Phyllostachys edulis anthocyanidin reductase gene PeANR4, extraction method and application thereof

Abstract

The present application belongs to the technical field of plant genetic engineering, and particularly relates to a Phyllostachys edulis anthocyanin reductase gene PeANR4, an extraction method and application thereof. The gene PeANR4 encodes an amino acid sequence as shown in SEQ ID NO:2. The present application first finds that the gene PeANR4 has the functions of promoting plant growth and improving drought resistance and salt resistance of plants. The Phyllostachys edulis anthocyanin reductase gene PeANR4 is introduced into Arabidopsis thaliana for verification, and it is found that the growth amount of the transgenic Arabidopsis thaliana plant is greatly increased, and the drought resistance and salt resistance of the plant are greatly improved compared with the wild Arabidopsis thaliana plant.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to a Phyllostachys edulis anthocyanidin reductase gene PeANR4, an extraction method and application thereof. BACKGROUND

[0002] Proanthocyanidin is one of important compounds in flavonoids, and has high biological activity, and plays an important role in anti-aging, antioxidant and DNA protection. The synthesis pathway of proanthocyanidin in plants has been very clear, and the synthesis process is mainly affected by external and internal factors. The external factors include temperature, moisture and light, and the internal factors mainly refer to the synthesis mechanism. The synthesis of proanthocyanidin is similar to the synthesis mechanism of other flavonoids, and is mainly catalyzed by a complex of various enzymes (mainly including three types of enzymes, namely 2-oxoglutarate-dependent dioxygenase, cytochrome P450 and transferase) in the cytoplasm to obtain different substrates.

[0003] Specifically, the synthesis of proanthocyanidins includes: first, 4-coumaric acid coenzyme A and malonyl-coenzyme A in the phenylalanine synthesis pathway generate chalcone under the catalysis of chalcone isomerase (CHS), then flavanones are formed under chalcone isomerase (CHI), then dihydroflavonols are formed under the catalysis of flavanone 3-hydroxylase (F3H), then leucoanthocyanidins are formed under the catalysis of dihydroflavonol-4-reductase (DFR), then one branch is formed under the catalysis of leucoanthocyanidin reductase (LAR) to form catechin, and the other branch is formed under the catalysis of leucoanthocyanidin dioxygenase / anthocyanidin synthase (LDOX / ANS) to form anthocyanidins, then anthocyanidin reductase (ANR) is used to form epicatechin. Finally, catechin and epicatechin are transported to the vacuole to polymerize into proanthocyanidin oligomers and polymers under the action of transporters, and finally proanthocyanidins are formed. The ANR gene is first cloned from Arabidopsis thaliana, and is a nucleotide sequence encoded by the BANYYULS (BAN) gene. At present, ANR has been found and cloned from a variety of plants, such as poplar, strawberry and pea. A large number of studies have shown that the change in the expression amount of the ANR gene is consistent with the accumulation of proanthocyanidin content. In tea, pea and soybean plants, ANR enzymes can catalyze pelargonidin, delphinidin and cyanidin to convert into the corresponding 2,3-cis flavan-3-ols (epiafzelechin, epigallocatechin and epicatechin). It is also found that overexpression of TcANR, grape VbANR and Gossypium hirsutum GhANR1 genes in Arabidopsis thaliana ban mutants can restore the color of the mutant seed coat, accumulate proanthocyanidins, and overexpression of apple MdANR1 and MdANR2, tea CsANR in tobacco can increase the content of proanthocyanidins in tobacco flowers.

[0004] As a plant, Phyllostachys edulis is one of the important economic plants in China, and it is rich in resources and has a wide range of development and application prospects. However, there are few reports on the biosynthesis of flavonoids in Phyllostachys edulis, especially the research on anthocyanidin reductase gene in Phyllostachys edulis has not been reported. Therefore, the research on anthocyanidin reductase gene in Phyllostachys edulis has important significance for the further development and utilization of Phyllostachys edulis. SUMMARY

[0005] In order to solve the above problems, the application extracts the anthocyanin reductase gene PeANR4 from Phyllostachys edulis, and finds that the gene has the functions of promoting plant growth and improving the drought resistance and salt resistance of the plant, and can be used as a target gene to cultivate high-biomass, drought-resistant and salt-resistant plants by means of transgenic means.

[0006] In order to achieve the above purpose, the application can adopt the following technical scheme:

[0007] The application provides a Phyllostachys edulis anthocyanin reductase gene PeANR4, which encodes an amino acid sequence as shown in SEQ ID NO: 2.

[0008] Preferably, the nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 2 is as shown in SEQ ID NO: 1.

[0009] The application provides a nucleic acid sequence, which is obtained by sequence optimization as shown in SEQ ID NO: 1.

[0010] The application provides a biological material, which comprises the Phyllostachys edulis anthocyanin reductase gene PeANR4 or the nucleic acid sequence.

