Primer Sets for Amplification of Nearly Full-Length HIV-1 Genome and Sequencing Method

Abstract

The present invention discloses a primer set for amplifying a nearly full-length genome of HIV-1, comprising a sequence shown in SEQ ID NO.1-SEQ ID NO.8, and a high-sensitivity amplification method using the primer set. The primer set of the present invention is suitable for amplifying a nearly full-length genome of a common HIV-1 epidemic strain in my country, with a wide subtype coverage and a high amplification success rate. The PCR product successfully amplified by the present invention can be analyzed by first-generation and second-generation sequencing technologies to obtain a nearly full-length genome sequence of HIV-1, which can be used for subtype identification, drug resistance analysis, minor variation analysis, and phylogenetic tree analysis of HIV-1 strains and other related studies.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a primer set for amplifying HIV-1 genome, and a related amplification and sequencing method and kit. Background Art

[0002] HIV-1 is a retrovirus that relies on reverse transcriptase (RT) that lacks proofreading function during replication. Therefore, gene mutations often occur, making HIV-1 genes diverse. HIV-1 genotypes are currently divided into four groups: M (main), O (outlier), N (non-M-non-O), and P. HIV-1 M group is currently prevalent worldwide. This group can be further divided into 10 subtypes (AD, FH, J, K, L) and 132 circulating recombinant forms (CRF) reported so far, as well as dozens of unique recombinant forms (URF). The continuous emergence of new strains poses a major challenge to the molecular monitoring, diagnosis, and treatment of HIV-1.

[0003] The full length of the HIV-1 genome is 9.7kb, but most current HIV-1 sequencing methods are limited to partial gene sequences (such as gag, env, and pol regions). Fragmented sequencing methods may obscure the identification results of subtypes, limiting the analysis of epidemiological characteristics and the identification of recombination breakpoints. Obtaining the full-length genome sequence of HIV-1 is an important basis for conducting molecular virology research on HIV-1. It is important for studying the evolution, transmission, and distribution of the virus in a specific population or region, determining new subtypes or prevalent recombinant types, and developing diagnostic reagents and vaccines. In addition, the accuracy of the phylogenetic tree is significantly proportional to the length of the sequence used. Using full-length sequences to construct a phylogenetic tree will help to more accurately analyze HIV-1 transmission relationships.

[0004] At present, the sequence characteristics of the near full-length genome (NFLG) are an important basis for the complete definition of the HIV-1 virus. HIV-1 near-full-length genome sequencing technology relies on an effective long-chain PCR amplification method to increase the viral gene content through amplification to reach the amount required for sequencing. Due to the difficulty of denaturing longer DNA templates and the decrease in activity of Taq enzymes during long-fragment PCR reactions, the success rate of long-fragment PCR amplification methods is low, and the HIV-1 genome has large variations, which usually makes it very difficult to amplify the HIV-1 near-full-length genome.

[0005] At present, the HIV-1 near-full-length genome mainly includes the following: ① Single amplicon strategy: Use a pair of primers targeting the 5' non-coding region and the 3' non-coding region to amplify the HIV-1 near-full-length genome sequence in a single PCR reaction, but this method is difficult to amplify and has a low amplification success rate. ② Double amplicon strategy: Amplify two overlapping half-genome sequences. The first sequence is usually composed of the gag gene and part of the pol gene, and the second sequence usually includes the env and nef genes. The overlapping parts of the two half-genomes are often auxiliary genes (vif, vpr, vpu), and the near-full-length genome sequence is spliced. The double amplicon strategy has a higher amplification success rate than the single amplicon strategy. ③ Multi-amplicon strategy: Select three to five overlapping amplicons from multiple PCR reactions to cover the near-full-length genome. Although the success rate of multi-fragment amplification PCR has been improved, there are also problems such as increased difficulty in later splicing and increased reaction costs.

[0006] The existing amplification primers are designed based on the genome of foreign epidemic strains. Due to the sequence differences between domestic and foreign HIV-1 epidemic strains, the success rate of using the existing amplification primers to amplify the sequences of domestic epidemic subtype strains is low, and the sensitivity of the existing HIV-1 near full-length genome amplification method is low. Therefore, the art needs a universal HIV-1 near full-length genome amplification primer set for domestic subtypes and a related amplification and sequencing method with high sensitivity and high success rate. Summary of the invention

[0007] In order to solve the defects of the existing amplification methods, the inventors have repeatedly studied and analyzed the HIV-1 gene sequences in China, and provided a set of HIV-1 nearly full-length genome amplification primer set sequences for domestic subtypes, and provided a highly sensitive and high success rate HIV-1 nearly full-length genome amplification and sequencing method by optimizing the amplification reaction system and conditions. Thus, the present invention is obtained.

[0008] Therefore, in a first aspect, there is provided a primer set for amplifying the HIV-1 genome, comprising:

[0009] A forward primer for the gag-pol fragment, the sequence of which is shown in SEQ ID NO.1;

[0010] A reverse primer for the gag-pol fragment, the sequence of which is shown in SEQ ID NO.2;

[0011] The second round forward primer of the gag-pol fragment, whose sequence is shown in SEQ ID NO.3;

[0012] The second round reverse primer of the gag-pol fragment, whose sequence is shown in SEQ ID NO.4;

[0013] A forward primer for the pol-nef fragment, the sequence of which is shown in SEQ ID NO.5;

[0014] A reverse primer for the pol-nef fragment, the sequence of which is shown in SEQ ID NO.6;

[0015] The second round forward primer of the pol-nef fragment, whose sequence is shown in SEQ ID NO.7; and

[0016] The second-round reverse primer of the pol-nef fragment has a sequence as shown in SEQ ID NO.8.

