A method for portable detection of escherichia coli o157:h7

Abstract

This invention relates to a portable method for detecting *Escherichia coli* O157:H7. The method involves preparing gold nanoparticles and gold seeds; modifying an enzyme-linked immunosorbent assay (ELISA) plate with gold nanoparticles, an SH-Ini sequence, and an aptamer sequence partially complementary to the SH-Ini sequence to obtain a DNA-modified gold-based ELISA plate; using the gold seed as a core, depositing gold and platinum on its surface to form bimetallic nanoparticles Au@AuPt NPs; modifying Au@AuPt NPs with the SH-H1 sequence to obtain Au@AuPt-H1, and modifying Au@AuPt with the SH-H2 sequence to obtain Au@AuPt-H1. NPs yield Au@AuPt-H2; the test sample solution, Au@AuPt-H1, and Au@AuPt-H2 are incubated in a DNA-modified gold-based ELISA plate. When E. coli is present in the system, the modified aptamer sequence on the ELISA plate specifically binds to E. coli, exposing the SH-Ini sequence, triggering an HCR reaction between Au@AuPt-H1 and Au@AuPt-H2, catalyzing glucose oxidation, and converting the E. coli concentration into a glucose concentration. This allows for portable detection of E. coli using a blood glucose meter. This method is simple to operate, highly sensitive, reproducible, highly selective, and easy to implement.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, and in particular to a portable method for detecting Escherichia coli O157:H7. Background Technology

[0002] Foodborne illnesses are a major factor affecting global health, causing millions of illnesses and thousands of deaths annually, resulting in enormous losses. *Escherichia coli* O157:H7 is a common foodborne pathogen that can be transmitted through food, posing a significant threat to food safety and causing serious illness. Therefore, infection prevention is crucial, and early detection of contamination sources is of great importance in preventing disease transmission and outbreaks and ensuring food safety in my country.

[0003] Current methods for detecting bacteria mainly include culture methods, electrochemical sensing methods, PCR, fluorescence, and Raman spectroscopy. However, these methods are complex, involve large-scale instruments, and are time-consuming, making them particularly unsuitable for home use. Blood glucose meters are relatively mature portable testing devices that are simple to operate, low in cost, and easy to carry, and are widely used in daily life.

[0004] The development of blood glucose meters for detecting non-glucose targets, such as metal ions, toxins, and bacteria, shows promising application prospects. In the detection of these non-glucose targets, immobilizing nanozymes on DNA as signal probes, recognizing specific targets through DNA, and then using the enzyme to convert the substrate into glucose for final detection will become one of the promising research directions.

[0005] However, the DNA hybridization environment contradicts the optimal activity conditions of natural enzymes. For example, DNA hybridization requires alkaline solutions, while natural enzymes exhibit poor activity in alkaline environments. Furthermore, natural enzymes are easily inactivated. These factors reduce the accuracy and sensitivity of blood glucose meters. Nanozymes, such as metal oxides and metal-organic frameworks, can overcome the disadvantages of natural enzymes, such as easy inactivation and high cost, and can replace them. Therefore, developing nanozymes, combined with the designability and specific recognition characteristics of DNA, to create efficient and accurate detection methods is of great significance for the timely and rapid detection of bacteria. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide a portable method for detecting Escherichia coli O157:H7.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A portable method for detecting Escherichia coli O157:H7 comprises the following steps: preparing gold nanoparticles using sodium citrate solution and tetrachloroauric acid solution; preparing gold seeds using sodium citrate solution, tetrachloroauric acid solution, and sodium borohydride solution; modifying an enzyme-linked immunosorbent assay (ELISA) plate with gold nanoparticles, an SH-Ini sequence, and an aptamer sequence partially complementary to the SH-Ini sequence to obtain a DNA-modified gold-based ELISA plate; forming bimetallic nanoparticles Au@AuPtNPs by depositing gold and platinum on the surface of the gold seeds; modifying Au@AuPtNPs with the SH-H1 sequence to obtain Au@AuPt-H1; and using SH-Ini... Au@AuPtNPs are modified with the -H2 sequence to obtain Au@AuPt-H2; the test sample solution, Au@AuPt-H1, and Au@AuPt-H2 are incubated in a DNA-modified gold-based ELISA plate. When E. coli is present in the system, the modified aptamer sequence on the ELISA plate specifically binds to E. coli, exposing the SH-Ini sequence, triggering the HCR reaction of Au@AuPt-H1 and Au@AuPt-H2, catalyzing the oxidation of glucose to gluconic acid and water, thus reducing the glucose concentration and converting the E. coli concentration into a glucose concentration. Combined with a portable blood glucose meter, this enables portable detection of E. coli.

