A quadruple quantitative fluorescent primer probe composition, kit and identification method for identifying African swine fever virus

Abstract

The present invention belongs to the field of molecular biology technology, and specifically relates to a quadruple fluorescent quantitative primer-probe composition, a kit and a PCR identification method for identifying wild strains of African swine fever virus and gene-deficient strains. The detection kit of the present invention that can quickly identify wild strains of African swine fever virus and gene-deficient strains, for the African swine fever gene-deficient strains currently developed in China, selects the B646L, EP402R, MGF505-3R and A137R gene sequences of African swine fever to design and synthesize specific primers and probes for the four genes, establishes a method for identifying wild strains of African swine fever virus and gene-deficient strains, and develops a convenient diagnosis kit, which has the characteristics of high sensitivity, strong specificity, good repeatability and stability.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and specifically relates to a quadruple fluorescent quantitative primer-probe composition, a kit and a PCR identification method for identifying wild-type African swine fever virus and gene-deficient strains. Background Art

[0002] African swine fever (ASF) is an acute, febrile, highly contagious disease of pigs caused by the African swine fever virus (ASFV). Domestic pigs and wild boars are generally susceptible. It is listed as a notifiable disease by the World Organization for Animal Health and as a Class I infectious disease by China. The incubation period of ASFV is 5-15 days. Once an outbreak occurs, the course of the disease is short and the mortality rate is high, reaching 100%. The clinical symptoms are complex and difficult to distinguish from other diseases, mostly manifested as high fever, skin congestion, abortion, edema and organ bleeding.

[0003] African swine fever (ASF) is a double-stranded DNA virus and the only member of the Asfrican virus family. It has only one serotype and 24 genotypes. Its genome is between 170-193kbp and encodes 68 structural proteins and more than 100 non-structural proteins. It consists of a four-layer protein shell and an inner genome. Its structure is significantly more complex than that of many other viruses. Its multi-layer structure plays different roles in the replication and survival of ASFV.

[0004] It is reported that the p72 protein encoded by the B646L gene of ASFV is the main capsid protein, and its C-terminal region sequence variation can divide ASFV into 24 genotypes. The main strains currently prevalent in China are genotype II introduced in 2018 and genotype I introduced in 2021. The p72 protein can produce neutralizing antibodies and block the adsorption of ASFV to macrophages, indicating that it is involved in the adsorption of ASFV. In addition, the CD2v protein is encoded by the EP402R gene and is a glycoprotein similar to the T lymphocyte surface adhesion receptor CD2v; and the CD2v protein is necessary for mediating the adsorption of erythrocytes and the binding of extracellular virus particles to erythrocytes. It is involved in host immune regulation, virulence, and induction of protective immune responses. Furthermore, multigene family (MGF) proteins are widely distributed in ASFV and are generally divided into five families, including MGF-100, MGF-110, MGF-300, MGF-360 and MGF-505, and MGF proteins have been reported to play an important role in multiple stages of viral infection of host cells, including transcription and translation, virulence, and immune escape. In addition, the translation product of the ASFV A137R gene is a protein expressed in the late viral replication cycle, and pA137R inhibits the IFN signaling pathway and plays an important role in escaping the innate immune response.

[0005] At present, there are many methods for diagnosing African swine fever, such as clinical and pathological observation, etiological diagnosis, and serological diagnosis. Among them, etiological diagnosis includes hemocyte adsorption test (HAD), polymerase chain reaction (PCR), real-time fluorescence quantitative PCR (qPCR), and isothermal amplification technology (RPA, LAMP). Serological diagnosis includes FAT, ELISA, IFA, IPT, DIA, and IBT. Clinical and pathological observation does not require cost, but it is difficult to identify infectious diseases with similar symptoms. The hemocyte adsorption experiment has a long cycle and can only verify strains with hemocyte adsorption characteristics, and the activity of the virus in the sample must be guaranteed. Isothermal amplification technology (RPA, LAMP) has high requirements for experimental conditions, and its sensitivity and effectiveness still need a lot of clinical data verification. ELISA has the advantages of simple operation, low cost, and short time, but the detection rate for chronic infection is not high. Serological methods such as IBT and IFA lack commercial kits. It can be seen that PCR and qPCR are the most reliable methods for diagnosing ASFV infection, among which highly sensitive qPCR is regarded as the gold standard.

[0006] Therefore, establishing an ASFV fluorescent quantitative PCR detection method for a new detection target gene of ASFV is crucial for early detection and prevention of the disease, in-depth research on the pathogenic mechanism of ASFV, and future differential diagnosis of vaccine strains and wild virus infections. Summary of the invention

[0007] To this end, the technical problem to be solved by the present invention is to provide a quadruple fluorescent quantitative primer-probe composition for identifying wild-type African swine fever virus and gene-deficient strains, which has the characteristics of high sensitivity, strong specificity, good repeatability and stability;

[0008] The second technical problem to be solved by the present invention is to provide a quadruple fluorescence quantitative kit for identifying wild-type African swine fever virus and gene-deficient strains;

[0009] The third technical problem to be solved by the present invention is to provide a quadruple fluorescence quantitative PCR identification method for distinguishing wild strains of African swine fever virus and gene-deficient strains.

