step-by-step construction process of the sensor preparation in Example 2 (where a is bare GCE, b is dropwise added MC, c is dropwise added AuNPs, d is immobilized H1 dimer, e is immobilized HT, f is DNA nanonet, and g is incubated thionine).

[0063] like Figure 3 As shown in Figure (A), the photocurrent signal of the bare GCE is nearly zero (curve a). After the addition of MC (curve b), the photocurrent signal increases significantly. Due to the excellent conductivity of AuNPs, the photocurrent signal further increases with the addition of AuNPs (curve c). However, with the immobilization of H1 dimers (curve d) and HT (curve e) on the electrode surface and the formation of the DNA nanomesh (curve f), the photocurrent signal decreases. After incubation of thionine on the electrode, thionine is embedded in the double strands of the DNA nanomesh, promoting charge separation and significantly increasing the photocurrent signal (curve g).

[0064] like Figure 3 The CV curves, shown in Figure B, also demonstrate the successful construction of the sensor. Bare GCE exhibits a well-defined redox peak (curve a). After MC modification, the peak current decreases slightly (curve b). Modification with AuNPs increases the peak current (curve c). The introduction of H1 dimer, HT, and DNA nanomesh sequentially decreases the peak current (curves d, e, and f, respectively). This is primarily due to the negative charge on the DNA surface, which is not conducive to the [Fe(CN)6] 3- / 4- Finally, the peak current increased significantly (curve g) because thionine acted as a mediator to promote electron conduction through the helical structure of double-stranded DNA.

[0065] Figure 3The impedance of the bare GCE shown in Figure C is low (curve a). Modification with MC increases the impedance (curve b). Subsequent modification with AuNPs promotes electron transfer, resulting in a corresponding decrease (curve c). The introduction of H1 dimer (curve d), HT (curve e), and DNA nanomesh (curve f) sequentially increases the impedance, primarily due to steric hindrance from DNA and HT hindering electron transfer. Finally, the addition of thionine significantly decreases the impedance (curve g). In summary, all three photoelectrochemical characterization techniques demonstrate the successful construction of a "signal-on" PEC biosensor based on target p53-triggered DNA nanomesh generation.

[0066] Performance testing

[0067] The photoelectrochemical biosensor prepared in Example 2 was used to test the PEC signal using a three-electrode system. The working electrode was scanned off-on-off (10 s-20 s-10 s) in a PBS (pH = 7.0) buffer solution containing 50.1 mmol ascorbic acid in the range of 0 V (vs. Hg / HgCl2), and the stable PEC response value obtained by the scan was recorded.

[0068] Figure 4 A in the figure shows the photocurrent signal of the sensor when different concentrations of target (human tumor suppressor gene (p53 gene)) are introduced. -1 ~100 pmol·L -1 In the range of , the photocurrent signal increases with the increase of p53 concentration, showing a good linear relationship (such as Figure 4 The linear equation of the calibration curve obtained after data processing is I = 0.52043 lg (cp53) + 2.882, with a correlation coefficient r = 0.99 (where I represents the PEC signal, c represents the concentration of the target p53, and the detection limit is 0.33 fmol·L -1 (S / N=3)).

[0069] Selective detection of photoelectrochemical (PEC) biosensor: using interferor miRNA-14 (100 pmol·L -1 ), miRNA-203A (100 pmol·L -1 )、miRNA-21(100 pmol·L -1 ), Covid-19 (100 pmol·L -1) was used to replace the target p53 to test the selectivity of the sensor prepared in Example 2. The incubated electrode was used to test the PEC signal (also using a three-electrode system: the working electrode was scanned off-on-off (10s-20s-10s) in a PBS (pH=7.0) buffer solution containing 50.1mmol ascorbic acid, with a scanning voltage range of 0V (vs. Hg / HgCl2), and the stable PEC response value obtained by the scan was recorded. Each interferent was measured three times to evaluate the selectivity of the prepared photoelectrochemical sensor. The results are shown in Figure 2. Figure 5 As shown in Figure A, even when the concentration of the target and the interfering substance is 1:100, the change in the photocurrent signal generated by the interfering substance is negligible, but the PEC signal of the target with a lower concentration (1 pmol·L-1) is sharply enhanced, indicating that the sensor prepared in Example 2 has good selectivity for p53.