[0017] In a second aspect, a method for amplifying HIV-1 genome is provided, comprising performing two-stage amplification of HIV-1 genome using the primer set described in the first aspect.

[0018] In a third aspect, a method for sequencing an HIV-1 genome is provided, comprising:

[0019] 1) implementing the method described in the second aspect to obtain gag-pol fragment and pol-nef fragment;

[0020] 2) Sequencing the obtained gag-pol fragment and pol-nef fragment to obtain the HIV-1 genome sequence.

[0021] In a fourth aspect, a kit for amplifying HIV-1 genome is provided, comprising:

[0022] a) the primer set described in the first aspect; and

[0023] b) instructions for use of the kit.

[0024] In a fifth aspect, provided is a use of the primer set of the first aspect in preparing a kit for amplifying or sequencing HIV-1.

[0025] The beneficial effects of the present invention are:

[0026] The present invention provides a set of HIV-1 nearly full-length genome amplification primer set sequences SEQID NO.1-SEQ ID NO.8 that are universal for domestic subtypes, which are suitable for nearly full-length genome amplification of common HIV-1 epidemic strains in my country, and cover a wide range of subtypes, including but not limited to CRF01_AE, CRF07_BC, CRF08_BC, B, CRF55_01B and other subtypes.

[0027] The present invention adopts a dual amplicon technology strategy, obtains a nearly full-length genome sequence by splicing two overlapping regions in the middle, and successfully amplifies. At the same time, compared with the multi-amplicon strategy, this method is easy to operate, only two PCR reaction tubes are needed to achieve the purpose of amplification, and the subsequent sequence splicing process is simple and easy.

[0028] The successfully amplified PCR products of the present invention can be used for first-generation and second-generation sequencing and subsequent analysis of sequencing results, and the obtained nearly full-length genome sequence can be used for HIV-1 virus-related research such as subtype identification, drug resistance analysis, minor variation analysis, and phylogenetic tree analysis of HIV-1 strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the specific implementation of the present invention or the technical solution in the prior art, the drawings required for use in the specific implementation or the description of the prior art will be briefly introduced below.

[0030] Figure 1 Shown are the gel electrophoresis images of the products amplified using four sets of primers.

[0031] Figure 2 The gel electrophoresis diagrams show the target amplification products obtained after reverse transcription using different reverse transcription reagents.

[0032] Figure 3 The depth coverage diagram of the second-generation sequencing of the target amplification product obtained using different reverse transcription reagents is shown, wherein the horizontal axis represents the gene position and the vertical axis represents the second-generation sequencing depth.

[0033] Figure 4 The gel electrophoresis diagrams of the target amplification products obtained using different amplification reagents are shown.

[0034] Figure 5 A depth coverage diagram of the next-generation sequencing of the target amplification product obtained using the amplification reagent is shown, wherein the horizontal axis represents the gene position and the vertical axis represents the second-generation sequencing depth.

[0035] Figure 6 Gel electrophoresis bands of amplified products at different primer concentrations are shown.

[0036] Figure 7 The gel electrophoresis bands of the products obtained by amplifying fragment 1 at different annealing temperatures are shown.

[0037] Figure 8 The gel electrophoresis bands of the products obtained by amplifying fragment 2 at different annealing temperatures are shown.

[0038] Fig. 9 Gel electrophoresis images of amplification products of samples with different viral loads are shown.

[0039] Fig.10The gel electrophoresis diagram of the amplified products of different subtype strains is shown, wherein: Fig.10 A is fragment 1, Fig.10 B is fragment 2.

[0040] Fig.11 Gel electrophoresis diagrams showing amplification products of clinical plasma samples of different subtypes, where: Fig.11 A is fragment 1, Fig.11 B is fragment 2. DETAILED DESCRIPTION

[0041] Hereinafter, the present invention will be described in detail with reference to the accompanying drawings. It should be understood that the following description is only used to illustrate the present invention by way of example, and is not intended to limit the scope of the present invention. The scope of protection of the present invention shall be subject to the attached claims. In addition, those skilled in the art will understand that the technical solution of the present invention may be modified without departing from the spirit and purpose of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter described herein belongs. Before describing the present invention in detail, the following definitions are provided for a better understanding of the present invention.

[0043] Where a numerical range is provided, such as a concentration range, a percentage range, or a ratio range, it is understood that each intervening value to one-tenth of the unit of the lower limit between the upper and lower limits of the range and any other stated or intervening values ​​in the stated range are included in the subject matter unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges, and such embodiments are also included in the subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or two limits, ranges excluding either or both of those included limits are also included in the subject matter.