[0010] In order to solve the above technical problems, the present invention discloses a quadruple fluorescent quantitative primer-probe combination for identifying wild-type African swine fever virus and gene-deficient strains, comprising primer-probe combinations for detecting the African swine fever virus B646L gene, the African swine fever virus EP402R gene, the African swine fever virus MGF505-3R gene, and the African swine fever virus A137R gene, respectively; wherein,

[0011] The primer-probe composition for detecting the African swine fever virus B646L gene comprises:

[0012] Upstream primer B646L-F: comprising the nucleotide sequence shown in SEQ ID NO: 1;

[0013] Downstream primer B646L-R: comprising the nucleotide sequence shown in SEQ ID NO: 2;

[0014] Fluorescent probe B646L-P: comprising the nucleotide sequence shown in SEQ ID NO: 3;

[0015] The primer-probe composition for detecting the African swine fever virus EP402R gene comprises:

[0016] Upstream primer EP402R-F: comprising the nucleotide sequence shown in SEQ ID NO: 4;

[0017] Downstream primer EP402R-R: comprising the nucleotide sequence shown in SEQ ID NO: 5;

[0018] Fluorescent probe EP402R-P: comprising the nucleotide sequence shown in SEQ ID NO: 6;

[0019] The primer-probe composition for detecting the African swine fever virus MGF505-3R gene comprises:

[0020] Upstream primer MGF505-3R-F: comprising the nucleotide sequence shown in SEQ ID NO: 7;

[0021] Downstream primer MGF505-3R-R: comprising the nucleotide sequence shown in SEQ ID NO: 8;

[0022] Fluorescent probe MGF505-3R-P: comprising the nucleotide sequence shown in SEQ ID NO: 9;

[0023] The primer-probe composition for detecting the A137R gene of African swine fever virus comprises:

[0024] Upstream primer A137R-F: comprising the nucleotide sequence shown in SEQ ID NO: 15;

[0025] Downstream primer A137R-R: comprising the nucleotide sequence shown in SEQ ID NO: 16;

[0026] Fluorescent probe A137R-P: comprises the nucleotide sequence shown in SEQ ID NO:17.

[0027] Specifically, in the primer-probe composition, the probe is a hydrolysis probe;

[0028] Preferably, the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end is labeled with a quencher group.

[0029] Specifically, the primer-probe composition:

[0030] The fluorescent reporter group is selected from any one of FAM, VIC, Cy5, and Texas Red;

[0031] The quenching group is selected from MGB.

[0032] Specifically, different specific probes have different 5' end labeled fluorescent reporter groups.

[0033] The present invention also discloses the use of the primer-probe combination for preparing a quadruple fluorescent quantitative PCR kit for identifying wild strains and gene-deficient strains of African swine fever virus.

[0034] The present invention also discloses a quadruple fluorescent quantitative PCR kit for identifying wild strains and gene-deficient strains of African swine fever virus, wherein the kit comprises the primer-probe combination.

[0035] Specifically, the kit further includes a positive control and / or a negative control;

[0036] The positive controls include a recombinant plasmid containing the African swine fever virus B646L gene, a recombinant plasmid containing the African swine fever virus EP402R gene, a recombinant plasmid containing the African swine fever virus MGF505-3R gene, and a recombinant plasmid containing the African swine fever virus A137R gene;

[0037] The negative control was water.

[0038] Specifically, the kit further comprises a PCR amplification solution and a fluorescent reaction solution. Specifically, the main components of the PCR amplification solution include DNA enzyme, PCR buffer, dNTPs, Mg 2+ , as well as enhancers and stabilizers.

[0039] The present invention also discloses a fluorescent quantitative PCR system for identifying wild strains and gene-deficient strains of African swine fever virus, comprising the primer-probe combination;

[0040] Preferably, in the primer-probe composition, the final concentration of the primer of the B646L gene in the system is 0.2-0.3 pmol / μL, preferably 0.24 pmol / μL;

[0041] Preferably, in the primer-probe composition, the final concentration of the EP402R and A137R primers in the system is 0.1-0.2 pmol / μL, preferably 0.16 pmol / μL;

[0042] Preferably, in the primer-probe composition, the final concentration of the MGF505-3R primer in the system is 0.05-0.1 pmol / μL, preferably 0.08 pmol / μL;

[0043] Preferably, in the primer-probe composition, the final concentration of the B646L probe in the system is 0.05-0.1 pmol / μL, preferably 0.08 pmol / μL;

[0044] Preferably, in the primer-probe composition, the final concentration of the EP402R probe in the system is 0.1-0.2 pmol / μL, preferably 0.16 pmol / μL;

[0045] Preferably, in the primer-probe composition, the final concentration of the A137R probe in the system is 0.2-0.3 pmol / μL, preferably 0.24 pmol / μL;

[0046] Preferably, in the primer-probe composition, the final concentration of the MGF505-3R probe in the system is 0.01-0.05 pmol / μL, preferably 0.04 pmol / μL.

[0047] The present invention also discloses a method for using the primer-probe combination or the kit or the fluorescent quantitative PCR system for purposes other than disease diagnosis and / or treatment, the method comprising the steps of using the primer-probe combination or the kit or the fluorescent quantitative PCR system to perform real-time fluorescent quantitative PCR reaction and detection on a sample to be tested, and the step of collecting fluorescent signals for identification to determine whether the sample to be tested contains a wild strain of African swine fever virus and / or a gene-deficient strain;

[0048] Preferably, the real-time fluorescence quantitative PCR reaction conditions include: 95°C, 30s; 95°C, 10s; 58°C, 20s; 41 cycles; the extension compensation reaction conditions are: 95°C, 30s; 65°C, 1min; 85°C, continuous.