[0011] Preferably, the biological material can comprise a gene expression cassette, a gene expression vector, a gene cloning vector, an engineered bacterium or an engineered cell.

[0012] The application provides an application of the Phyllostachys edulis anthocyanin reductase gene PeANR4 or the nucleic acid sequence or the biological material in promoting plant growth.

[0013] The application provides an application of the Phyllostachys edulis anthocyanin reductase gene PeANR4 or the nucleic acid sequence or the biological material in improving the drought resistance of a plant.

[0014] The application provides an application of the Phyllostachys edulis anthocyanin reductase gene PeANR4 or the nucleic acid sequence or the biological material in improving the salt resistance of a plant.

[0015] The application provides an application of the Phyllostachys edulis anthocyanin reductase gene PeANR4 or the nucleic acid sequence or the biological material in cultivating a plant, and the plant is a drought-resistant plant, a salt-resistant plant, a high-biomass plant, a drought-resistant and salt-resistant plant, a drought-resistant and high-biomass plant, a salt-resistant and high-biomass plant, or a drought-resistant, salt-resistant and high-biomass plant.

[0016] In still another aspect of the present application, a method for extracting the sequence shown as SEQ ID NO: 1 is provided, comprising: (1) taking bamboo shoots as the material, extracting RNA, and reverse transcribing the cDNA as a template; (2) using a primer pair to perform PCR amplification to obtain the bamboo anthocyanin reductase gene PeANR4, wherein the upstream primer of the primer pair is shown as SEQ ID NO: 3, and the downstream primer of the primer pair is shown as SEQ ID NO: 4.

[0017] The present application has at least the following beneficial effects: the anthocyanin reductase gene PeANR4 of the bamboo is found for the first time to have the functions of promoting plant growth and improving the drought and salt resistance of the plant, the anthocyanin reductase gene PeANR4 of the bamboo is introduced into the Arabidopsis thaliana for verification, and the growth amount of the transgenic Arabidopsis thaliana plant is greatly increased, and the drought and salt resistance of the plant is greatly improved compared with the wild Arabidopsis thaliana plant. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 It is the agarose gel electrophoresis map of the double enzyme digestion of the pCAMBIASuper1300-PeANR4 recombinant plasmid in Example 2, wherein M1: DNA molecular weight marker DL15000; 1-3: expression plasmid;

[0019] Figure 2 It is the schematic diagram of the expression vector structure of the pCAMBIASuper1300-PeANR4 in Example 2;

[0020] Figure 3 It is the PCR electrophoresis map of the expression vector pCAMBIASuper1300-PeANR4 plasmid transformed Agrobacterium monoclonal colony in Example 3, wherein M2: DNA molecular weight marker DL2000; 1-5: pCAMBIASuper1300-PeANR4 transformed monoclonal colony; 6: pCAMBIASuper1300-PeANR4 plasmid as positive control; 7: water as negative control;

[0021] Figure 4 It is the PCR detection result electrophoresis map of PeANR4 in the Arabidopsis thaliana plant in Example 4, wherein M2: DNA molecular weight marker DL2000; 1-2: transgenic Arabidopsis thaliana plant; 3: positive control; 4: Col-0 negative control;

[0022] Figure 5 It is the column chart of the biomass (fresh weight) comparison analysis of the PeANR4 transgenic Arabidopsis thaliana in Example 5;

[0023] Figure 6 It is the column chart of the biomass (dry weight) comparison analysis of the PeANR4 transgenic Arabidopsis thaliana in Example 5;

[0024] Figure 7 Figure 6 is a bar graph showing the analysis of proanthocyanidin content in seeds of PeANR4 transgenic Arabidopsis in Example 6;

[0025] Figure 8 Figure 7 is a bar graph showing the analysis of proanthocyanidin content in leaves of PeANR4 transgenic Arabidopsis in Example 6;

[0026] Figure 9 Figure 8 is a chart showing the DMACA staining condition in Example 6, scale = 1 cm;

[0027] Figure 10 Figure 9 is a curve graph showing the analysis of seed germination of PeANR4 transgenic Arabidopsis under drought stress (0 mmol / L mannitol) in Example 6, * indicates significant difference at 0.01 < p < 0.05 level, ** indicates significant difference at p < 0.01 level, and ns indicates p > 0.05;

[0028] Figure 11 Figure 10 is a curve graph showing the analysis of seed germination of PeANR4 transgenic Arabidopsis under drought stress (100 mmol / L mannitol) in Example 7, * indicates significant difference at 0.01 < p < 0.05 level, ** indicates significant difference at p < 0.01 level, and ns indicates p > 0.05;