[0044] In the context of the present invention, many embodiments use the expressions "comprising", "including" or "consisting essentially / mainly of..." The expressions "comprising", "including" or "consisting essentially / mainly of..." can usually be understood as open-ended expressions, indicating that in addition to the elements, components, assemblies, method steps, etc. specifically listed after the expression, other elements, components, assemblies, method steps, etc. are also included. In addition, in this article, the expressions "comprising", "including" or "consisting essentially / mainly of..." can also be understood as closed expressions in some cases, indicating that only the elements, components, assemblies, method steps specifically listed after the expression are included, and no other elements, components, assemblies, method steps are included. At this time, the expression is equivalent to the expression "consisting of..."

[0045] In order to better understand the present teachings and not to limit the scope of the present teachings, unless otherwise indicated, all numbers and other numerical values ​​used in the specification and claims indicating quantities, percentages or ratios should be understood as being modified by the term "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values, which may vary depending on the desired properties sought to be obtained. At a minimum, each numerical parameter should at least be interpreted in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0046] In a first aspect, a primer set for amplifying an HIV-1 genome is provided, comprising:

[0047] A forward primer for the gag-pol fragment, the sequence of which is shown in SEQ ID NO.1;

[0048] A reverse primer for the gag-pol fragment, the sequence of which is shown in SEQ ID NO.2;

[0049] The second round forward primer of the gag-pol fragment, whose sequence is shown in SEQ ID NO.3;

[0050] The second round reverse primer of the gag-pol fragment, whose sequence is shown in SEQ ID NO.4;

[0051] A forward primer for the pol-nef fragment, the sequence of which is shown in SEQ ID NO.5;

[0052] A reverse primer for the pol-nef fragment, the sequence of which is shown in SEQ ID NO.6;

[0053] The second round forward primer of the pol-nef fragment, whose sequence is shown in SEQ ID NO.7; and

[0054] The second-round reverse primer of the pol-nef fragment has a sequence as shown in SEQ ID NO.8.

[0055] The specific sequence is as follows:

[0056] SEQ ID NO.1:AAATCTCTAGCAGTGGCGCCCGAACAG

[0057] SEQ ID NO.2:GAATTTCCCTGTTCTCTGCCAATTC

[0058] SEQ ID NO.3:GCGGAGGCTAGAAGGAGAGAGATGG

[0059] SEQ ID NO.4:TTTTCCCACTAATTTCTGTATATCATTGACA

[0060] SEQ ID NO.5: AGAAATTGCAGGGCCCCTAGGAA

[0061] SEQ ID NO.6: GCACTCAAGGCAAGCTTTATTGAGGCTT

[0062] SEQ ID NO.7: AGANCAGAGCCAACAGCCCCACCA

[0063] SEQ ID NO.8:GTGTGTAGTTKTGCCAATCAGGGAA

[0064] In the above primer sequences, A represents adenine, G represents guanine, C represents cytosine, T represents thymine, R represents A / G, Y represents C / T, M represents A / C, K represents G / T, S represents C / G, W represents A / T, H represents A / T / C, B represents G / T / C, V represents G / A / C, D represents G / A / T, and N represents A / T / C / G.

[0065] In the present invention, the HIV-1 genome sequence is divided into two fragments, the first fragment is the gag-pol region, which is located at 769bp-3338bp relative to the HIV-1 standard strain (HXB2); the second fragment is the pol-nef region, which is located at 2143bp-9181bp relative to the HIV-1HXB2 strain. The "two-segment" PCR amplification is adopted, and the primers shown in SEQ ID NO.1-SEQ ID NO.4 are subjected to two rounds of PCR to obtain fragment 1 (gag-pol), and the primers shown in SEQ ID NO.5-SEQ ID NO.8 are subjected to two rounds of PCR to obtain fragment 2 (pol-nef). Thus, two fragments with overlapping regions are obtained, and after splicing, the nearly full-length genome sequence of HIV-1 can be obtained.

[0066] This "two-stage" amplification can also be referred to as a "double-amplicon strategy" in the context of the present invention. The present invention adopts a double-amplicon strategy to obtain a nearly full-length genome sequence of HIV-1 by splicing the overlapping regions between the two fragments. Compared with the multi-amplicon strategy, this method is easy to operate, only two PCR reaction tubes are needed to achieve the purpose of amplification, and the subsequent sequence splicing analysis is easy. It can be understood that the HIV-1 genome sequence obtained by the present invention is not the full-length sequence of the HIV-1 genome, but only includes about 86% of the HIV-1 genome sequence, so it is also called a nearly full-length genome sequence.

[0067] In a second aspect, a method for amplifying HIV-1 genome is provided, comprising performing two-stage amplification of HIV-1 genome using the primer set described in the first aspect.

[0068] In a specific embodiment, the method comprises the following steps:

[0069] a. Provide HIV-1 RNA;

[0070] b. reverse transcribing the HIV-1 RNA into cDNA;

[0071] c. Using the cDNA as a template, the primer set described in the first aspect is used to perform two-stage PCR amplification on the HIV-1 genome to obtain a gag-pol fragment and a pol-nef fragment.

[0072] It is understood that the HIV-1 RNA sample used in the context of the present invention can be from any source, for example, from a blood sample such as whole blood, serum, plasma, dried blood spots, etc., from a body fluid sample such as secretions, etc., or it can be a sample artificially synthesized based on a known nucleic acid sequence. In addition, it is also understood that the HIV-1 RNA can be extracted and obtained by conventional nucleic acid extraction techniques in the art, and the present invention has no special restrictions on nucleic acid extraction methods and reagents.