[0009] The SH-Ini sequence is as follows:

[0010] 5′-SH-(CH2)6-ATACGGGAGCCAACACCACGCATC-3′,

[0011] The aptamer sequence is: 5'ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGATGCGTGG TGTTGGCTCCCGTAT-3'.

[0012] The SH-H1 sequence is:

[0013] 5'-SH-(CH2)6-GAGCCAACACCACGCATCCAAAGTGATGCGTGGTGTTGGCTCCCGTAT-3, wherein the SH-H2 sequence is:

[0014] 5′-ACTTTGGATGCGTGGTGTTGGCTCATACGGGAGCCAACACCACGCATC-(CH2)6-SH-3′.

[0015] The specific operating steps of the above-mentioned portable method for detecting Escherichia coli O157:H7 are as follows:

[0016] (1) Add 1 mL of 1 wt% tetrachloroauric acid solution to 100 mL of ultrapure water, heat to boiling, and quickly add 2.5 mL of 1 wt% sodium citrate solution while stirring vigorously. Keep boiling and stirring for 10 min. At this time, the color of the solution changes from gray to blue to purple to wine red. Remove the heat source and continue stirring for 10 min to obtain gold nanoparticle solution. Take 36 mL of ultrapure water and 1 mL of 10 mM tetrachloroauric acid solution into a 100 mL round bottom flask. Add 1 mL of 10 mM sodium citrate solution and 1 mL of 100 mM sodium borohydride solution in sequence under stirring at room temperature. Stir at room temperature for 1 min. The solution can be observed to turn orange red. Let stand at room temperature for 4-5 h to obtain gold seed solution.

[0017] (2) Add 100 μL of the gold nanoparticle solution obtained in step (1) and 5 μL of 1 μM mPEG-SH solution to each well of the ELISA plate and dry at 80 °C; then add 50 μL of 10 mM tetrachloroauric acid solution and 50 μL of 20 mM hydroxylamine hydrochloride solution to each well, incubate at room temperature for 30 min, wash the plate 3 times with ultrapure water, and pat dry; then add 100 μL of 7.5 nM SH-Ini sequence solution to each well, incubate at room temperature for 4 h, wash the plate 3 times with Tris buffer, and pat dry; then add 100 μL of 7.5 nM aptamer sequence solution to each well, incubate at room temperature for 4 h, wash the plate 3 times with Tris buffer, and pat dry; then add 100 μL of 2 wt% BSA solution to each well, incubate at room temperature for 2 h, wash the plate 3 times with Tris buffer, and pat dry to obtain a DNA-modified gold-based ELISA plate;

[0018] (3) Take 100 mL of the gold seed solution obtained in step (1), add 10 mL of chloroauric acid-chloroplatinic acid mixed solution to it, then slowly add 5 mL of 80 mM ascorbic acid solution, stir at room temperature for 1 min, let stand and age for 5 h to obtain Au@AuPt NPs solution;

[0019] (4) Dissolve the SH-H1 sequence in Tris-HCl buffer to a final concentration of 10 μM, denature at 95 °C for 10 min, and then cool on ice for 10 min to obtain the denatured SH-H1 solution; dissolve the SH-H2 sequence in Tris-HCl buffer to a final concentration of 10 μM, denature at 95 °C for 10 min, and then cool on ice for 10 min to obtain the denatured SH-H2 solution; take 50 μL of Au@AuPt NPs solution obtained in step (3), 2 μL of 20 μM PEG-SH solution, 2 μL of 1 vol% Tween 20 solution and shake to mix well, add 3 μL of the denatured SH-H1 solution and 20 μL of 1 M NaCl solution, mix well and place at 37 °C for 1 h, centrifuge, discard the supernatant, add 250 μL of Tris-HCl buffer to the precipitate to obtain the Au@AuPt-H1 solution; take 50 μL of Au@AuPt obtained in step (3) Mix NPs solution, 2 μL 20 μM PEG-SH solution, and 2 μL 1 vol% Tween 20 solution by shaking. Add 3 μL of denatured SH-H2 solution and 20 μL 1 M NaCl solution, mix well, and incubate at 37 °C for 1 h. Centrifuge, discard the supernatant, and add 250 μL Tris-HCl buffer to the precipitate to obtain Au@AuPt-H2 solution.