[0029] Figure 12 Figure 11 is a curve graph showing the analysis of seed germination of PeANR4 transgenic Arabidopsis under drought stress (200 mmol / L mannitol) in Example 7, * indicates significant difference at 0.01 < p < 0.05 level, ** indicates significant difference at p < 0.01 level, and ns indicates p > 0.05;

[0030] Figure 13 Figure 12 is a curve graph showing the analysis of seed germination of PeANR4 transgenic Arabidopsis under drought stress (300 mmol / L mannitol) in Example 7, * indicates significant difference at 0.01 < p < 0.05 level, ** indicates significant difference at p < 0.01 level, and ns indicates p > 0.05;

[0031] Figure 14 Figure 13 is a bar graph showing the analysis of main root length of PeANR4 transgenic Arabidopsis under drought stress in Example 7, * indicates significant difference at 0.01 < p < 0.05 level, ** indicates significant difference at p < 0.01 level, and ns indicates p > 0.05;

[0032] Figure 15Figure 8 is a graph showing the germination of PeANR4 transgenic Arabidopsis seeds under salt stress (0 mmol / L NaCl) in Example 8, where * indicates significant difference at 0.01 < p < 0.05, ** indicates significant difference at p < 0.01, and ns indicates p > 0.05.

[0033] Figure 16 Figure 9 is a graph showing the germination of PeANR4 transgenic Arabidopsis seeds under salt stress (50 mmol / L NaCl) in Example 8, where * indicates significant difference at 0.01 < p < 0.05, ** indicates significant difference at p < 0.01, and ns indicates p > 0.05.

[0034] Figure 17 Figure 10 is a graph showing the germination of PeANR4 transgenic Arabidopsis seeds under salt stress (75 mmol / L NaCl) in Example 8, where * indicates significant difference at 0.01 < p < 0.05, ** indicates significant difference at p < 0.01, and ns indicates p > 0.05.

[0035] Figure 18 Figure 11 is a graph showing the germination of PeANR4 transgenic Arabidopsis seeds under salt stress (100 mmol / L NaCl) in Example 8, where * indicates significant difference at 0.01 < p < 0.05, ** indicates significant difference at p < 0.01, and ns indicates p > 0.05.

[0036] Figure 19 Figure 12 is a graph showing the germination of PeANR4 transgenic Arabidopsis seeds under salt stress (150 mmol / L NaCl) in Example 8, where * indicates significant difference at 0.01 < p < 0.05, ** indicates significant difference at p < 0.01, and ns indicates p > 0.05.

[0037] Figure 20 Figure 13 is a bar graph showing the primary root length of PeANR4 transgenic Arabidopsis under salt stress in Example 8, where * indicates significant difference at 0.01 < p < 0.05, ** indicates significant difference at p < 0.01, and ns indicates p > 0.05. DETAILED DESCRIPTION

[0038] The examples are provided to better illustrate the present application and should not be construed as limiting the present application, which is only limited by the appended claims. Therefore, those skilled in the art, based on the above disclosure, can make non-essential improvements and modifications to the embodiments, which are still within the scope of the present application.

[0039] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure. Unless otherwise defined, all terms of art used herein have the same meaning as commonly understood by one of ordinary skill in the art in the field of the disclosure. In this application, expressions of direction such as "vertical", "horizontal", "top", "bottom", "upper", "lower", "left", "right", "front", "back", "inside", "outside", and the like as can be used in relation to one or more features are intended to encompass such features as they are oriented in use or in operation. Terms such as "including", "containing", "comprising", "having", "fronting", "backing", "lefting", "righting", "topping", "bottoming", "uppering", "lowering", and the like are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise noted. As used herein, "and / or" between elements is to be construed as individual as well as joint occurrences. Terms such as "first", "second", "third", etc. are used to identify different features and do not imply a particular order or sequence.

[0040] To achieve the above object, the present application can adopt the following technical solutions:

[0041] An embodiment of the present application provides a Phyllostachys edulis anthocyanin reductase gene PeANR4, which encodes an amino acid sequence as shown in SEQ ID NO: 2.

[0042] It should be noted that the nucleotide sequence capable of encoding the above-mentioned amino acid sequence as shown in SEQ ID NO: 2 can meet the needs of the present application, and the preferred nucleotide sequence can be as shown in SEQ ID NO: 1.

[0043] Another aspect of the present application provides a nucleic acid sequence, which can be optimized from the sequence as shown in SEQ ID NO: 1. It should be noted that the above-mentioned sequence as shown in SEQ ID NO: 1 can be optimized by the existing technical means in the art, mainly including the following technical means: (1) such as the design and improvement of expression vectors for the transcription stage, such as the use of efficient expression elements such as promoters, enhancers, etc.; (2) improvement of the translation stage, optimization of the gene coding sequence of the recombinant protein itself, including codon bias optimization; (3) optimization of host cells, including efficient expression site positioning and targeted recombination; (4) optimization of cell large-scale culture process. Those skilled in the art can optimize the sequence as shown in SEQ ID NO: 1 according to specific needs to enhance its expression efficiency.