[0049] The present invention also discloses the use of the primer-probe combination or the kit or the fluorescent quantitative PCR system for preparing diagnostic reagents for ASFV-related diseases.

[0050] The quadruple fluorescent quantitative primer-probe composition for identifying wild strains and gene-deficient strains of African swine fever virus described in the present invention is targeted at the mainstream African swine fever gene-deficient strains currently developed in China, including MGF505 gene-deficient strains, MGF360-505 gene-deficient strains, EP402R gene-deficient strains, A137R gene-deficient strains and MGF360-505, EP402R, A137R combined-deficient strains, and primer probes of conservative regions of African swine fever virus gene type I and type II B646L gene, EP402R gene, MGF505-3R gene, and A137R gene are respectively determined through sequence alignment, and primer probe sequences with similar amplification efficiencies are screened out through optimization, and at the same time, the ratio of primers to fluorescent probes is adjusted to further maintain a relatively consistent amplification efficiency of the four pairs of fluorescent probes.

[0051] The quadruple fluorescent quantitative primer-probe composition for identifying wild strains and gene-deficient strains of African swine fever virus described in the present invention specifically designs primers / probes for four genes, namely, B646L, EP402R, MGF505-3R, and A137R. Among them, the B646L gene is the first choice for detecting African swine fever virus, and the gene is the capsid protein encoding gene of the African swine fever virus; the EP402R and MGF505-3R genes are popular deleted genes for constructing gene-deficient strains, and the MGF505-3R gene is naturally deleted in nature; A137R is a recently discovered protein encoding gene that is significantly related to immunosuppression. The strain lacking this gene has immune protection for the host and may become an important target for gene-deficient vaccines in the future. Therefore, we established a quadruple fluorescence quantitative PCR detection method to identify wild strains of African swine fever virus and gene-deficient strains. It can effectively confirm whether a person is infected with the gene-deficient strain, and effectively make up for the defect that when wild strains of African swine fever virus and gene-deficient strains are co-infected, identifying the missing gene alone cannot determine whether there is a gene-deficient strain infection. It has good accuracy and applicability.

[0052] The quadruple fluorescent quantitative primer-probe combination for identifying wild strains and gene-deficient strains of African swine fever virus described in the present invention is designed to meet the diagnostic needs of ASFV. Primers / probes for the four genes of ASFV, B646L, EP402R, MGF505-3R, and A137R, are designed. Comparison with the gene sequences of 21 strains of ASFV shows that the designed primers / probes have high conservatism. Through optimization, the standard curve has a good linear relationship (R 2 >0.99), the lowest detected concentration of positive plasmid was 50 copies / μl, and the lowest detected viral load was 10 2 HAD 50 / ml. Quadruple qPCR reactions were performed using nucleic acids from three porcine DNA viruses and cDNAs from eight RNA viruses, and no amplification curves appeared, indicating that this method has good specificity. 1×10 6 -10 4 The mixed plasmid of 1000 copies / μl was used as the reaction template of quadruple qPCR, and the coefficient of variation (CV) of three replicates within and between groups was less than 2%, indicating that the method has good repeatability. The clinical samples of EP402R, MGF505-3R and A137R with different combinations of gene deletion strains were tested, and the results obtained were in line with expectations. Therefore, the established kit is of great significance for the molecular diagnosis of African swine fever etiology and the verification of deletion strains.

[0053] The quadruple fluorescent quantitative primer-probe composition for identifying wild strains and gene-deficient strains of African swine fever virus described in the present invention has strong specificity and has no nonspecific amplification curves for classical swine fever virus, pseudorabies virus, porcine reproductive and respiratory syndrome virus, porcine circovirus type II, porcine parvovirus, foot-and-mouth disease, porcine Japanese encephalitis virus, porcine epidemic diarrhea, swine influenza, porcine transmissible gastroenteritis and bovine viral diarrhea, thereby ensuring the accuracy of detection.

[0054] The detection kit for rapidly identifying wild strains and gene-deficient strains of African swine fever virus of the present invention selects the B646L, EP402R, MGF505-3R and A137R gene sequences of African swine fever for the gene-deficient strains of African swine fever currently developed in China, designs and synthesizes specific primers and probes for the four genes, establishes a method for identifying wild strains and gene-deficient strains of African swine fever virus, and develops a kit for convenient diagnosis. The kit and identification method can simultaneously identify the four genes of wild strains and gene-deficient strains of African swine fever virus, the primers of different genes do not interfere with each other, and have the characteristics of high sensitivity, strong specificity, good repeatability and stability. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0056] Figure 1 The fluorescence amplification curve of the African swine fever virus B646L gene (the curves from left to right represent the copy numbers of the mixed positive plasmids, which are 10 6 -10 2 copies / μL);

[0057] Figure 2 This is the standard curve of the African swine fever virus B646L gene;

[0058] Figure 3The fluorescence amplification curve of the African swine fever virus EP402R gene (the curves from left to right represent the copy numbers of the mixed positive plasmids, which are 10 6 -10 2 copies / μL);

[0059] Figure 4 This is the standard curve of the African swine fever virus EP402R gene;

[0060] Figure 5 The fluorescence amplification curve of the African swine fever virus MGF505-3R gene (the curves from left to right represent the copy numbers of the mixed positive plasmids, which are 10 6 -10 2 copies / μL);

[0061] Figure 6 This is the standard curve of the African swine fever virus MGF505-3R gene;

[0062] Figure 7 The fluorescence amplification curve of the A137R gene of African swine fever virus (the curves from left to right represent the copy numbers of the mixed positive plasmids, which are 10 6 -10 2 copies / μL);