[0020] (5) Add 50 μL of Au@AuPt-H1 solution and 50 μL of Au@AuPt-H2 solution obtained in step (4) to each well of the DNA-modified gold-based ELISA plate obtained in step (2), incubate at 37°C for 2 h, wash the plate 3 times with washing buffer, and pat dry; then add 50 μL of glucose solution (20 mM) to each well, incubate at room temperature for 1 h, and then use a portable blood glucose meter (Yuwell Medical, 660) to detect the glucose concentration, and record the blood glucose meter reading as Y1;

[0021] (6) Add 100 μL / well of different concentrations of E. coli O157:H7 standard solution to the DNA-modified gold-based enzyme-labeled plate obtained in step (2), incubate at room temperature for 30 min, wash the plate 3 times with Tris buffer, and pat dry; then add 50 μL of Au@AuPt-H1 solution and 50 μL of Au@AuPt-H2 solution obtained in step (4) to each well, incubate at 37℃ for 2 h, wash the plate 3 times with washing buffer, and pat dry; then add 50 μL of 20 mM glucose solution to each well, incubate at room temperature for 1 h, and then use a portable blood glucose meter to detect the glucose concentration. Record the blood glucose meter reading as Y2, establish the correspondence between the concentration of E. coli and the change in blood glucose meter reading ΔY, and plot a standard curve; where ΔY = Y1 - Y2;

[0022] The gold nanoparticles have an average particle size of 15 nm, the gold seeds have an average particle size of 5 nm, and the Au@AuPtNPs have an average particle size of 8 nm.

[0023] In the chloroauric acid-chloroplatinic acid mixed solution, the molar ratio of chloroplatinic acid to chloroauric acid is 1:10 to 1:1;

[0024] The Tris buffer solution is formulated as follows: 10 mM Tris-HCl, 300 mM NaCl, 5 mM MgCl2; pH = 7.4.

[0025] The Tris-HCl buffer solution has a concentration of 10 mM and a pH value of 7.4.

[0026] The washing buffer solution is formulated as follows: 10 mM Tris-HCl, 300 mM NaCl, 5 mM MgCl2, 0.05 vol% Tween 20; pH = 7.4.

[0027] The establishment of the correspondence between Escherichia coli concentration and blood glucose meter reading refers to plotting a standard curve for detecting Escherichia coli O157:H7 with the logarithm of the concentration of the Escherichia coli standard solution as the abscissa and ΔY as the ordinate.

[0028] The significant advantages of this invention are:

[0029] This invention combines DNA-modified Au@AuPt NPs, which possess both glucose oxidase activity and the ability of nucleic acid aptamers to specifically recognize *E. coli* O157:H7, with further integration of the HCR reaction to significantly amplify the signal, which is then detected using a blood glucose meter. This method is simple to operate, highly sensitive, reproducible, selective, and easy to implement, making it suitable for the determination of *E. coli* O157:H7. Attached Figure Description

[0030] Figure 1 This is a schematic diagram illustrating the detection principle of the present invention.

[0031] Figure 2 TEM morphology of gold seeds and Au@AuPt NPs. Left: gold seeds; Right: Au@AuPt NPs.

[0032] Figure 3 This is a map showing the distribution of gold and platinum elements on the surface of Au@AuPtNPs.

[0033] Figure 4 The particle size distribution of DNA-modified Au@AuPt NPs is shown in the diagram. a, Au@AuPt NPs; b, Au@AuPt-Ini; c, Au@AuPt-H1; d, Au@AuPt-Ini+H1.

[0034] Figure 5 TEM images of Au@AuPtNPs before and after the HCR reaction.

[0035] Figure 6 This is the result of a specific test.