[0044] Another embodiment of the present application provides a biological material comprising the bamboo anthocyanin reductase gene PeANR4 or the nucleic acid sequence. Specifically, the bamboo anthocyanin reductase gene PeANR4 or the nucleic acid sequence can be prepared into a product more conducive to practical application, such as a gene expression cassette, a gene expression vector, a gene cloning vector, an engineered bacterium or an engineered cell. In addition, the types of the engineered bacterium or the engineered cell are known in the art, such as an Agrobacterium, and the bamboo anthocyanin reductase gene PeANR4 or the nucleic acid sequence can be transduced into the Agrobacterium to form the engineered bacterium. In addition, the engineered cell is generally a tissue cell of a plant or a fertilized egg.

[0045] Another embodiment of the present application provides an application of the bamboo anthocyanin reductase gene PeANR4 or the nucleic acid sequence or the biological material in promoting plant growth. Specifically, based on the application of the bamboo anthocyanin reductase gene PeANR4 in promoting plant growth, the optimized nucleic acid sequence or the biological material prepared from the raw material can also promote plant growth. In some specific embodiments, the transgenic Arabidopsis thaliana transformed by the bamboo anthocyanin reductase gene PeANR4 has a fresh weight and a dry weight of the aboveground part of 1.55 times and 2.08 times or more than the wild type Arabidopsis thaliana, respectively, and the anthocyanin content of the leaves and seeds of the transgenic Arabidopsis thaliana is 1.25 times and 1.57 times or more than the wild type Arabidopsis thaliana, respectively, indicating that the bamboo anthocyanin reductase gene PeANR4 can significantly promote plant growth. It should be noted that the indicators in promoting plant growth particularly include the increase of proanthocyanidins.

[0046] Another aspect of the present application provides an application of the bamboo anthocyanin reductase gene PeANR4 or the nucleic acid sequence or the biological material in improving the drought resistance of plants. Specifically, based on the application of the bamboo anthocyanin reductase gene PeANR4 in promoting plant growth, the optimized nucleic acid sequence or the biological material prepared from the raw material can also improve the drought resistance of plants. In some specific embodiments, the transgenic Arabidopsis thaliana transformed by the bamboo anthocyanin reductase gene PeANR4 has a germination rate of about 90% under the drought stress of 300 mmol / L mannitol for 5 days, which is much higher than the wild type of about 55%, and a main root length of more than 22.51 mm for 7 days, which is much higher than the wild type of 13.53 mm.

[0047] In another aspect of the present application, the application of the Phyllostachys edulis anthocyanidin reductase gene PeANR4 or the nucleic acid sequence or the biological material in improving the salt tolerance of a plant is provided. In some specific embodiments, the transgenic Arabidopsis thaliana transformed by the Phyllostachys edulis anthocyanidin reductase gene PeANR4 has a germination rate of about 95% under the salt stress of 100 mmol / L NaCl for 5 days, which is much higher than that of the wild type of about 87%; and the main root length of the transgenic Arabidopsis thaliana is more than 17.17 mm under the salt stress of 150 mmol / L NaCl for 7 days, which is much higher than that of the wild type of 13.13 mm.

[0048] In another aspect of the present application, the application of the Phyllostachys edulis anthocyanidin reductase gene PeANR4 or the nucleic acid sequence or the biological material in cultivating a plant is provided, and the plant is a drought-resistant plant, a salt-resistant plant, a high-biomass plant, a drought-resistant and salt-resistant plant, a drought-resistant and high-biomass plant, a salt-resistant and high-biomass plant, or a drought-resistant, salt-resistant and high-biomass plant. It should be noted that the Phyllostachys edulis anthocyanidin reductase gene PeANR4 or the nucleic acid sequence or the biological material can be introduced into a plant by a transgenic technology to cultivate the plant, and the plant can be improved to obtain a transgenic plant of a drought-resistant plant, a salt-resistant plant, a high-biomass plant, a drought-resistant and salt-resistant plant, a drought-resistant and high-biomass plant, a salt-resistant and high-biomass plant, or a drought-resistant, salt-resistant and high-biomass plant. The transgenic technology includes a gene editing technology and a technology of transfection by Agrobacterium, which can be selected according to specific conditions.

[0049] It should be noted that the term “high-biomass plant” specifically refers to a transgenic plant obtained by transgenically introducing the Phyllostachys edulis anthocyanidin reductase gene PeANR4 as a target gene, and the biomass (fresh weight and dry weight) and the proanthocyanidin content of the transgenic plant are both improved compared with those of a wild type plant under the same conditions.