[0063] Figure 8 This is the standard curve of the A137R gene of African swine fever virus;

[0064] Fig. 9 The results of the fluorescence amplification curve of the specific experiment; 1-4 are the amplification curves of B646L, MGF505-3R, A137R, and ER402R genes of ASFV, and 5-16 are PRV, PPV, PCVⅡ, FMDV, CSFV, PEDV, TGEV, SIV, JEV, PRRSV, BVDV, and negative control, respectively;

[0065] Fig.10 The single fluorescence amplification curve of the African swine fever virus B646L gene (the curves from left to right represent the copy numbers of the positive plasmids, which are 10 6 -10 1 copies / μL);

[0066] Fig.11 The single fluorescence amplification curve of the African swine fever virus EP402R gene (the curves from left to right represent the copy numbers of the positive plasmids, which are 10 8 -10 1 copies / μL);

[0067] Fig.12The single fluorescence amplification curve of the African swine fever virus MGF505-3R (SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9) gene (the curves from left to right represent the copy numbers of the positive plasmids, respectively, 10 9 -10 4 copies / μL);

[0068] Fig.13 The single fluorescence amplification curve of the African swine fever virus MGF505-3R (SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 13) gene (the curves from left to right represent the copy numbers of the positive plasmids, respectively, 10 9 -10 4 copies / μL);

[0069] Fig.14 The single fluorescence amplification curve of the African swine fever virus MGF505-3R (SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 14) gene (the curves from left to right represent the copy numbers of the positive plasmids, respectively, 10 9 -10 2 copies / μL);

[0070] Fig.15 The single fluorescence amplification curve of the African swine fever virus A137R (SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17) gene (the curves from left to right represent the copy numbers of the positive plasmids, which are 10 8 -10 1 copies / μL);

[0071] Fig.16 The single fluorescence amplification curve of the African swine fever virus A137R (SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20) gene (the curves from left to right represent the copy numbers of the positive plasmids, respectively, 10 8 -10 1 copies / μL);

[0072] Fig.17 It is the fluorescence amplification curve diagram of clinical samples with known genotypes, wherein AF represents blood, liver, spleen, lung, genotype I ASFV cytotoxicity, and ASFVΔA137RΔEP402R cytotoxicity, respectively; in each figure, 1-5 represent the B646L, MGF505-3R, A137R and EP402R genes of ASFV, i.e., the negative control amplification curve diagram. DETAILED DESCRIPTION

[0073] In the following embodiments of the present invention, for the African swine fever gene-deficient strains currently developed in China, the B646L, EP402R, MGF505-3R and A137R gene sequences of African swine fever are selected to design and synthesize specific primers and probes for the four genes, which can simultaneously identify the four genes of wild strains and gene-deficient strains of African swine fever virus. The primers of different genes do not interfere with each other, and have the characteristics of high sensitivity, strong specificity, good repeatability and stability.

[0074] In the following embodiments of the present invention, the 5'-end of the fluorescent probes B646L-P, MGF505-3R-P, EP402R-P, and A137R-P can be labeled with any one of the fluorescent reporter groups FAM, VIC, Cy5, and Texas Red, and the 3'-end of the fluorescent probe can be labeled with the fluorescent quencher group MGB.

[0075] The fluorescent probes B646L-P, MGF505-3R-P, EP402R-P and A137R-P are respectively labeled with four different fluorescent groups.

[0076] Specifically, the African swine fever virus B646L gene sequence is as follows: GAACGTGAACCTTGCTATTCCCTCAGTATCCATTCCCTTCGGCGAGCG CTTTATCACCATAAAGCTTGCATCGCAAAAGGATTTGGTGAATGAATTT CC (SEQ ID NO: 21);

[0077] The primer probe composition for detecting the African swine fever virus B646L gene comprises:

[0078] Upstream primer B646L-F: 5'-GAACGTGAACCTTGCTA-3' (SEQ ID NO: 1); Downstream primer B646L-R: 5'-GGAAATTCATTCACCAAATCC-3' (SEQ ID NO: 2);

[0079] Fluorescent probe B646L-P: 6-FAM-TAAAGCTTGCATCGCA-MGB (SEQ ID NO: 3).

[0080] Specifically, the African swine fever virus EP402R gene sequence is as follows: GACACCACTTCCATACATGAACCATCTCCCAGAGAACCATTACTTCCT AAGCCTTACAGTCGTTATCAGTATAATACACCTATTTACTACATGCGTC C (SEQ ID NO: 22);

[0081] The primer probe set for detecting the EP402R gene of African swine fever virus includes:

[0082] Upstream primer EP402R-F: 5′-GACACCACTTCCATACATGAAC-3′ (SEQ ID NO: 4);

[0083] Downstream primer EP402R-R: 5′-GGACGCATGTAGTAAATAGGT-3′ (SEQ ID NO: 5);

[0084] Fluorescent probe EP402R-P: Cy5-CAGTCGTTATCAGTATAA-MGB (SEQ ID NO: 6).