[0036] Figure 7 This is a standard curve of ΔY-bacterial concentration from a blood glucose meter reading. Detailed Implementation

[0037] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0038] In the following examples, the Tris buffer solution was formulated as follows: 10 mM Tris-HCl, 300 mM NaCl, 5 mM MgCl2; pH = 7.4.

[0039] In the following examples, the Tris-HCl buffer solution has a concentration of 10 mM and a pH of 7.4.

[0040] In the following examples, the washing buffer formulation is: 10 mM Tris-HCl, 300 mM NaCl, 5 mM MgCl2, 0.05 vol% Tween 20; pH = 7.4.

[0041] The DNA sequence involved in this invention is as follows:

[0042] The SH-Ini sequence is: 5′-SH-(CH2)6-ATACGGGAGCCAACACCACGCATC-3′

[0043] The aptamer sequence is:

[0044] 5'-

[0045] ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT-3'

[0046] The SH-H1 sequence is: 5'-SH-(CH2)6-GAGCCAACACCACGCATCCAAAGTGATGCGTGGTGTTGGCTCCCGTAT-3

[0047] The SH-H2 sequence is:

[0048] 5′-ACTTTGGATGCGTGGTGTTGGCTCATACGGGAGCCAACACCACGCATC-(CH2)6-SH-3′.

[0049] Example 1

[0050] The portable method for detecting Escherichia coli O157:H7 described in this invention comprises the following steps:

[0051] (1) Preparation of gold nanoparticle solution and gold seed solution

[0052] Add 1 mL of tetrachloroauric acid solution (1 wt%) to 100 mL of ultrapure water, heat to boiling, and then quickly add 2.5 mL of sodium citrate solution (1 wt%) while stirring vigorously. Keep boiling and stirring for 10 min. At this time, the color of the solution changes from gray to blue to purple to wine red. Remove the heat source and continue stirring for another 10 min to obtain a solution of gold nanoparticles with a particle size of 15 nm.

[0053] Take 36 mL of ultrapure water and 1 mL of tetrachloroauric acid solution (10 mM) into a 100 mL round-bottom flask, and add 1 mL of sodium citrate solution (10 mM) and 1 mL of sodium borohydride solution (100 mM) in sequence under stirring at room temperature. Stir at room temperature for 1 min, and observe that the solution changes from pale yellow to orange-red. Let it stand at room temperature for 5 h to obtain a gold seed solution with a particle size of 5 nm.

[0054] (2) Preparation of DNA-modified gold-based enzyme-labeled plates

[0055] Add 100 μL of the gold nanoparticle solution obtained in step (1) and 5 μL of mPEG-SH solution (1 μM) to each well of a 96-well microplate and dry at 80 °C for 3 h. Then add 50 μL of tetrachloroauric acid solution (10 mM) and 50 μL of hydroxylamine hydrochloride solution (20 mM) to each well, incubate at room temperature for 30 min, wash the plate 3 times with ultrapure water, and pat dry. Then add 100 μL of SH-Ini sequence solution (7.5 nM) to each well, incubate at room temperature for 4 h, wash the plate 3 times with Tris buffer, and pat dry. Then add 100 μL of aptamer sequence solution (7.5 nM) to each well, incubate at room temperature for 4 h, wash the plate 3 times with Tris buffer, and pat dry. Then add 100 μL of BSA solution (2% w / v) to each well, incubate at room temperature for 2 h, wash the plate 3 times with Tris buffer, and pat dry to obtain a DNA-modified gold-based microplate.

[0056] (3) Synthesis of bimetallic nanoparticles Au@AuPtNPs

[0057] Take 100 mL of the gold seed solution obtained in step (1), add 10 mL of chloroauric acid-chloroplatinic acid mixed solution (the mixed solution contains 0.8 mM chloroplatinic acid and 4 mM chloroauric acid), then slowly add 5 mL of ascorbic acid solution (80 mM), stir at room temperature for 1 min, and let stand for 5 h to obtain Au@AuPtNPs solution.

