Epimedium breeding method based on light foraging characteristics and genetic background detection and application
By measuring the biomass information and light-foraging characteristics of Epimedium plants, and combining the SNP sites of matK and ITS sequences, an efficient method for breeding Epimedium varieties was developed, solving the classification and breeding problems of Epimedium plants and realizing the scientific breeding of high-yielding Epimedium varieties.
Patent Information
- Application Number
- CN202310664849.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-06
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2043-06-06
AI Technical Summary
The classification of Epimedium species is inconsistent and the identification is ambiguous. The quality of Epimedium species in the market is uneven, making it difficult to determine high-yielding varieties through field yield measurement. Furthermore, the differences in photosynthetic efficiency cannot be effectively compared, leading to breeding difficulties.
By measuring biomass information of Epimedium plants, such as petiole length, width, and leaf area, and combining this with light-fed characteristics, a method for breeding high-yielding Epimedium varieties was developed. Species identification was performed using SNP sites of matK and ITS sequences, and targeted amplification primers were designed for product identification.
It has achieved efficient and scientific breeding of Epimedium varieties, accurately distinguishing germplasm grades, guiding the breeding of high-yield varieties, and solving the problems of identification difficulties and differences in photosynthetic efficiency in the breeding process.
Smart Images

Figure BDA0004275102740000051 
Figure BDA0004275102740000061 
Figure BDA0004275102740000071
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant (crop) genetic breeding technology, specifically to a method and application for breeding high-yielding Epimedium varieties based on light-foraging characteristics and genetic background detection. Background Technology
[0002] Epimedium is a genus of perennial shade-loving herbs belonging to the Berberidaceae family. Currently, 68 species have been discovered worldwide, most discontinuously distributed in East Asia, with a few species found in Southern Europe, the Mediterranean, and northernmost Africa. China is home to most of the Epimedium genus, and approximately 85% of these species are endemic to China. Therefore, China has a significant advantage in Epimedium germplasm resources and is also an important center of distribution and differentiation.
[0003] However, the classification of Epimedium species has long been subject to differing opinions, making it one of the genera with the most significant taxonomic disputes. Furthermore, the medicinal varieties of Epimedium are numerous and complex, leading to unclear identification. A lack of professional knowledge results in numerous problems such as mis-harvesting and mis-selling, adulteration, and confusion due to similar characteristics. This results in inconsistent quality of Epimedium sold in the market, with the prevalence of counterfeit, adulterated, or substitute products. In addition, the diversity and wide distribution of Epimedium species make interspecific hybridization easy, and the characteristics are not clearly distinguishable. The species itself is affected by various factors such as origin, variety, medicinal part, harvesting season, and altitude. Even the same variety exhibits significant differences in characteristics under different ecological environments, easily resulting in multiple intermediate transitional traits. This leads to varying levels of internal active ingredients and unstable quality, greatly impacting clinical treatment. Therefore, identification and differentiation are extremely difficult.
[0004] In the field of plant (crop) genetics and breeding, the most direct method for selecting high-yielding varieties is yield measurement. However, as is well known, yield is affected by many factors, including plant genetic background, soil nutrient composition, cultivation techniques, and natural environment. In the initial stages of wild plant breeding, when water, fertilizer, pesticides, and cultivation techniques are not yet perfect, the yields of different varieties or lines in germplasm resource nurseries or superior wild plant resources are highly unstable. In this situation, it is particularly important to discover and apply other clearly defined biological indicators that affect yield. For Epimedium, in addition to the aforementioned difficulties in identification, the selection of high-yielding varieties is also challenging due to the large number of varieties, making it impossible to effectively compare differences in nutrient utilization and photosynthetic efficiency among different species. Furthermore, the number of some superior plants is very small or nonexistent, making it impossible to anchor breeding materials through field yield measurement. Therefore, developing a scientific, stable, and efficient method for breeding high-yielding Epimedium varieties is of paramount importance for the development and marketization of Epimedium varieties. Summary of the Invention
[0005] This invention aims to at least solve one of the aforementioned technical problems existing in the prior art. Therefore, the purpose of this invention is to provide a method and application for breeding high-yielding Epimedium varieties based on photoforaging characteristics and genetic background detection. In this invention, the inventors, through cultivation verification of collected wild Epimedium resources, discovered that the biomass information of Epimedium plants (such as leaf area) can be used as a biomass indicator. Furthermore, by measuring multiple phenotypic parameters of Epimedium compound leaves, the photoforaging characteristics of Epimedium plants were determined, and based on these characteristics, a specific breeding method was developed, which is then applied to the breeding practice of high-yielding Epimedium varieties.
[0006] The first aspect of this invention provides a method for screening Epimedium germplasm, comprising the following steps:
[0007] Biomass information of the sample to be tested is determined or calculated, and high-quality germplasm populations are selected based on the biomass information.
[0008] In some embodiments of the present invention, the biomass information includes at least three of the following: petiole length, petiole width, leaf length, leaf width, leaf area, and plant dry weight.
[0009] In some embodiments of the present invention, the petiole length includes the petiole length of compound leaves and the petiole length of leaflets.
[0010] In some embodiments of the present invention, the petiole width includes the petiole width of compound leaves and the petiole width of leaflets.
[0011] In this invention, the term "compound leaf" refers to a plurality of leaflets that grow together on a single petiole.
[0012] In some embodiments of the present invention, the biomass information includes at least petiole length, petiole width, and leaf area (or blade area).