[0073] Therefore, in a specific embodiment, HIV-1 RNA can be provided by extracting HIV-1 RNA from a blood sample, a body fluid sample, or a sample artificially synthesized based on a known nucleic acid sequence.

[0074] In a preferred embodiment, the viral load in the sample is at least 10 4 copies / mL.

[0075] In yet another specific embodiment, reverse transcription can be performed using SuperScript III First-Strand reverse transcription reagents.

[0076] In a specific embodiment, the PCR amplification may be nested PCR amplification. Nested PCR uses two sets of primers to amplify specific DNA fragments through two rounds of PCR reactions.

[0077] In yet another specific embodiment, the concentration of each primer in the PCR amplification reaction can be 0.4-1.2 μM.

[0078] In a preferred embodiment, the concentration of each primer in the PCR amplification reaction may be 0.4 μM.

[0079] In yet another specific embodiment, the temperature of the annealing step in the PCR amplification reaction can be 49.8°C-58°C.

[0080] In a preferred embodiment, the temperature of the annealing step in the PCR amplification reaction of the fragment 1 can be 53°C, and the temperature of the annealing step in the PCR amplification reaction of the fragment 2 can be 55°C.

[0081] In a further preferred embodiment, PrimeSTAR GXL DNA polymerase amplification reagent may be used to perform PCR amplification.

[0082] Other reagents required in the amplification reaction of the present invention, such as buffer, dNTP, etc., can use commonly used reagents in the art, and the present invention has no particular limitation on this.

[0083] It can be understood that the method of the present invention for amplifying the nearly full-length genome of HIV-1 can be used for diagnostic purposes or for "non-diagnostic purposes", wherein the "non-diagnostic purposes" include but are not limited to HIV-1 strain resistance analysis, minor variation analysis, and phylogenetic tree analysis and other HIV virus-related research, inspection and quarantine, etc.

[0084] The inventors of the present invention have concluded through repeated studies that the HIV-1 genome amplification primer set of the present invention can be used for nearly full-length genome amplification of common HIV-1 strains prevalent in my country, such as CRF01_AE, CRF07_BC, CRF08_BC, B, CRF55_01B and other subtypes, and covers a wide range of subtypes. Therefore, compared with existing methods, the primer set is more suitable for the inspection and quarantine of HIV-1 diseases in my country.

[0085] In a third aspect, a method for sequencing an HIV-1 genome is provided, comprising:

[0086] 1) implementing the method described in the second aspect to obtain gag-pol fragment and pol-nef fragment;

[0087] 2) Sequencing the obtained gag-pol fragment and pol-nef fragment to obtain the nearly full-length genome sequence of HIV-1.

[0088] It can be understood that the PCR products amplified using the primer set of the present invention can be used for first-generation and second-generation sequencing and subsequent analysis of sequencing results, and the obtained near-full-length genome sequence can be used for HIV-1 virus-related research such as HIV-1 strain subtype identification, drug resistance analysis, minor variation analysis, and phylogenetic tree analysis.

[0089] In a preferred embodiment, the sequencing can be performed by next-generation sequencing. Those skilled in the art can select specific steps and conditions for next-generation sequencing based on different amplification products, and the present invention has no particular limitation on this.

[0090] It is also understood that the method of the present invention for sequencing the near-full-length genome of HIV-1 can be used for diagnostic purposes or for "non-diagnostic purposes", wherein the "non-diagnostic purposes" include but are not limited to HIV virus-related research (e.g., minor variation analysis of HIV-1 strains, phylogenetic tree analysis, etc.), inspection and quarantine, etc.

[0091] In a fourth aspect, a kit for amplifying HIV-1 genome is provided, comprising:

[0092] a) the primer set described in the first aspect; and

[0093] b) instructions for use of the kit.

[0094] In a fifth aspect, there is provided use of the primer set of the first aspect in preparing a kit for amplifying or sequencing HIV-1 genome.

[0095] Example

[0096] In the following examples, the detection method of HIV-1 of the present invention and the characterization of related properties are shown. Unless otherwise specified, the test methods used are all conventional methods, and unless otherwise specified, the test materials used in the following examples are all conventional reagents purchased from stores. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention.

[0097] It should be noted that the terms used in the specification of the present invention are only for the purpose of describing specific embodiments, and are not intended to limit the present invention. The above summary of the invention and the detailed description below are only for the purpose of specifically explaining the present invention, and are not intended to limit the present invention in any way. Without departing from the spirit and purpose of the present invention, the scope of the present invention is determined by the attached claims.

[0098] Example 1: Design and verification of primers for amplification of HIV-1 near-full-length genome

[0099] All HIV-1 full-length gene sequences in China are retrieved in HIV database database, downloaded and sequence analysis is performed. According to the gene sequence characteristics of domestic popular strains, the present invention selects to adopt double amplicon strategy to amplify HIV-1 nearly full-length genome sequence, and designs to obtain multiple groups of nearly full-length genome amplification primer sets with high gene sequence matching degree of domestic HIV-1 popular subtypes. In the present embodiment, the inventor has listed three primer sets in numerous primer sets of the primer sets (i.e. primer sets of the present invention) that obtain nearly full-length genome amplification success rate through repeated screening and verification and attempted in experiment as a control, and their amplification results are compared to prove the amplification effect of primer sets of the present invention. Concrete primer sequence information is shown in the following table 1, and wherein primer sets 2 is primer sets of the present invention.