[0085] Specifically, the African swine fever virus MGF505-3R gene sequence is as follows: GAGCTGTTGTTGTCATGGGAGGCAGATCCCCGCTACGCCGTCGTAGG AGCCCTAGAAAGCAAATACTATGACCTGGTTTACAAATACTATGACCA AGTTAAAGACTGCCATGATATCTTGCCGCTGATTCAAAATCC (SEQ ID NO: 23);

[0086] The primer-probe combination for detecting the African swine fever virus MGF505-3R gene includes a combination of primers and probes selected from the following sequence structures, wherein:

[0087] The primers are selected from:

[0088] Upstream primer MGF505-3R-F: 5′-GAGCTGTTGTTGTCATGGGA-3′ (SEQ ID NO: 7);

[0089] Downstream primer MGF505-3R-R: 5'-GGATTTTGAATCAGCGGCAA-3' (SEQ ID NO: 8); or,

[0090] Upstream primer MGF505-3R-F: 5′-GCATCGGAAGGGAACTATGA-3′ (SEQ ID NO: 10);

[0091] Downstream primer MGF505-3R-R: 5'-TTTCCGGATTTTGAATCAGC-3' (SEQ ID NO: 11); or,

[0092] Upstream primer MGF505-3R-F: 5′-ACTCAAAGTAGCAGCATCGG-3′ (SEQ ID NO: 12);

[0093] Downstream primer MGF505-3R-R: 5′-TGGCAGTCTTTAACTTGGTCA-3′ (SEQ ID NO: 13);

[0094] The probe is selected from:

[0095] Fluorescent probe MGF505-3R-P:

[0096] VIC-CCCCGCTACGCCGTCGTAGGAGCCC-MGB (SEQ ID NO: 9); or,

[0097] Fluorescent probe MGF505-3R-P: HEX-CCGCTACGCCGTCGT-MGB (SEQ ID NO: 14).

[0098] Specifically, the African swine fever virus A137R gene sequence is as follows: CTTGAAATCCCTGAGGAACGATGCACCTATAAATTCAACTCATACACAAAAAAAATGGAGCTTTTATTTACCCCTGAATTCCACACCGCCTGGCATGAAGTTCCTGAGTGCAGAGAGTTCATATTAAACTTTTTGAGACTCATTTCGGGACATCG (SEQ ID NO: 24);

[0099] The primer probe composition for detecting the A137R gene of African swine fever virus comprises:

[0100] Upstream primer A137R-F: 5′-CTTGAAATCCCTGAGGAACG-3′ (SEQ ID NO: 15);

[0101] Downstream primer A137R-R: 5′-CGATGTCCCGAAATGAGTCT-3′ (SEQ ID NO: 16);

[0102] Fluorescent probe A137R-P: Texas Red-CACCGCCTGGCATGA-MGB (SEQ ID NO: 17); or,

[0103] Upstream primer A137R-F: 5′-TTGAGACTCATTTCGGGACATC-3′ (SEQ ID NO: 18);

[0104] Downstream primer A137R-R: 5′-CCGATGAGATTTCCCTTCTGTA-3′ (SEQ ID NO: 19);

[0105] Fluorescent probe A137R-P: Texas Red-ACCATCAATGTTGACTTTCAGGCCA-MGB (SEQ ID NO: 20).

[0106] In the following embodiments of the present invention, a quadruple fluorescent PCR method for identifying and detecting wild strains and gene-deficient strains of African swine fever virus using the dedicated primer and probe set is also provided, as follows:

[0107] (1) extracting the total DNA of the sample to be tested and setting aside;

[0108] (2) Prepare the reaction system as follows: 3 μl of sample DNA, 2.2 μl of primer premix, 1.3 μl of probe premix, 12.5 μl of PCR amplification solution, and 6 μl of ddH2O;

[0109] In this embodiment, the premix required for the qPCR amplification reaction is a reagent with the product number CW3003M of Kangwei Century Company, and the product name is HyperProbe Mixture, whose main components are DNA enzyme, PCR buffer, dNTPs, Mg 2+ , and enhancers and stabilizers;

[0110] (3) The amplification program was as follows: 95°C for 30 s, followed by 95°C for 10 s, and 58°C for 20 s (collecting fluorescence signals), for a total of 41 cycles; there were 4 fluorescence channels, namely: reporter group "FAM", quencher group "MGB"; reporter group "VIC", quencher group "MGB"; reporter group "Cy5", quencher group "MGB"; reporter group "Texas Red", quencher group "MGB";

[0111] (4) The results were determined according to the standards shown in Table 1: the positive control had four channels with Ct values ​​< 30 and a specific amplification curve, and the negative control had no Ct value and no specific amplification curve. If both conditions were met, the experimental results were considered established.

[0112] Table 1 Result judgment criteria

[0113]

[0114] In summary, from the standard results in Table 1 above, we can see that:

[0115] In B646L, a Ct value ≤ 37 and a specific amplification curve was positive, 37 < Ct value < 40 and a specific amplification curve was questionable, and no Ct value or Ct value ≥ 40 was negative;

[0116] In EP402R, a Ct value ≤ 38 and a specific amplification curve was positive, 38 < Ct value < 40 and a specific amplification curve was questionable, and no Ct value or Ct value ≥ 40 was negative;

[0117] In A137R, a Ct value ≤ 37 and a specific amplification curve was positive, 37 < Ct value < 40 and a specific amplification curve was questionable, and no Ct value or Ct value ≥ 40 was negative;

[0118] In MGF505-3R, a Ct value ≤ 36 and a specific amplification curve was positive, 36 < Ct value < 38 and a specific amplification curve was questionable, and no Ct value or Ct value ≥ 38 was negative.

[0119] Under the above results, if the African swine fever virus nucleic acid is judged to be suspicious, re-sampling and DNA extraction are required for re-testing. If the Ct value is ≤40 and there is a specific amplification curve, it is judged to be positive, otherwise it is judged to be negative.