[0058] (4) Preparation of DNA-modified bimetallic nanoparticles

[0059] The SH-H1 sequence was dissolved in Tris-HCl buffer to a final concentration of 10 μM, denatured at 95 °C for 10 min, and then cooled on ice for 10 min to obtain the denatured SH-H1 solution. Take 50 μL of Au@AuPt NPs solution obtained in step (3), 2 μL of PEG-SH solution (20 μM), and 2 μL of Tween 20 solution (1% v / v) and vortex to mix. Add 3 μL of the denatured SH-H1 solution and 20 μL of NaCl solution (1 M), mix well, place at 37 °C for 1 h, centrifuge at 15000 rpm for 30 min, discard the supernatant, and add 250 μL of Tris-HCl buffer to obtain the Au@AuPt-H1 solution.

[0060] The SH-H2 sequence was dissolved in Tris-HCl buffer to a final concentration of 10 μM, denatured at 95 °C for 10 min, and then cooled on ice for 10 min to obtain the denatured SH-H2 solution. Take 50 μL of Au@AuPt NPs solution obtained in step (3), 2 μL of PEG-SH solution (20 μM), and 2 μL of Tween 20 solution (1% v / v) and vortex to mix. Add 3 μL of the denatured SH-H2 solution and 20 μL of NaCl solution (1 M), mix well, place at 37 °C for 1 h, centrifuge at 15000 rpm for 30 min, discard the supernatant, and add 250 μL of Tris-HCl buffer to obtain the Au@AuPt-H2 solution.

[0061] The SH-Ini sequence was dissolved in Tris-HCl buffer to a final concentration of 10 μM, denatured at 95 °C for 10 min, and then cooled on ice for 10 min to obtain the denatured SH-Ini solution. 50 μL of Au@AuPt NPs solution obtained in step (3), 2 μL of PEG-SH solution (20 μM), and 2 μL of Tween 20 solution (1% v / v) were shaken and mixed. 3 μL of the denatured SH-Ini solution and 20 μL of NaCl solution (1 M) were added, mixed, and placed at 37 °C for 1 h. After centrifugation at 15000 rpm for 30 min, the supernatant was discarded, and 250 μL of Tris-HCl buffer was added to obtain the Au@AuPt-Ini solution.

[0062] Mix 250 μL of Au@AuPt-H1 solution, 250 μL of Au@AuPt-Ini solution, and 500 μL of Tris buffer to obtain Au@AuPt-Ini+H1 solution.

[0063] (5) HCR reaction

[0064] Add 50 μL of Au@AuPt-H1 solution and 50 μL of Au@AuPt-H2 solution obtained in step (4) to each well of the DNA-modified gold-based ELISA plate obtained in step (2), incubate at 37°C for 2 h, wash the plate 3 times with washing buffer, and pat dry; then add 50 μL of glucose solution (20 mM) to each well, incubate at room temperature for 1 h, and then use a portable blood glucose meter (Yuwell Medical, 660) to detect the glucose concentration, and record the blood glucose meter reading as Y1.

[0065] (6) Establishing a standard curve

[0066] Escherichia coli O157:H7 was diluted with tap water to different concentrations (10). 1 ~10 7The standard solution of *E. coli* (CFU / mL) was obtained and added at 100 μL / well to the DNA-modified gold-based ELISA plate obtained in step (2). The plate was incubated at room temperature for 30 min, washed three times with Tris buffer, and then dried. Then, 50 μL of Au@AuPt-H1 solution and 50 μL of Au@AuPt-H2 solution obtained in step (4) were added to each well, and the plate was incubated at 37 °C for 2 h. The plate was washed three times with washing buffer and then dried. Then, 50 μL of glucose solution (20 mM) was added to each well, and the plate was incubated at room temperature for 1 h. The glucose concentration was then detected using a portable blood glucose meter (Yuwell Medical, 660), and the reading of the blood glucose meter was recorded as Y2. The standard curve for detecting *E. coli* O157:H7 was plotted with the logarithm of the concentration of the *E. coli* standard solution as the x-axis and the difference ΔY (ΔY = Y1 - Y2) between the blood glucose meter reading of glucose solution (20 mM) and the reading after catalysis as the y-axis. The standard curve for detecting Escherichia coli O157:H7 is as follows: Figure 7 As shown, the linear relationship is y = 1.06x + 0.152, R0 2 =0.993, detection limit is 8 CFU / mL.