[0050] In another aspect of the present application, a method for extracting the sequence as shown in SEQ ID NO: 1 is provided, which comprises the following steps: (1) taking Phyllostachys edulis shoots as a material, extracting RNA, and reverse transcribing the RNA into cDNA as a template; and (2) using a primer pair to perform PCR amplification to obtain the Phyllostachys edulis anthocyanidin reductase gene PeANR4, wherein the upstream primer of the primer pair is as shown in SEQ ID NO: 3, and the downstream primer of the primer pair is as shown in SEQ ID NO: 4.

[0051] In order to better understand the present application, the content of the present application will be further illustrated below in combination with specific examples, but the content of the present application is not limited to the following examples only.

[0052] Example 1: Obtaining the coding region sequence of the Phyllostachys edulis anthocyanidin reductase gene PeANR4

[0053] The bamboo shoots (Phyllostachys edulis) were used as materials to extract RNA and reverse transcription into cDNA as a template; the specific primers were designed according to the predicted gene PH02Gene32097 in bamboo, and the coding region sequence was amplified by PCR, and the primer sequences are shown in Table 1.

[0054] Table 1 PCR amplification primer

[0055] Upstream primer 5'- ATGTTGGCGGTAGAAACGAAGA -3' (SEQ ID NO: 3) Downstream primer 5'-TTAGAACGGCAGAATTCCCAAC-3' (SEQ ID NO: 4)

[0056] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was purified and recovered. The recovered DNA fragment was ligated to the pGEM-T easy vector, and the E. coli DH5α competent cells were transformed. After blue-white spot screening, the positive clone plasmid was extracted and enzyme digestion map analysis, then the single clone was sequenced, and the inserted fragment was 1017 bp, as shown in SEQ ID NO: 1. Subsequently, the Blast online software was used to compare several ten thousand genes in the predicted genome of bamboo, and it was found that SEQ ID NO: 1 was completely consistent with PH02Gene32097 sequence.

[0057] Further analysis by BlastP online comparison found that the amino acid sequence (SEQ ID NO: 2) encoded by the gene had the highest consistency (80.06%) with ANR (XP_040255791.1) of Aegilops tauschii, and the consistency with ZmANR (PWZ46070.1) of Zea mays was 76.72%; protein domain analysis showed that the protein had an ANR enzyme-related conserved domain Epimerase (pfm01370), containing Ser-130, Tyr-167, Lys-171 active sites and NADH binding region (G-G-X-G-X-X-G / A). Among them, Ser-130 is both an NADPH binding site and a substrate binding site. It can be seen that the cloned gene encodes an anthocyanin reductase, which is named PeANR4, and the pGEM-Teasy vector containing the gene is pT-PeANR4.

[0058] Example 2 Construction of plant expression vector carrying bamboo anthocyanin reductase gene PeANR4

[0059] According to the sequence shown in SEQ ID NO: 1, an amplification primer with a homologous arm and a restriction site XbaI / HindIII was designed, and the cDNA of Phyllostachys edulis was used as a template. The sequencing correct plasmid obtained in Example 1 was diluted 40 times, and PrimeSTAR Mix high-fidelity enzyme was used for PCR amplification. The fragment containing the restriction site (XbaI / HindIII) required for the construction of the expression vector and the deoxyribonucleotide sequence of the coding region of Phyllostachys edulis PeANR4 was amplified. The primer sequences are shown in Table 2 below.

[0060] Table 2 Primer sequences

[0061]

[0062] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was purified and recovered. The target gene and the pCAMBIASuper1300 vector restriction fragment were connected using one-step cloning technology. The reaction system is as follows (20 μL) in Table 3 below.

[0063] Table 3 Cloning reaction system of target gene and pCAMBIASuper1300 vector restriction fragment

[0064] Component Volume 5x reaction buffer 4.0 μL NovoRec Plus recombinant enzyme 1.0 μL pCAMBIA Super 1300 restriction vector 1.0 μL Fragment of interest 1.0 μL ddH2O 13.0 μL

[0065] All reagents were added to the PCR tube in the above order, mixed and centrifuged, placed in a 50°C water bath for 10 min, and then transformed into E. coli DH5α. The plasmid was extracted, and the restriction map identification and sequencing verification were performed. The restriction map identification is shown in Figure 1 .

[0066] The obtained recombinant expression vector was named pCAMBIASuper1300-PeANR4 (see Figure 2 ).

[0067] Example 3 Identification of Monoclonal Colonies Containing Expression Vector pCAMBIASuper1300-PeANR4

[0068] The expression vector pCAMBIASuper1300-PeANR4 constructed in Example 2 was transformed into Agrobacterium tumefaciens strain EHA105 competent cells by electroporation. Single colonies growing on kanamycin-resistant (50 mg·L -1 ) plates were picked for PCR identification. The monoclonal colonies formed after transformation of the PeANR4 gene recombinant expression vector were used as templates, and the primers in Example 2 (shown in Table 2) were used for PCR detection. The recombinant plasmid pCAMBIASuper1300-PeANR4 was used as a positive control, and water was used as a negative control.