[0100] Table 1: Primer sequences

[0101]

[0102]

[0103] The culture supernatant of subtype B strain was used as a sample to verify the availability of the above four primer sets for nearly full-length genome amplification. The specific verification method is as follows:

[0104] (1) Nucleic acid extraction

[0105] The nucleic acid was extracted from the culture supernatant of the strain using the QIAamp Viral RNA Mini Kit (QIAGEN). The operation steps were strictly in accordance with the reagent instructions, and 40 μL of RNA extraction product was finally obtained by elution.

[0106] (2) Reverse transcription

[0107] The extracted RNA was reverse transcribed using a SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) reverse transcription kit, and the reverse transcription primer was a reverse primer of fragment 2. For example, for primer set 2 of the present invention, the reverse transcription primer was primer SEQ ID NO.6, and the reaction system was prepared as shown in Tables 2 and 3. First, the PCR reaction tube containing reaction system one was placed at 65°C for 5 minutes, and then the PCR reaction tube was quickly transferred to an ice box for a cold bath for 1 minute. Subsequently, reaction system two was added to the PCR reaction tube containing reaction system one, mixed thoroughly, and centrifuged briefly, and placed in a PCR instrument to start the reaction program. The reaction program is shown in Table 4.

[0108] Table 2: Reaction system 1

[0109]

[0110] Table 3: Reaction system 2

[0111]

[0112] Table 4: Reverse transcription reaction procedure

[0113]

[0114] (3) Nested PCR amplification: The reverse transcription product cDNA was amplified using the PrimeSTAR GXL DNA polymerase kit (Clontech). The present invention adopts a dual amplicon strategy, requiring the amplification of two gene fragments (fragment 1 and fragment 2) for each sample, which are completed independently in two sets of parallel PCR reactions.

[0115] a. One-round PCR reaction system

[0116] According to Table 5, a one-round reaction system is prepared, using a one-round forward and reverse primer for fragment 1 and a one-round forward and reverse primer for fragment 2, respectively. For example, for primer set 2 of the present invention, primers SEQ ID NO.1 and SEQ ID NO.2 are used for fragment 1; and primers SEQ ID NO.5 and SEQ ID NO.6 are used for fragment 2. The PCR reaction tube containing the one-round reaction system is placed in a PCR instrument, and a one-round PCR amplification reaction program is started. The reaction program is shown in Table 6.

[0117] Table 5: One round PCR reaction system

[0118]

[0119] Table 6: One round of PCR amplification reaction program

[0120]

[0121] b. Second round PCR reaction system

[0122] According to Table 7, a two-round PCR reaction system is prepared, and the two-round forward and reverse primers of fragment 1 and the two-round forward and reverse primers of fragment 2 are used respectively. For example, for primer set 2 of the present invention, primers SEQ ID NO.3 and SEQ ID NO.4 are used for fragment 1; and primers SEQ ID NO.7 and SEQ ID NO.8 are used for fragment 2. The PCR reaction tube containing the two-round reaction system is placed in a PCR instrument, and the two-round PCR amplification reaction program is started. The reaction program is the same as the one-round PCR amplification reaction, as shown in Table 6.

[0123] Table 7: Second round PCR reaction system

[0124]

[0125] (4) Gel electrophoresis: The second-round PCR reaction products were subjected to gel electrophoresis verification. 0.8% agarose gel was used for electrophoresis at 140 V for 30 minutes, and the presence of the target band was observed under a UV gel imaging analysis system.

[0126] Figure 1 The gel electrophoresis diagrams of the amplified products using four sets of primers are shown. The results show that primer set 1 does not produce the target band of fragment 1 and has non-specific electrophoresis bands, and the target band of fragment 2 appears, but it is darker; primer set 2, which is the primer set of the present invention, has target bands of fragment 1 and fragment 2, and the bands are brighter. Primer set 3 does not produce target bands of fragment 1 and fragment 2; although primer set 4 has target bands of fragment 1 and fragment 2, the target bands are darker. In summary, the primer set of the present invention successfully amplified two target fragments, and the electrophoresis bands are brighter, and the concentration of the amplified product is high.

[0127] Example 2: Screening of reverse transcription reagents and amplification reagents

[0128] ① Screening of reverse transcription reagents

[0129] The reverse transcription process affects the subsequent amplification effect and sequencing quality, and is a key step in the HIV-1 near full-length genome amplification method. Using nucleic acid extracted from subtype B virus culture as a template, the nucleic acid sample was extracted according to the extraction method given in Example 1, and then two reverse transcription reagents SuperScript III First-Strand and SuperScript IV VILO (Invitrogen) were used for reverse transcription in the reverse transcription stage to compare the effects of the two reverse transcription reagents on the subsequent amplification and sequencing effects, and based on this result, the reverse transcription reagents used in the subsequent HIV-1 near full-length genome amplification method were screened.