[0067] (7) Application of DNA-modified bimetallic nanoparticles in portable detection of Escherichia coli O157:H7: Escherichia coli O157:H7 was diluted with tap water to different concentrations to obtain the test samples. 100 μL / well was added to the DNA-modified gold-based enzyme-labeled plate obtained in step (2), incubated at room temperature for 30 min, washed 3 times with Tris buffer, and dried. Then, 50 μL of Au@AuPt-H1 solution and 50 μL of Au@AuPt-H2 solution obtained in step (4) were added to each well, incubated at 37℃ for 2 h, washed 3 times with washing buffer, and dried. Then, 50 μL of glucose solution (20 mM) was added to each well, incubated at room temperature for 1 h. The glucose concentration was then detected using a blood glucose meter. ΔY was substituted into the standard curve obtained in step (6) to calculate the content of Escherichia coli O157:H7 in the test samples, and the sample recovery rate was calculated, as shown in Table 1.

[0068] Table 1

[0069]

[0070] like Figure 1As shown, gold nanoparticles were modified onto a 96-well ELISA plate, and the SH-Ini sequence was modified onto the plate using the interaction between thiol groups and gold. The SH-Ini sequence is partially complementary to the aptamer sequence. Gold seeds were synthesized via sodium borohydride reduction, and then chloroauric acid and chloroplatinic acid were reduced with ascorbic acid to simultaneously deposit gold and platinum atoms on the surface of the gold seeds, thereby synthesizing bimetallic nanoparticles Au@AuPtNPs embedded with gold and platinum sites. The SH-H1 and SH-H2 sequences were modified onto Au@AuPtNPs via gold-sulfur bonds. When E. coli O157:H7 is present, the aptamer specifically recognizes E. coli O157:H7, exposing the SH-Ini sequence, thereby triggering the HCR reaction of Au@AuPtNPs modified with the SH-H1 and SH-H2 sequences, exerting enzyme-like activity. Combined with a blood glucose meter, the bacterial concentration is converted into a glucose decrease concentration. After the HCR reaction, the detection signal is amplified, thus realizing portable detection of bacteria.

[0071] Figure 2 The images show the TEM morphology of gold seeds and Au@AuPt NPs. The left image shows gold seeds, and the right image shows Au@AuPt NPs. As can be seen from the images, the gold seeds and Au@AuPt NPs have uniform morphology. The average particle size of the gold seeds is 5 nm, while the particle size increases to 8 nm after platinum and gold are deposited on their surfaces.

[0072] Figure 3 This image shows the distribution of gold and platinum on the surface of Au@AuPtNPs under a high-resolution transmission microscope. As can be seen from the image, platinum and gold were successfully deposited on the surface of Au@AuPtNPs.

[0073] Figure 4 The figures show the particle size distributions of Au@AuPt NPs, Au@AuPt-Ini, Au@AuPt-H1, and Au@AuPt-Ini+H1. As can be seen from the figures, DNA modification of Au@AuPt NPs increases their particle size.

[0074] Figure 5 These are TEM images of the Au@AuPt-H1 nanoparticles before and after the HCR reaction. The left image shows the nanoparticles before the HCR reaction, and the right image shows the nanoparticles after the HCR reaction. As can be seen from the images, the nanoparticles clearly aggregated together after the HCR reaction, indicating that HCR can occur when DNA is ligated onto Au@AuPtNPs.

[0075] Following the method provided above, PBS and Escherichia coli K12 (5×10⁻⁶) were tested. 5 CFU / mL), Staphylococcus aureus (5×10⁻⁶ ... 5 CFU / mL), Bacillus subtilis B. sublitilis (5×10) 5CFU / mL), Escherichia coli O157:H7 (1×10⁻⁶ ... 5 The test was performed using CFU / mL. The results are as follows: Figure 6 As shown, the method provided by this invention can specifically detect E. coli O157:H7.