[0069] Results are shown in Figure 3 Figure 4. The results of PCR electrophoresis of the plasmid pCAMBIASuper1300-PeANR4 transformed Agrobacterium monoclonal colonies showed that the monoclonal colonies contained the target gene fragment, and the Agrobacterium monoclonal bacterial liquid obtained by shaking could be used for infection and transformation experiments.

[0070] Example 4 Transformation of PeANR4 into Arabidopsis thaliana and PCR detection

[0071] Using the bacterial liquid obtained in Example 3, wild-type Arabidopsis thaliana was transformed by the dipping method, and through continuous resistance (hygromycin 50 mg·L -1 ) screening, two T3 generation transgenic Arabidopsis thaliana lines were obtained without separation, and gene expression detection was performed.

[0072] The DNA of the transgenic Arabidopsis thaliana plants and wild-type Arabidopsis thaliana plants was extracted, and PCR detection was performed using the primers in Example 2. The results are shown in Figure 4 , which showed that the target gene was detected in the transgenic Arabidopsis thaliana plants, but not in the wild-type Arabidopsis thaliana plants, proving that PeANR4 had been transferred into the Arabidopsis thaliana plants.

[0073] Example 5 Comparison and analysis of the biomass of PeANR4 transgenic Arabidopsis thaliana

[0074] Statistical analysis of the biomass of 3-week-old Arabidopsis thaliana seedlings found that, as shown in Figure 5 and Figure 6 , compared with wild-type Arabidopsis thaliana (WT) and Arabidopsis thaliana anthocyanin reductase gene mutant ban (SALK_040250C), the overexpression PeANR4 lines OE-1 and OE-2 (it should be noted that there are differences between the overexpression PeANR4 lines, which are normal) increased the dry weight and fresh weight biomass of Arabidopsis thaliana plants, among which the fresh weight was 1.39 and 1.55 times that of WT, and 2.37 and 2.57 times that of ban; and their dry weight was 1.78 and 2.08 times that of WT, and 2.05 and 2.40 times that of ban.

[0075] Example 6 Analysis of the content of procyanidins in PeANR4 transgenic Arabidopsis thaliana

[0076] The content of procyanidins in the leaves of the plants was determined, and the results are shown in Figure 7 , which showed that the content of procyanidins in the leaves of WT was 25.56 mg / plant, and that of ban was 15.78 mg / plant, while the content of procyanidins in the leaves of the overexpression PeANR4 lines OE-1 and OE-2 was 1.24 and 1.25 times that of WT, and 2.01 and 2.02 times that of ban.

[0077] The content of proanthocyanidins in the seeds was determined, and the results are shown in Table 1. Figure 8 As shown in Table 1, the content of WT was 50.24 mg·g -1 ; the content of ban was significantly lower than that of WT; and the content of proanthocyanidins in the seeds of Arabidopsis thaliana overexpressing PeANR4 gene was significantly higher than that of WT, being 1.53 and 1.57 times that of WT, respectively.

[0078] Proanthocyanidins are flavonoids polymerized from catechin or epicatechin, and thus can be chemically dyed using 4-dimethylaminocinnamaldehyde (DMACA). The results of dyeing are shown in Table 2. Figure 9 As shown in Table 2, the overexpression of PeANR4 gene deepened the color of the seed coat of Arabidopsis thaliana, which was consistent with the results of determination of the content of proanthocyanidins therein.

[0079] Example 7 Seed germination and root length analysis of PeANR4 transgenic Arabidopsis thaliana under drought stress

[0080] After sterilization, the seeds of transgenic lines OE-1 and OE-2, as well as ban, WT were uniformly sown on 1 / 2MS medium containing mannitol, and the germination rates of the lines within 7 days were counted.

[0081] As shown in Table 3, on the medium without the addition of mannitol, there was no significant difference in the germination rates of OE-1 and OE-2 lines and those of ban and WT. However, on the medium containing mannitol, it was found on the 3rd day that the germination rates of OE-1 and OE-2 lines were significantly higher than those of WT, and the germination rates of ban were significantly lower than those of WT. Figure 10 As shown in Table 4, on the medium containing 100 mmol / L mannitol, the germination rates of OE-1 and OE-2 lines were 88.33% and 86.67%, respectively, which were significantly higher than those of ban (75.00%) and WT (81.67%);

[0082] Figure 11 As shown in Table 5, on the medium containing 200 mmol / L mannitol, the germination rates of OE-1 and OE-2 lines were 80.00% and 76.67%, respectively, which were significantly higher than those of ban (41.67%) and WT (56.67%).