[0120] When all four genes are positive, it can be determined as an African swine fever wild strain. When B646L is positive, it can be determined as an African swine fever positive sample. If B646L is negative, it is determined as an African swine fever negative sample. When B646L is positive and one or more of the other genes are negative, it can be determined that the negative gene is missing and the sample is a gene-missing strain. When B646L is negative and other genes are positive, it is recommended to retest to confirm.

[0121] In the following embodiments of the present invention, a kit prepared using the four sets of primers and probes is also provided, and the kit can be used to assist in identifying wild strains and gene-deficient strains of African swine fever virus, and / or to detect whether a sample contains wild strains and / or gene-deficient strains of African swine fever virus.

[0122] Specifically, the kit also includes the following reagents: positive control, negative control, primer premix, probe premix, PCR amplification solution; wherein,

[0123] Positive control: recombinant plasmid containing B646L, EP402R, MGF505-3R, and A137R genes;

[0124] Negative control: ddH2O;

[0125] Primer premix: including A137R-F, A137R-R, MGF505-3R-F, MGF505-3R-R with an initial concentration of 10 μM, B646L-F, B646L-R, EP402R-F, EP402R-R with an initial concentration of 20 μM;

[0126] Probe premix: A137R-P, EP402R-P, B646L-P, MGF505-3R at an initial concentration of 10 μM;

[0127] PCR amplification solution includes: 2×HyperProbe Mixture.

[0128] The following embodiment of the present invention also provides a method for detecting whether a test sample contains wild strains and gene-deficient strains of African swine fever virus, namely, using the primer probe combination or the kit to perform a PCR amplification reaction on the nucleic acid extracted from the test sample, collecting the fluorescent signal, and determining whether the test sample contains wild strains and / or gene-deficient strains of African swine fever virus.

[0129] The technical scheme of the present invention is described in detail below. The following examples are convenient for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0130] Example 1

[0131] Preparation of positive standards

[0132] The full-length gene plasmids of B646L, EP402R, A137R, and MGF505-3R were synthesized and constructed by Shanghai Shenggong Biotechnology Co., Ltd. The full-length sequence of the target gene was referenced to the ASFV HuB20 strain (GenBank sequence number: MW521382), and the cloning vector was pUC57 with AMP resistance. The recombinant plasmids were named pUC57-B646L, pUC57-EP402R, pUC57-A137R, and pUC57-MGF505-3R, respectively.

[0133] After amplification with LB culture medium, 2 μl was taken as the PCR reaction template. A 25 μl system was used, and the reaction system included: 12.5 μl PCR Mix, 1 μl upstream primer, 1 μl downstream primer, 2 μl bacterial solution, and 8.5 μl ddH2O.

[0134] PCR amplification program: 95°C for 30 s; 95°C for 10 s, 57°C for 15 s, and 72°C for 15 s, for a total of 40 cycles; and then extension at 72°C for 10 min.

[0135] After amplification, all products were identified by agarose gel electrophoresis, and the bands were consistent with the target fragment size.

[0136] Optimization of single-plex fluorescence quantitative PCR conditions

[0137] Roche LightCycler 480Ⅱ fluorescence quantitative PCR instrument was used, 2×HyperProbe Mixture (CWBIO, catalog number: CW3003M) was selected as the premix required for the reaction, and the following primer / probe concentrations and annealing temperatures were optimized.

[0138] The primers and probes related to the B646L gene were designed as follows: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3;

[0139] The primers and probes related to the EP402R gene were designed as follows: SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6);

[0140] The primers and probes related to the A137R gene were designed as follows: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20;

[0141] The primers and probe related to the MGF505-3R gene were designed as follows: SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14.

[0142] Determination of single-plex fluorescence quantitative PCR reaction conditions and primers

[0143] The total system of single-plex fluorescence quantitative PCR for each gene was determined to be 25 μl through optimization. The specific composition is shown in Table 2 below.

[0144] Table 2 Single-plex fluorescence quantitative PCR reaction system

[0145]

[0146] According to the above system, the single fluorescence amplification curves of the African swine fever virus B646L gene, EP402R gene, MGF505-3R gene, and A137R gene formed by selecting different primer and probe combinations are shown in the attached Figure 10-16 shown.

[0147] The above primer-probe combinations were subjected to single-plex qPCR amplification, and the B646L gene amplification diagram is as follows: Fig.10 , EP402R gene amplification diagram is Fig.11 The amplification curves of these two pairs of genes were good and could be determined as the primer-probe combination for subsequent experiments.

[0148] like Fig.16 The A137R gene amplification curve shown in Figure 13-14 The amplification results of the MGF505-3R gene shown in Figure 2 show that the amplification curves of these two pairs of genes are not ideal. Fig.15 As shown in the A137R gene amplification diagram, the amplification curve of single-plex qPCR amplification based on the primer-probe combination (SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17) is relatively ideal, and Fig.12 As shown in the MGF505-3R gene amplification diagram, the amplification curve of single-plex qPCR amplification based on the primer-probe combination (SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9) is relatively ideal. Therefore, the above primer-probe combination was determined as the primer-probe combination for subsequent experiments.

[0149] In summary, according to Figure 10-16 The amplification efficiency shown can be determined with the following optimized primer / probe combination for quadruple qPCR:

[0150] B646L: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 ( Fig.10 );

[0151] EP402R: SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 ( Fig.11 );

[0152] A137R: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 ( Fig.15 );

[0153] MGF505-3R: SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 ( Fig.12 ).