[0076] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A portable method for detecting Escherichia coli O157:H7 in an aquatic environment, characterized in that: Gold nanoparticles were prepared using sodium citrate solution and tetrachloroauric acid solution, and gold seeds were prepared using sodium citrate solution, tetrachloroauric acid solution and sodium borohydride solution. The enzyme-labeled plate was modified with gold nanoparticles, SH-Ini sequence and aptamer sequence partially complementary to SH-Ini sequence to obtain DNA modified gold substrate enzyme-labeled plate. Using gold seeds as the core, bimetallic nanoparticles Au@AuPt NPs are formed by depositing gold and platinum on their surface. Au@AuPt NPs are modified with SH-H1 sequence to obtain Au@AuPt-H1, and Au@AuPt NPs are modified with SH-H2 sequence to obtain Au@AuPt-H2. The water environment sample solution to be tested, Au@AuPt-H1, and Au@AuPt-H2 are incubated in a DNA-modified gold-based ELISA plate. When E. coli is present in the system, the modified aptamer sequence on the ELISA plate specifically binds to E. coli, exposing the SH-Ini sequence, triggering the HCR reaction of Au@AuPt-H1 and Au@AuPt-H2, catalyzing the oxidation of glucose to gluconic acid and water, thus reducing the glucose concentration and converting the E. coli concentration into a glucose concentration. Combined with a portable blood glucose meter, this enables portable detection of E. coli in the water environment. The SH-Ini sequence is: 5'-SH-(CH2)6-ATACGGGAGCCAACACCACGCATC-3'. The aptamer sequence is: 5'-ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGATGCGTGGTGTTGGCTCCCGTAT-3'. The SH-H1 sequence is: 5'-SH-(CH2)6-GAGCCAACACCACGCATCCAAAGTGATGCGTGGTGTTGGCTCCCGTAT-3'. The SH-H2 sequence is: 5'-ACTTTGGATGCGTGGTGTTGGCTCATACGGGAGCCAACACCACGCATC-(CH2)6-SH-3'.