[0083] As shown in Table 6, on the medium containing 300 mmol / L mannitol, it was found on the 4th day that the germination rates of OE-1 and OE-2 lines were 78.33% and 76.67%, respectively, which were still significantly higher than those of ban (16.67%) and WT (26.67%); Figure 12

[0084] Figure 13

[0085] ​​​​The germination rates of all seeds reached their highest levels on day 5. On medium containing 100 mmol / L mannitol, the germination rates of OE-1 and OE-2 lines were 95.00% and 96.67%, respectively, higher than those of ban (86.67%) and WT (93.33%). On medium containing 200 mmol / L mannitol, the germination rates of OE-1 and OE-2 lines were 93.33% and 91.67%, respectively, significantly higher than those of ban (70.00%) and WT (81.67%). On medium containing 300 mmol / L mannitol, the germination rates of OE-1 and OE-2 lines were 91.67% and 90.00%, respectively, still significantly higher than those of ban (43.33%) and WT (56.67%). After that, the germination rates remained relatively stable.

[0086] The above results indicate that overexpression of the PeANR4 gene can improve the germination rate of Arabidopsis seeds under drought stress.

[0087] In addition, after sterilizing the transgenic lines OE-1 and OE-2, as well as the seeds of ban and WT, they were sown on 1 / 2 MS medium. When the plants reached the 5th day, the Arabidopsis thaliana lines with uniform growth were transferred to 1 / 2 MS medium containing mannitol and cultured vertically for 7 days. The length of the taproot was then measured.

[0088] The results are as follows Figure 14 As shown in the figure (the horizontal axis of each group represents WT, ban, OE-1, and OE-2 from left to right), the results indicate that on the medium without mannitol, the taproots of lines OE-1 and OE-2 were not significantly different from those of ban and WT. However, on the medium containing mannitol, the root lengths of lines OE-1 and OE-2, as well as ban and WT, were inhibited, and the inhibition of taproots became more pronounced with increasing mannitol concentration. However, the root lengths of lines OE-1 and OE-2 were significantly longer than those of WT, while the root lengths of ban were significantly shorter than those of WT. Specifically, on a medium containing 100 mmol / L mannitol, the root lengths of OE-1 and OE-2 lines were 35.86 mm and 36.72 mm, respectively, significantly longer than those of ban (24.38 mm) and WT (30.76 mm). On a medium containing 200 mmol / L mannitol, the root lengths of OE-1 and OE-2 lines were 35.03 mm and 27.78 mm, respectively, significantly longer than those of ban (14.74 mm) and WT (17.12 mm). On a medium subjected to 300 mmol / L mannitol stress, the root lengths of OE-1 and OE-2 lines were 20.90 mm and 22.51 mm, respectively, significantly longer than those of ban (12.86 mm) and WT (13.53 mm).

[0089] The above results indicate that overexpression of the PeANR4 gene can reduce the inhibitory effect of drought stress on the primary root.

[0090] Example 8 Seed germination and root length analysis of PeANR4 transgenic Arabidopsis under salt stress

[0091] After sterilization, seeds of transgenic lines OE-1 and OE-2 and ban, WT were uniformly sowed on 1 / 2MS medium containing NaCl, and the germination rate of each line was counted within 7 days.

[0092] The results showed that there was no significant difference in germination rate between OE-1 and OE-2 lines and ban and WT on medium without NaCl (see Figure 15 ). However, on medium containing NaCl (50 mmol / L, 75 mmol / L and 100 mmol / L) (see Figure 16 , Figure 17 , Figure 18 ), it was found that the germination rate of OE-1 and OE-2 lines was significantly higher than that of WT, while the germination rate of ban was significantly lower than that of WT on the 3rd day. Figure 16 Among them, on medium containing 75 mmol / L NaCl (see Figure 18 ), the germination rate of OE-1 and OE-2 lines was 88.33% and 86.67%, respectively, which was significantly higher than that of ban (60.00%) and WT (63.33%); on medium containing 100 mmol / L NaCl (see ), it was found that the germination rate of OE-1 and OE-2 lines was 58.33.00% and 58.33%, respectively, which was still significantly higher than that of ban (43.33%) and WT (45.00%) on the 3rd day; on the 4th day, it was found that the germination rate of OE-1 and OE-2 lines was 60.00% and 61.67%, respectively, which was still significantly higher than that of ban (45.00%) and WT (46.67%).

[0093] In addition, on medium containing 150 mmol / L NaCl (see Figure 19 ), it was found that ban did not germinate, while the germination rate of OE-1 and OE-2 lines was 20.33% and 22.33%, respectively, which was higher than that of WT (15.33%) on the 5th day; on medium containing 200 mmol / L NaCl, ban, WT, OE-1 and OE-2 lines did not germinate.