[0154] Example 2

[0155] Preparation of positive standards

[0156] The preparation method of the positive standard described in this example is the same as that in Example 1.

[0157] Optimization of quadruple fluorescence quantitative PCR conditions

[0158] Use a fluorescent quantitative PCR instrument and select 2×HyperProbe Mixture as the premix required for the reaction. Optimize the primer / probe concentration and annealing temperature in the order of optimizing single-plex qPCR first and then quadruplex qPCR.

[0159] Through the single-plex optimization in the above Example 1, the combination of B646L (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3), EP402R (SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6), A137R (SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17), and MGF505-3R (SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9) was selected as the final primer-probe combination system.

[0160] The matrix method was used to optimize the primer / probe concentration and annealing temperature at 57°C, 58°C, and 59°C. The specific procedure is shown in Table 3 below.

[0161] Table 3 Optimization of quadruple qPCR conditions

[0162]

[0163] The final optimized total system was 25 μl, and the specific composition is shown in Table 4 below.

[0164] The amplification program was pre-denaturation at 95°C for 30 s, denaturation at 95°C for 10 s, annealing / extension at 58°C for 20 s, for a total of 41 cycles. Since there was interference between the fluorescence channels, color compensation was required, and the program was 95°C for 30 s, 65°C for 1 min, and 85°C continuous.

[0165] Table 4 Quadruple qPCR reaction system

[0166]

[0167]

[0168] The concentrations of pUC57-B646L, pUC57-EP402R, pUC57-A137R, and pUC57-MGF505-3R were measured using a micro-spectrophotometer and converted into copy numbers, which were 1.7 × 10 10 copies / μl, 1.6×10 10 copies / μl, 1.2×10 10 copies / μl, 1.2×10 10 copies / μl.

[0169] First, dilute each recombinant plasmid to 1×10 9 After that, equal volumes were taken and mixed, and the obtained mixed plasmid contained 2.5×10 8copies / μl, dilute the mixed plasmid to 1×10 8 copies / μl, and then dilute 10-fold to 1×10 9 copies / μl is used to construct the calibration curve, where 1×10 2 The mixed plasmids with 100 copies / μl were diluted 2-fold to 25 copies / μl for sensitivity test. The above reaction conditions and system were used in the specific operation process.

[0170] In this embodiment, the fluorescence amplification curves of the African swine fever virus B646L gene, EP402R gene, MGF505-3R gene, and A137R gene and the drawn standard curves are shown in the attached drawings. Figure 1-8 shown.

[0171] like Figure 1-8 The results show that within the current concentration range of dilution, the template amount and the corresponding Ct value have a good linear relationship, and the correlation coefficient R 2 The values ​​are 0.9962, 0.997, 0.994 and 0.9922 respectively, and the minimum detection amount of fluorescence quantitative PCR is 50 copise / / μl. Therefore, the fluorescence quantitative PCR system established by the present invention has high sensitivity.

[0172] Example 3 Repeatability Test

[0173] 1×10 6 -10 4 The positive plasmid with 100 copies / μl was used as a template, and fluorescence quantitative PCR was performed according to the fluorescence quantitative reaction system and procedure provided in Example 2. Three replicates were set for each gradient to verify the repeatability of the method.

[0174] The results show that the coefficient of variation (CV value) of repeated experiments of the present invention is all below 2%, indicating that the present invention has good repeatability.

[0175] Example 4 Specificity Test

[0176] Using the preserved positive samples of classical swine fever virus, pseudorabies virus, porcine blue ear virus, porcine circovirus type II, porcine parvovirus, swine foot-and-mouth disease, Japanese encephalitis virus, porcine epidemic diarrhea, swine influenza, porcine transmissible gastroenteritis and bovine viral diarrhea as templates, fluorescent quantitative PCR amplification was performed using the optimized primer and probe combination system in Example 2 of the present invention. The results are as follows: Fig. 9 shown.

[0177] It can be seen that the detection results of different signal channels in this system are all negative, indicating that this method has strong specificity and no cross-reaction with other major infectious agents.

[0178] Example 5 Clinical sample detection

[0179] Clinical samples with known genotypes included blood, liver, spleen, and lung of Hubei / 2019 genotype II ASFV, cytotoxicity of genotype I ASFV, and constructed cytotoxicity of ASFVΔA137RΔEP402R. Nucleic acids of the six samples were extracted and evaluated by quadruple qPCR.

[0180] The clinical samples were tested using the quadruple qPCR system established in Example 2, and the expected amplification was observed. Fig.17 .

[0181] like Fig.17 The results shown in middle AF show that ASFV nucleic acid in the blood, liver, spleen, and lungs were amplified, but no amplification curve was shown for MGF505-3R of genotype I ASFV, and no amplification was shown for the A137R and EP402R genes of ASFVΔA137RΔEP402R.

[0182] It can be seen that the quadruple fluorescence quantitative PCR detection method established in the present invention is used to distinguish between wild strains of African swine fever virus and gene-deficient strains, can effectively confirm whether a person is infected with the gene-deficient strain, and has the advantages of strong detection and good specificity.