[0070] Stability test of photoelectrochemical (PEC) biosensor: The photoelectrochemical biosensor prepared in Example 2 was used to test the PEC signal (using a three-electrode system: the working electrode was scanned off-on-off (10s-20s-10s) for 8 cycles in a PBS (pH=7.0) buffer solution containing 0.1 mmol ascorbic acid, with a scanning voltage range of 0V (vs. Hg / HgCl2), and the changes in the PEC signal obtained by the scanning were recorded, as shown in FIG. Figure 5 As shown in Figure B, the PEC signal of the electrode does not change much under multiple on-off-on irradiation, and the relative standard deviation (RSD) of the PEC signal measured over 8 cycles is 2.68%, indicating that the sensor prepared in Example 2 has good stability.

[0071] The photoelectrochemical (PEC) biosensor prepared in Example 2 was used for detection of actual samples: The standard addition method was used to explore the detection performance of the sensor prepared in Example 2 on actual samples to evaluate the specific value of the photoelectrochemical biosensor prepared in Example 2 in practical applications. The specific method is as follows: First, a 10-fold diluted human serum sample was used instead of Tris-HCl buffer to dilute the target (p53 gene) to the following concentration: 1 fmol·L -1 、10 fmol·L -1 、100 fmol·L -1 , 1 pmol·L -1The PEC signal was then measured using the PEC biosensor prepared in Example 2. The calculation results are shown in Table 1. The spike recovery rate was in the range of 95.2% to 107%, and the relative standard deviation (RSD) was between 1.1% and 2.1%. The good spike recovery rate and low relative standard deviation both demonstrate the potential and broad application prospects of the sensor prepared in Example 2 in actual detection.

[0072] Table 1 Detection performance of the photoelectrochemical biosensor prepared in Example 2 for target substances in human serum

[0073]

[0074] Under the irradiation of excitation light, the electrons in the MoSe2 / CdSe material absorb energy and jump to the conduction band, generating photogenerated electron-hole pairs. Due to the matching band structure, the electrons in the MoSe2 conduction band migrate to the CdSe conduction band, while the holes in the CdSe valence band migrate to the MoSe2 valence band. The generation and rapid transfer of photogenerated electrons generate photocurrent (such as Figure 6 shown).

[0075] In summary, the present invention discloses a photoelectrically active heterojunction material, which mainly forms a photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material) by adding MoSe2 material to CdSe material. This can further improve the photoelectric performance of CdSe and reduce the recombination rate of photogenerated electrons and holes. At the same time, due to the mutual matching of the valence band and conduction band between the materials, the recombination of photogenerated electron-hole pairs between the heterojunction materials is significantly inhibited, thereby improving the charge separation efficiency of the material and thus exhibiting excellent light absorption capacity and high photoresponse current response, which has good application prospects in the preparation of photoelectrochemical biosensors. In addition, the present invention also discloses a photoelectrochemical biosensor. Based on a highly photoelectrically active heterojunction material (MoSe2 / CdSe, i.e., MC heterojunction material) combined with a clamped hybrid chain reaction (c-HCR) nucleic acid amplification strategy, a "signal-on" type PEC biosensor based on target-induced DNA nanonet formation and thionine sensitization is constructed for highly sensitive detection of the biomarker human tumor suppressor gene (p53 gene). Specifically, a human tumor suppressor gene (p53 gene) with excellent interfacial charge transfer ability is first added as a substrate material to a pretreated electrode surface to obtain a certain initial photocurrent signal. Then, a layer of AuNPs is drop-coated for H1 polymer (formed by self-hybridization of the specific tail sequence of H1, wherein the 5' end of H1 is modified with a thiol (SH) group and the nucleotide sequence of H1 is as shown in SEQ ID 1), HT was used to block nonspecific active sites, and p53 was introduced to trigger the c-HCR reaction between H1 aggregates and H2. Through the in situ triggered c-HCR hybridization chain reaction, a large number of DNA nanomeshes were rapidly and efficiently formed. Finally, thionine was immobilized on the double-stranded DNA of the nanomesh. Thionine not only acts as a mediator to promote electron conduction through the helical structure of double-stranded DNA, improving DNA conductivity, but also increases light energy utilization and promotes charge separation in MC, thereby significantly enhancing the photocurrent signal. This "signal-on" PEC biosensor based on standard-triggered DNA nanomesh formation and thionine sensitization has the advantages of self-initiation, high specificity, and in situ triggering, effectively improving sensor sensitivity and successfully realizing the detection of p53 gene fragments. The present invention uses MC with high photoelectric conversion efficiency as the substrate material, amplifies the target through the c-HCR strategy, and sensitizes the substrate material with the organic dye thionine immobilized on the double-stranded DNA of the hybridized nanomesh, significantly enhancing the photocurrent signal and achieving highly sensitive detection of the target p53. The linear range of the sensor detection platform is 1 fmol·L -1 -100 pmol·L -1 , the detection limit is as low as 0.33fmol·L -1, has good selectivity and stability, has certain application potential in early cancer diagnosis, and provides a new method for the detection of disease markers.