[0094] In summary, on media containing NaCl (50 mmol / L, 75 mmol / L, 100 mmol / L, and 200 mmol / L), the seed germination rates of all media reached their highest levels on day 5. Specifically, on media containing 75 mmol / L NaCl, the germination rates of lines OE-1 and OE-2 were 95.00% and 98.33%, respectively, significantly higher than those of ban (81.67%) and WT (88.33%). On media under 100 mmol / L NaCl stress, the germination rates of lines OE-1 and OE-2 were 93.33% and 93.33%, respectively, significantly higher than those of ban (66.67%) and WT (78.33%). Afterward, the germination rates remained essentially unchanged.

[0095] The above results indicate that overexpression of the PeANR4 gene can improve the germination rate of seeds under salt stress.

[0096] After sterilizing the transgenic lines OE-1 and OE-2, as well as the seeds of ban and WT, they were sown on 1 / 2 MS medium. On the 5th day, the Arabidopsis lines with uniform growth were transferred to 1 / 2 MS medium containing NaCl and cultured vertically for 7 days. The length of the taproot was then measured.

[0097] The results are as follows Figure 20 As shown in the figure (the horizontal axis of each group from left to right represents WT, ban, OE-1, and OE-2), the results indicate that the root lengths of OE-1 and OE-2 lines, as well as ban and WT, were inhibited on the NaCl-containing medium. The inhibition of the taproot became more pronounced with increasing NaCl concentration. However, the root lengths of OE-1 and OE-2 lines were significantly longer than WT, while the root lengths of ban were significantly shorter than WT. Specifically, on the 100 mmol / L NaCl medium, the root lengths of OE-1 and OE-2 lines were 23.43 mm and 25.57 mm, respectively, significantly longer than ban (8.68 mm) and WT (12.06 mm). On the 150 mmol / L NaCl-stressed medium, the root lengths of OE-1 and OE-2 lines were 16.63 mm and 17.17 mm, respectively, significantly longer than ban (6.15 mm) and WT (13.13 mm). On a medium under 200 mmol / L NaCl stress, the root lengths of the OE-1 and OE-2 lines were 10.25 mm and 11.66 mm, respectively, which were still significantly higher than those of ban (6.71 mm) and WT (8.21 mm).

[0098] The results indicate that the PeANR4 gene significantly increases root length in plants under moderate salt stress (150 mmol / L).

[0099] Finally, it is to be explained that the above embodiments are only used to illustrate the technical solutions of the present application but not to limit the present application. Although the present application is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or equivalently replaced without departing from the purpose and scope of the technical solutions of the present application, and all of them should be covered in the scope of the claims of the present application.

Claims

1. Overexpression of moso bamboo ( Phyllostachys edulis Anthocyanin reductase gene PeANR4 Applications in promoting Arabidopsis growth: Promoting Arabidopsis growth by increasing Arabidopsis biomass; Bamboo anthocyanin reductase gene PeANR4 The amino acid sequence is encoded as shown in SEQ ID NO:

2.

2. Overexpression of Phyllostachys edulis anthocyanin reductase gene PeANR4 Application in improving drought resistance of Arabidopsis thaliana; Phyllostachys edulis anthocyanin reductase gene PeANR4 Encoding an amino acid sequence as shown in SEQ ID NO:

2.

3. Overexpression of Phyllostachys edulis anthocyanin reductase gene PeANR4 Application in improving salt resistance of Arabidopsis thaliana; Phyllostachys edulis anthocyanin reductase gene PeANR4 Encoding an amino acid sequence as shown in SEQ ID NO:

2.

4. The Phyllostachys edulis anthocyanin reductase gene is overexpressed PeANR4 In the application in breeding Arabidopsis, Arabidopsis is drought-resistant Arabidopsis, salt-resistant Arabidopsis, high-biomass Arabidopsis, drought-resistant and salt-resistant Arabidopsis, drought-resistant high-biomass Arabidopsis, salt-resistant high-biomass Arabidopsis, or drought-resistant, salt-resistant and high-biomass Arabidopsis; the Phyllostachys edulis anthocyanin reductase gene PeANR4 The amino acid sequence shown as SEQ ID NO: 2 is encoded.

5. Use according to any one of claims 1 to 4, characterized in that, Phyllostachys edulis anthocyanin reductase gene PeANR4 The nucleotide sequence of the gene is shown as SEQ ID NO:

1.

6. Use according to any one of claims 1 to 4, characterized in that, Method for extracting phyllostachys edulis anthocyanin reductase gene PeANR4 The method comprises the following steps: (1) taking bamboo shoots as a material, extracting RNA, and reversely transcribing the RNA into cDNA as a template; (2) using a primer pair to perform PCR amplification to obtain the phyllostachys edulis anthocyanin reductase gene PeANR4 PeANR4 , wherein the upstream primer of the primer pair is shown as SEQ ID NO: 3, and the downstream primer of the primer pair is shown as SEQ ID NO: 4.

Images