[0130] 1) Reverse transcription of the sample was performed using SuperScript III First-Strand Synthesis System for RT-PCR reagent. The specific experimental steps are as shown in Example 1.

[0131] 2) Use SuperScript IV VILO premix for reverse transcription. The specific steps are as follows:

[0132] Prepare the reaction system as shown in Table 8:

[0133] Table 8: Reverse transcription reaction system

[0134]

[0135] Reverse transcription was performed according to the following reaction procedure:

[0136] Table 9: Reverse transcription reaction procedure

[0137]

[0138] The specific procedures of subsequent nested PCR amplification and gel electrophoresis are the same as those in Example 1. Figure 2 The gel electrophoresis diagram shows the amplification products obtained after reverse transcription using different reverse transcription reagents. Figure 2 The results showed that after nested PCR amplification using SuperScript III First-Strand reverse transcription reagent, gel electrophoresis verified that both fragment 1 and fragment 2 target bands appeared, and the bands were brighter; after nested PCR amplification using SuperScript IV VILO reverse transcription reagent, gel electrophoresis verified that only fragment 1 target band appeared, which was darker and contained more non-target fragments.

[0139] In addition, the second-generation sequencing method was used to analyze the second-round amplification products. The specific operations are as follows:

[0140] ①DNA library construction and amplification: The second-round PCR reaction products of genomic fragment 1 and fragment 2 were mixed in equal volumes and purified. The purified products were quantified using a Qubit fluorescence quantifier and diluted to 0.2ng / μL. The genomic DNA was fragmented according to the MiSeq sequencing reagent instructions, the label adapter was selected to label the DNA, and 12 PCR cycles were performed to amplify the DNA library.

[0141] ② Normalized DNA library: The DNA library was adsorbed with AMP-Pure magnetic beads (35 μL) and eluted in 52.5 μL Illumina resuspension buffer (RSB), and the library concentration was adjusted to 1 nM.

[0142] ③ Loading the MiSeq machine: Mix equal volumes of the library, denature with 0.1N NaOH for 5 minutes, and dilute to 20pM with HT1 buffer. Dilute the DNA library to 12pM with HT1 again, and add 1% PhiX loading control. After denaturing the library at 96°C for 2 minutes, invert and mix well and immediately place in an ice bath for 5 minutes. The reaction product is sequenced on the MiSeq device.

[0143] ④ Second-generation sequencing data analysis: The sequencing data were automatically organized, spliced ​​and analyzed using the pathogenic microorganism information analysis system (Beijing Micro Future Company).

[0144] The sequencing quality is comprehensively evaluated from two aspects: coverage and average sequencing depth. Coverage refers to the percentage of sites with sequencing depth in the total length of the reference sequence, and average sequencing depth refers to the average sequencing depth of each gene site. When the coverage is greater than 80% and the average sequencing depth is greater than 100×, the sequencing results are generally considered good.

[0145] Table 10 lists the next generation sequencing results of the amplified products obtained using different reverse transcription reagents. Table 10 shows that the coverage and average sequencing depth of the next generation sequencing of the final product obtained using the SuperScript III First-Strand reverse transcription reagent are higher than those of the amplified product obtained using SuperScript IV VILO. Figure 3 The second-generation sequencing depth coverage map is shown, in which the second-generation sequencing depth of the amplified product after reverse transcription using SuperScript IV VILO is unevenly distributed, and there is an obvious fragment loss at the position of 4000-8000bp.

[0146] Table 10: Next-generation sequencing results of the second-round amplification products obtained using different reverse transcription reagents

[0147]

[0148] In summary, the electrophoresis bands of the amplified products obtained by SuperScript III First-Strand reverse transcription reagent are bright and the quality of the second-generation sequencing of the amplified products is higher than that of SuperScript IV VILO. Therefore, SuperScript III First-Strand reverse transcription reagent was selected as the reverse transcription reagent for the HIV-1 near-full-length genome amplification method.

[0149] ② Screening amplification reagents

[0150] The activity of DNA polymerase affects the efficiency of long-fragment amplification. Using subtype B virus culture as a sample, the nucleic acid was extracted and reverse transcribed according to the extraction method given in Example 1, and three different amplification reagents, Takara LATaq polymerase (Takara, Japan), PrimeSTAR GXL DNA polymerase (Clontech, USA) and Expand Long Template PCR System (Roche, Switzerland) were used to perform near-full-length genome amplification, to compare the amplification product results obtained using different amplification reagents. Based on this result, the amplification reagents used for the subsequent HIV-1 near-full-length genome amplification method were screened. The reaction systems and reaction conditions of the three amplification reagents are shown in Table 11 below:

[0151] Table 11: Reaction systems and reaction conditions of different amplification reagents

[0152]

[0153]

[0154] Note: The PCR reaction conditions for the first and second rounds of nested PCR are the same

[0155] The specific procedures of subsequent nested PCR amplification, gel electrophoresis and next-generation sequencing analysis are the same as those in Examples 1 and 2.

[0156] Gel electrophoresis results Figure 4 As shown, the target bands of fragment 1 and fragment 2 obtained by using PrimeSTAR GXL DNA polymerase amplification reagent are brighter; the target band of fragment 1 obtained by using Expand Long Template PCR System amplification reagent is brighter, but the target band of fragment 2 is darker; the target bands of fragment 1 and fragment 2 obtained by using Takara LA Taq polymerase amplification reagent are both darker.