[0183] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A quadruple fluorescent quantitative primer-probe composition for identifying wild-type African swine fever virus and gene-deficient strains, characterized in that: It includes primer-probe compositions for detecting the African swine fever virus B646L gene, the African swine fever virus EP402R gene, the African swine fever virus MGF505-3R gene, and the African swine fever virus A137R gene, respectively; wherein, The primer-probe composition for detecting the African swine fever virus B646L gene comprises: Upstream primer B646L-F: nucleotide sequence as shown in SEQ ID NO: 1; Downstream primer B646L-R: nucleotide sequence as shown in SEQ ID NO: 2; Fluorescent probe B646L-P: nucleotide sequence is shown in SEQ ID NO: 3; The primer-probe composition for detecting the African swine fever virus EP402R gene comprises: Upstream primer EP402R-F: the nucleotide sequence is shown in SEQ ID NO: 4; Downstream primer EP402R-R: nucleotide sequence as shown in SEQ ID NO: 5; Fluorescent probe EP402R-P: nucleotide sequence is shown in SEQ ID NO: 6; The primer-probe composition for detecting the African swine fever virus MGF505-3R gene comprises: Upstream primer MGF505-3R-F: nucleotide sequence as shown in SEQ ID NO: 7; Downstream primer MGF505-3R-R: nucleotide sequence as shown in SEQ ID NO: 8; Fluorescent probe MGF505-3R-P: nucleotide sequence as shown in SEQ ID NO: 9; The primer-probe composition for detecting the A137R gene of African swine fever virus comprises: Upstream primer A137R-F: nucleotide sequence as shown in SEQ ID NO: 15; Downstream primer A137R-R: nucleotide sequence as shown in SEQ ID NO: 16; Fluorescent probe A137R-P: The nucleotide sequence is shown in SEQ ID NO:

17.

2. The primer-probe combination according to claim 1, characterized in that The probe is a hydrolysis probe.

3. The primer-probe combination according to claim 1 or 2, characterized in that: The 5' end of the probe is labeled with a fluorescent reporter group and the 3' end is labeled with a quencher group.

4. The primer-probe composition according to claim 3, characterized in that: The fluorescent reporter group is selected from any one of FAM, VIC, Cy5, and Texas Red; The quenching group is selected from MGB.

5. Use of the primer-probe combination according to any one of claims 1 to 4 for preparing a quadruple fluorescent quantitative PCR kit for identifying wild strains and gene-deficient strains of African swine fever virus.

6. A quadruple fluorescence quantitative PCR kit for identifying wild-type African swine fever virus strains and gene-deficient strains, characterized in that: The kit comprises the primer-probe combination according to any one of claims 1 to 4.

7. The kit according to claim 6, characterized in that The kit also includes a positive control and / or a negative control; The positive controls include a recombinant plasmid containing the African swine fever virus B646L gene, a recombinant plasmid containing the African swine fever virus EP402R gene, a recombinant plasmid containing the African swine fever virus MGF505-3R gene, and a recombinant plasmid containing the African swine fever virus A137R gene; The negative control was water.

8. The kit according to claim 6 or 7, characterized in that The kit also includes PCR amplification solution and fluorescence reaction solution.

9. A fluorescent quantitative PCR system for distinguishing wild strains and gene-deficient strains of African swine fever virus, characterized in that: A primer-probe combination comprising any one of claims 1 to 4.

10. The fluorescent quantitative PCR system for identifying wild-type African swine fever virus strains and gene-deficient strains according to claim 9, characterized in that: In the primer-probe composition, the final concentration of the primer of the B646L gene in the system is 0.2-0.3 pmol / μL; In the primer-probe composition, the final concentration of the EP402R and A137R primers in the system is 0.1-0.2 pmol / μL; In the primer-probe composition, the final concentration of the MGF505-3R primer in the system is 0.05-0.1 pmol / μL; In the primer-probe combination, the final concentration of the B646L probe in the system is 0.05-0.1 pmol / μL; In the primer-probe combination, the final concentration of the EP402R probe in the system is 0.1-0.2 pmol / μL; In the primer-probe combination, the final concentration of the A137R probe in the system is 0.2-0.3 pmol / μL; In the primer-probe combination, the final concentration of the MGF505-3R probe in the system is 0.01-0.05 pmol / μL.

11. The fluorescent quantitative PCR system for identifying wild-type African swine fever virus strains and gene-deficient strains according to claim 9 or 10, characterized in that: In the primer-probe composition, the final concentration of the primer of the B646L gene in the system is 0.24 pmol / μL; In the primer-probe composition, the final concentration of the EP402R and A137R primers in the system is 0.16 pmol / μL; In the primer-probe composition, the final concentration of the MGF505-3R primer in the system is 0.08 pmol / μL; In the primer-probe combination, the final concentration of the B646L probe in the system is 0.08 pmol / μL; In the primer-probe combination, the final concentration of the EP402R probe in the system is 0.16 pmol / μL; In the primer-probe combination, the final concentration of the A137R probe in the system is 0.24 pmol / μL; In the primer-probe combination, the final concentration of the MGF505-3R probe in the system is 0.04 pmol / μL.

12. A method for using the primer-probe combination according to any one of claims 1 to 4, the kit according to any one of claims 6 to 8, or the fluorescent quantitative PCR system according to any one of claims 9 to 11 for purposes other than disease diagnosis and / or treatment, characterized in that: The method comprises the steps of using the primer-probe combination or the kit or the fluorescent quantitative PCR system to perform real-time fluorescent quantitative PCR reaction and detection on the sample to be tested, and the step of collecting fluorescent signals for identification to determine whether the sample to be tested contains wild strains and / or gene-deficient strains of African swine fever virus.

13. Use of the primer-probe combination according to any one of claims 1 to 4, the kit according to any one of claims 6 to 8, or the fluorescent quantitative PCR system according to any one of claims 9 to 11 for preparing a diagnostic reagent for ASFV infection.

Images