2. The portable method for detecting Escherichia coli O157:H7 in an aquatic environment according to claim 1, characterized in that: The specific operating steps are as follows: (1) Add 1 mL of 1 wt% tetrachloroauric acid solution to 100 mL of ultrapure water, heat to boiling, and quickly add 2.5 mL of 1 wt% sodium citrate solution while stirring vigorously. Keep boiling and stirring for 10 min. At this time, the color of the solution changes from gray to blue to purple to wine red. Remove the heat source and continue stirring for 10 min to obtain gold nanoparticle solution. Take 36 mL of ultrapure water and 1 mL of 10 mM tetrachloroauric acid solution into a 100 mL round bottom flask. Add 1 mL of 10 mM sodium citrate solution and 1 mL of 100 mM sodium borohydride solution in sequence under stirring at room temperature. Stir at room temperature for 1 min. The solution turns orange red. Let stand at room temperature for 4-5 h to obtain gold seed solution. (2) Add 100 μL of the gold nanoparticle solution obtained in step (1) and 5 μL of 1 μM mPEG-SH solution to each well of the microplate and dry at 80 °C; then add 50 μL of 10 mM tetrachloroauric acid solution and 50 μL of 20 mM hydroxylamine hydrochloride solution to each well, incubate at room temperature for 30 min, wash the plate 3 times with ultrapure water, and pat dry. Add 100 μL of 7.5 nM SH-Ini sequence solution to each well, incubate at room temperature for 4 h, wash the plate 3 times with Tris buffer, and pat dry. Add 100 μL of 7.5 nM aptamer sequence solution to each well, incubate at room temperature for 4 h, wash the plate 3 times with Tris buffer, and pat dry. Add 100 μL of 2 wt% BSA solution to each well, incubate at room temperature for 2 h, wash the plate 3 times with Tris buffer, pat dry, and obtain DNA-modified gold-based microplate. (3) Take 100 mL of the gold seed solution obtained in step (1), add 10 mL of chloroauric acid-chloroplatinic acid mixed solution to it, and then slowly add 5 mL of 80 mM ascorbic acid solution. Stir at room temperature for 1 min, let stand and age for 5 h to obtain Au@AuPt NPs solution. (4) Dissolve the SH-H1 sequence in Tris-HCl buffer to a final concentration of 10 μM, denature it at 95 °C for 10 min, and then cool it on ice for 10 min to obtain the denatured SH-H1 solution. The SH-H2 sequence was dissolved in Tris-HCl buffer to a final concentration of 10 μM, denatured at 95 °C for 10 min, and then cooled on ice for 10 min to obtain the denatured SH-H2 solution. 50 μL of the Au@AuPt NPs solution obtained in step (3), 2 μL of 20 μM PEG-SH solution, and 2 μL of 1 vol% Tween 20 solution were shaken and mixed. 3 μL of the denatured SH-H1 solution and 20 μL of 1 M NaCl solution were added, mixed, and placed at 37 °C for 1 h. The mixture was centrifuged, the supernatant was discarded, and 250 μL of Tris-HCl buffer was added to the precipitate to obtain the Au@AuPt-H1 solution. 50 μL of the Au@AuPt NPs solution obtained in step (3), 2 μL of 20 μM PEG-SH solution, and 2 μL of 1 vol% Tween 20 solution were shaken and mixed. 3 μL of the denatured SH-H2 solution and 20 μL of 1 vol% Tween 20 solution were added. Mix 1M NaCl solution, place at 37℃ for 1 h, centrifuge, discard the supernatant, add 250 μL Tris-HCl buffer to the precipitate to obtain Au@AuPt-H2 solution; (5) Add 50 μL of Au@AuPt-H1 solution and 50 μL of Au@AuPt-H2 solution obtained in step (4) to each well of the DNA-modified gold-based microplate obtained in step (2), incubate at 37°C for 2 h, wash the plate 3 times with washing buffer, and pat dry; then add 50 μL of 20 mM glucose solution to each well, incubate at room temperature for 1 h, and then use a portable blood glucose meter to detect the glucose concentration, and record the blood glucose meter reading as Y1; (6) Add 100 μL / well of different concentrations of Escherichia coli O157:H7 standard solution to the DNA-modified gold-based enzyme-labeled plate obtained in step (2), incubate at room temperature for 30 min, wash the plate 3 times with Tris buffer, and pat dry; then add 50 μL of Au@AuPt-H1 solution and 50 μL of Au@AuPt-H2 solution obtained in step (4) to each well, incubate at 37℃ for 2 h, wash the plate 3 times with washing buffer, and pat dry; then add 50 μL of 20 mM glucose solution to each well, incubate at room temperature for 1 h, and then use a portable blood glucose meter to detect the glucose concentration. Record the blood glucose meter reading as Y2, and establish the relationship between Escherichia coli concentration and blood glucose meter reading change. The corresponding relationship of Y is established and a standard curve is plotted; where, Y = Y1 - Y2; (7) Add 100 μL of the water environment sample solution to be tested to the DNA-modified gold-based enzyme-labeled plate obtained in step (2) at a rate of 100 μL / well, incubate at room temperature for 30 min, wash the plate 3 times with Tris buffer, and pat dry; then add 50 μL of Au@AuPt-H1 solution and 50 μL of Au@AuPt-H2 solution obtained in step (4) to each well, incubate at 37℃ for 2 h, wash the plate 3 times with washing buffer, and pat dry; then add 50 μL of 20 mM glucose solution to each well, incubate at room temperature for 1 h, and then use a portable blood glucose meter to detect the glucose concentration. Calculate the content of Escherichia coli O157:H7 in the water environment sample solution to be tested according to the standard curve obtained in step (6).

3. The method of claim 2, wherein: The gold nanoparticles have an average particle size of 15 nm, the gold seeds have an average particle size of 5 nm, and the Au@AuPt NPs have an average particle size of 8 nm.

4. The method of claim 2, wherein: The molar ratio of chloroplatinic acid to chloroauric acid in the chloroauric acid-chloroplatinic acid mixed solution is 1:10 to 1:

1.

5. The method of claim 2, wherein: The Tris buffer solution was formulated as follows: 10 mM Tris-HCl, 300 mM NaCl, 5 mM MgCl2; pH = 7.

4.

6. The method of claim 2, wherein: The Tris-HCl buffer solution had a concentration of 10 mM and a pH of 7.

4.

7. The method of claim 2, wherein: The washing buffer solution is formulated as follows: 10 mM Tris-HCl, 300 mM NaCl, 5 mM MgCl2, 0.05 vol% Tween 20; pH=7.

4.

8. The method of claim 2, wherein: The establishment of the correspondence between E. coli concentration and blood glucose meter reading refers to using the logarithm of the concentration of the E. coli standard solution as the x-axis. With Y as the ordinate, a standard curve for detecting Escherichia coli O157:H7 was plotted.

Images