[0157] The results of the second generation sequencing are shown in Table 12 and Figure 5As shown in the figure, the next-generation sequencing coverage and average sequencing depth of the amplification products of PrimeSTAR GXL DNA polymerase amplification reagent are higher than those of the other two reagents.

[0158] In summary, the electrophoresis bands of the amplification products of PrimeSTAR GXL DNA polymerase amplification reagent are bright and the quality of the next-generation sequencing of the amplification products is higher than that of the other two reagents. Therefore, PrimeSTAR GXL DNA polymerase amplification reagent was selected as the amplification reagent for the HIV-1 near-full-length genome amplification method.

[0159] Table 12: Next-generation sequencing results of products amplified by different reagents

[0160]

[0161] Example 3: Optimization of reaction system and reaction procedure

[0162] ①Optimize the concentration of primers for the first and second rounds of amplification

[0163] The culture supernatant of the subtype B strain was used to perform nucleic acid extraction, reverse transcription and nested PCR amplification according to Example 1, and different primer final concentration gradients (0.4 μM, 0.6 μM, 0.8 μM, 1.2 μM) were set, and the concentrations of amplification primers in the first and second rounds of nested PCR reaction systems were kept consistent.

[0164] The amplified product was analyzed by gel electrophoresis. The specific experimental steps refer to Example 1. Figure 6 As shown, the amplification effect of fragment 1 under different primer concentration conditions is similar, and the target band appears. Therefore, the lowest primer concentration of 0.4 μM is selected for subsequent experiments; fragment 2 has the target electrophoresis band under primer concentrations of 0.4 μM and 0.6 μM, but the electrophoresis band is brightest under the condition of 0.4 μM. Therefore, 0.4 μM is preferred as the primer concentration for the subsequent nested PCR reaction of fragment 1 and fragment 2.

[0165] ②Optimize annealing temperature

[0166] In order to improve the amplification efficiency and the amount of amplified products, it is necessary to further explore the optimal amplification conditions. Using the nucleic acid extracted from the culture supernatant of the subtype B strain as a template, 8 temperature gradients (49.8°C-58°C) were set in the annealing step of the nested PCR amplification stage, and the amplified products were analyzed by gel electrophoresis. The specific experimental steps refer to Example 1.

[0167] The results are as follows Figure 7 and Figure 8 As shown, fragment 1 has the target band at all annealing temperatures, and when the annealing temperature is set to 53°C, the target band is the brightest and no non-specific fragments appear ( Figure 7 ); Fragment 2 also showed the target band at all annealing temperatures. When the annealing temperature was set to 55°C, the target band was the brightest and no non-specific fragments appeared ( Figure 8 ). Therefore, 53°C and 55°C are preferably used as the annealing temperatures for the subsequent nested PCR amplification stage of fragment 1 and fragment 2, respectively.

[0168] Example 4: Sensitivity Analysis

[0169] The B subtype strain culture was diluted ten-fold to obtain five concentration gradient samples (10 7 , 10 6 , 10 5 , 10 4 , 10 3 The five concentration gradient samples were amplified by the HIV-1 near full-length genome amplification method of the present invention, and the second-round amplification products were subjected to gel electrophoresis and second-generation sequencing analysis to verify the sensitivity of the HIV-1 near full-length genome amplification method of the present invention. The specific experimental operations refer to Examples 1 and 2.

[0170] The gel electrophoresis results of the amplified products are as follows Fig. 9 As shown, viral load is greater than or equal to 10 5 After amplification of the sample with a viral load of 10 copies / mL, both fragments showed target bands; 4 After amplification, the sample with a viral load of 10 copies / mL showed the target band of fragment 1, and the viral load was 10 3 No target bands appeared after amplification of samples with 10 copies / mL.

[0171] The results of the second-generation sequencing analysis are shown in Table 13. The viral load is greater than or equal to 10 5 After amplification of samples with a viral load of 10 copies / mL, the coverage and alignment rate of the second-generation sequencing were both greater than 93%, and the average sequencing depth was greater than 5500×. 4 copies / mL), the coverage rate was still greater than 85%, and the average sequencing depth was greater than 2000×, indicating that good sequencing results can still be obtained for samples with this viral load using the method of the present invention.

[0172] Table 13: Next-generation sequencing results of amplification products of samples with different viral loads

[0173]

[0174] The comprehensive analysis of gel electrophoresis results and next-generation sequencing results showed that the detection limit of the HIV-1 near-full-length genome amplification and sequencing method optimized and established in the present invention was 10 4 copies / mL.

[0175] Example 5: Subtype universality verification

[0176] The subtype universality of the HIV-1 near full-length genome amplification method of the present invention was verified using 15 strain culture samples of different subtypes. Amplification was performed with reference to the above-mentioned optimized reaction system and reaction conditions, and gel electrophoresis and second-generation sequencing analysis were performed on the amplified products. The specific experimental operations were referred to Examples 1 and 2.