[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for preparing a photoelectrochemical biosensor, characterized in that: The preparation method comprises the following steps: (1) dropping a photoelectrically active heterojunction material onto the surface of a pretreated glassy carbon electrode, and then dropping gold nanoparticles with a diameter of 16 nm to modify the surface to obtain a modified electrode; the photoelectrically active heterojunction material is composed of MoSe2 and CdSe in a molar ratio of 0.038:0.063; (2) sequentially adding the AuNPs solution and the PBS buffer solution of H1 dimer to the surface of the modified electrode in step (1), assembling the H1 dimer on the surface of the modified electrode in step (1) through the Au-S bond, wherein the H1 dimer is formed by self-hybridization of the specific tail sequence of H1, wherein the 5' end of H1 is modified with a thiol group and the nucleotide sequence of H1 is as shown in SEQ ID NO.1; (3) The nonspecific adsorption sites of the modified electrode obtained in step (2) were blocked with 1% by mass of mercaptohexanol, and the human tumor suppressor gene p53 was introduced to trigger the c-HCR reaction between H1 polymer and H2 to form a DNA nanonet. Then, thionine was immobilized in the double-stranded DNA of the nanonet. After blocking for 30 to 40 minutes, it was washed with deionized water. Based on the photoelectrically active heterojunction material combined with the c-HCR nucleic acid amplification strategy, a photoelectrochemical biosensor was obtained.

2. The method for preparing the photoelectrochemical biosensor according to claim 1, characterized in that: The photoelectrically active heterojunction material is prepared by the following steps: (1) Mixing a mixed solution A formed by hydrazine hydrate and selenium powder with a mixed solution B and stirring to form a homogeneous solution, wherein the mixed solution B is formed by mixing a divalent cadmium ion salt and a molybdate in N,N-dimethylformamide; (2) placing the homogeneous solution in a polytetrafluoroethylene high-pressure reactor and reacting at 180° C. for 12 to 14 hours to obtain a reaction product; (3) The reaction product was cooled at room temperature and centrifuged at a speed of 10,000 to 12,000 rpm to obtain a black solid, which was repeatedly washed with deionized water and dried in an oven at 60°C for 12 h to obtain a black powder, which is a photoelectrically active heterojunction material.

3. The method for preparing the photoelectrochemical biosensor according to claim 2, wherein: The divalent cadmium ion salt is CdCl2, and the molybdate is Na2MoO4.

4. The method for preparing the photoelectrochemical biosensor according to claim 2, wherein: The mixed solution A was prepared as follows: selenium powder was added to hydrazine hydrate, and the mixture was stirred at 75-80° C. to mix evenly; the volume molar ratio of hydrazine hydrate to selenium powder was 5:0.164 mL:mmol.

5. The method for preparing the photoelectrochemical biosensor according to claim 2, wherein: The mixed solution A is prepared according to the following method: a divalent cadmium ion salt and a molybdate are sequentially added to N,N-dimethylformamide under vigorous stirring and mixed evenly; the molar ratio of the divalent cadmium ions in the divalent cadmium ion salt to the molybdenum ions in the molybdate is 0.038:0.063~0.

065.

6. The method for preparing the photoelectrochemical biosensor according to claim 2, wherein: The volume ratio of the mixed solution A to the mixed solution B is 1:3-3.

2.

7. A photoelectrochemical biosensor, characterized in that The sensor is prepared by the method according to any one of claims 1 to 6.

8. Use of the photoelectrochemical biosensor according to claim 7 in the preparation of a detection reagent for detecting human tumor suppressor genes, characterized in that: The nucleotide sequence of the human tumor suppressor gene is shown in SEQ ID NO.7.

Images