[0177] The gel electrophoresis of the amplified product is shown in Fig.10 As shown, after amplification of 15 culture samples of 5 different subtypes of the virus, fragment 1 ( Fig.10 A) and fragment 2 ( Fig.10 B) all showed the target band. The second generation sequencing results are shown in Table 14. The average coverage of the second generation sequencing of different subtypes was 94.96% (83.58% to 99.97%), and the average sequencing depth was 5323.10× (3026× to 6790.57×). The above data show that the method of the present invention can be applied to common HIV-1 subtype strains in my country, including but not limited to CRF01_AE, B, CRF07_BC, CRF08_BC, CRF55_01B and CRF 105_0108.

[0178] Table 14: Next-generation sequencing results of the second-round amplification products of different amplification reagents

[0179]

[0180] Note: The subtype identification results of the strain are based on the analysis of the nearly full-length genome sequence of HIV-1.

[0181] Example 6: Clinical sample verification

[0182] The method of the present invention was verified using 13 clinical plasma samples containing 4 different subtypes. The information of the 13 clinical plasma samples is shown in Table 15 below, which involves B subtype, CRF01_AE subtype, BC subtype and CRF07_BC subtype. The specific experimental steps refer to Examples 1 and 2.

[0183] Table 15: Information of 13 clinical plasma samples

[0184]

[0185]

[0186] Note: The subtype was determined based on the evolutionary tree of the HIV-1 pol region, and the viral load was detected using the Roche TaqMan HIV-1 Test Version 2.0.

[0187] Gel electrophoresis results of clinical sample amplification products are as follows Fig.11 As shown, after amplification of 13 clinical plasma samples, fragment 1 ( Fig.11 A) and fragment 2 ( Fig.11 B) The target bands appeared, and the amplification success rate was 100%. This proves that the HIV-1 near-full-length genome amplification method established by the present invention has a high amplification success rate for clinical samples of different subtypes and different viral load ranges.

Claims

1. A primer set for amplifying HIV-1 genome, comprising: A forward primer for the gag-pol fragment, the sequence of which is shown in SEQ ID NO.1; A reverse primer for the gag-pol fragment, the sequence of which is shown in SEQ ID NO.2; The second round forward primer of the gag-pol fragment, whose sequence is shown in SEQ ID NO.3; The second round reverse primer of the gag-pol fragment, whose sequence is shown in SEQ ID NO.4; A forward primer for the pol-nef fragment, the sequence of which is shown in SEQ ID NO.5; A reverse primer for the pol-nef fragment, the sequence of which is shown in SEQ ID NO.6; The second round forward primer of the pol-nef fragment, whose sequence is shown in SEQ ID NO.7; and The second round reverse primer of pol-nef fragment, whose sequence is shown in SEQ ID NO.8; The position of the gag-pol fragment relative to the HIV-1 standard strain HXB2 is 769bp-3338bp; the position of the pol-nef fragment relative to the HIV-1 standard strain HXB2 is 2143bp-9181bp.

2. A method for amplifying HIV-1 genome for non-diagnostic purposes, comprising performing two-stage nested PCR amplification of HIV-1 genome using the primer set of claim 1.

3. The method according to claim 2, comprising the steps of: a. Provide HIV-1 RNA; b. reverse transcribing the HIV-1 RNA into cDNA; c. Using the cDNA as a template, performing two-stage nested PCR amplification of the HIV-1 genome using the primer set of claim 1 to obtain a gag-pol fragment and a pol-nef fragment.

4. The method according to claim 3, wherein: Nested PCR amplification was performed using PrimeSTAR GXL DNA polymerase amplification reagent.

5. A method for non-diagnostic purposes of sequencing HIV-1 genome, comprising: 1) Implementing the method according to any one of claims 2 to 4 to obtain a gag-pol fragment and a pol-nef fragment; 2) Sequence the obtained gag-pol fragment and pol-nef fragment to obtain the HIV-1 genome sequence.

6. The method according to claim 5, wherein: Sequencing was performed by next-generation sequencing.

7. The method according to any one of claims 2 to 6, wherein: The concentration of each primer in the PCR amplification reaction was 0.4-1.2 μM.

8. The method according to claim 7, wherein: The concentration of each primer in the PCR amplification reaction was 0.4 μM.

9. The method according to any one of claims 2 to 6, wherein: The temperature of the annealing step in the PCR amplification reaction is 49.8°C-58°C.

10. The method according to claim 9, wherein: The temperature for the annealing step of the gag-pol fragment was 53°C.

11. The method according to claim 9, wherein: The temperature for the annealing step of the pol-nef fragment was 55°C.

12. The method according to any one of claims 2 to 6, wherein: HIV-1 RNA is provided by extracting HIV-1 RNA from a blood sample, a body fluid sample, or by artificially synthesizing the sample based on a known nucleic acid sequence.

13. The method according to claim 12, wherein: The blood samples are whole blood, serum, plasma, and dried blood spots.

14. The method according to claim 12, wherein: The body fluid sample is secretion.

15. The method according to claim 12, wherein: The viral load in the sample is at least 10 4 copies / mL.

16. The method according to any one of claims 2 to 6, wherein: Reverse transcription was performed using SuperScript III First-Strand Reverse Transcription Reagent.

17. A kit for amplifying HIV-1 genome, comprising: a) the primer set according to claim 1; as well as b) instructions for use of the kit.

18. Use of the primer set of claim 1 in preparing a kit for amplifying or sequencing HIV-1 genome.

Images