[0013] In some embodiments of the present invention, the high-quality germplasm resource has at least the following characteristics: petiole length ≥ 10 cm, petiole width ≥ 0.4 cm, and leaf area ≥ 10 cm². 2 .
[0014] In some embodiments of the present invention, the high-quality germplasm resource has at least the following characteristics: petiole length ≥ 14 cm, petiole width ≥ 0.7 cm, and leaf area ≥ 20 cm². 2 .
[0015] In this invention, the germplasm grading criteria for Epimedium based on petiole length, petiole width, and leaf area are shown in Table 3 of the specification.
[0016] In some embodiments of the present invention, the method further includes species identification of the selected high-quality germplasm resources to determine their hybridization ability.
[0017] In some embodiments of the present invention, the species identification includes at least one of morphological classification, ecological classification, molecular biological classification, and genotypic classification.
[0018] In some embodiments of the present invention, the species identification is performed using molecular biological classification.
[0019] In this invention, the term "light foraging" refers to the plant morphology and growth characteristics evolved by Epimedium species to compete with weeds for light. In this invention, this characteristic is mainly manifested in the length and width of the compound leaf petioles and petiolules, leaf area, as well as the growth cycle and growth rate of the compound leaf petioles. A typical light foraging characteristic of Epimedium species is that they rapidly elongate their compound leaf petioles when sprouting new leaves in early spring, making their plant height exceed that of other companion weeds to obtain sunlight; this is the first stage of achieving self-generated photosynthetic advantage. In the second stage, dominant Epimedium species maximize sunlight absorption by extending their leaflet petioles; the length of the leaflet petiole directly determines the maximum width of the three leaflets. If the leaflet petiole is short, it is insufficient to extend the leaves to maximize sunlight absorption. Thirdly, the width of the compound leaf petioles and leaflet petioles directly determines the total leaf biomass, mainly affecting leaf length. Discovering and applying this pattern to the breeding of high-yielding Epimedium species has proven highly effective.
[0020] A second aspect of the present invention provides a method for identifying plants of the genus Epimedium, comprising the following steps:
[0021] Nucleic acid was extracted from the plant samples to be tested, and matK and ITS sequences were separated. SNP sites in the matK and ITS sequences were detected. Based on the correspondence between SNP sites and Epimedium species, the species relationship of the plant samples to be tested was determined.
[0022] Using the genomic information of the Epimedium E004 population as a reference, polymorphisms at positions 51, 53, 57, 66, 67, 68, 70, 89, 90, 96, 106, 151, 190, 197, 239, 284, 296, 331, 395, 412, 413, 421, 497, 581, 584, 612, 613, 614, 615, 616, 617, 648, 651, 652, 664, 766, 776, 787, 812, 830, 831, 845, 855, 858, 869, 879, 889, 892, 894, 903, 907, 910, and 925 were detected in the matK sequence.
[0023] Polymorphisms at bases 59, 72, 90, 91, 98, 103, 118, 153, 159, 170, 174, 176, 182, 358, 384, 391, 393, 398, 400, 407, 412, 419, 437, 446, 447, 450, and 480 were detected in the ITS sequence.
[0024] The matK sequence of the Epimedium E004 population is shown in SEQ ID NO: 5.
[0025] The ITS sequence of the Epimedium E004 population is shown in SEQ ID NO: 6.
[0026] Of course, those skilled in the art should understand that the above-mentioned positions include the corresponding positions when referring to the genome information of other Epimedium species, and the reference Epimedium genome information cannot be used to limit the specific location of SNP sites.
[0027] In some embodiments of the present invention, the lengths of the amplified matK and ITS sequences obtained will vary depending on the genomic information of different Epimedium species. For example, the matK sequence length of Epimedium populations ranges from a minimum of 723 bp (e.g., E024) to a maximum of 941 bp (e.g., E004, E006), with a GC content of 32.4%–33.2%. The ITS sequence length ranges from a minimum of 479 bp (e.g., E044) to a maximum of 562 bp (e.g., E035, E041), with a GC content of 52.1%–53.4%. However, all of these sequences include the SNP sites mentioned above, and therefore should be understood to be within the scope of protection of the present invention.
[0028] In this invention, the SNP sites covered include SNP sites not yet discovered in the art, as can be seen in the accompanying drawings. Figure 18 .
[0029] In some embodiments of the present invention, the correspondence between the SNP sites and Epimedium species is shown in Tables 4 to 6 of the specification.
[0030] In this invention, the above method can amplify the matK and ITS sequences, and through sequencing results, it can not only guide the selection of parents and identification of offspring in the breeding process of high-yield Epimedium varieties, but also effectively realize the classification of unknown species, providing favorable theoretical and technical support for the germplasm development of Epimedium plants.
[0031] Of course, those skilled in the art should understand that the above-mentioned positions include the corresponding positions when referring to the genome information of other Epimedium species, and the reference Epimedium genome information cannot be used to limit the specific location of SNP sites.
[0032] A third aspect of the present invention provides the use of primers for targeted amplification of the matK sequence and / or ITS sequence of Epimedium plants in the preparation of Epimedium identification products.
[0033] In some embodiments of the present invention, the primers target and amplify the matK sequence or ITS sequence of Epimedium plants.
[0034] In some embodiments of the present invention, the product includes a detection reagent and a detection chip.
[0035] In some embodiments of the present invention, the product form of the detection reagent includes, but is not limited to, a standalone reagent or a kit containing the reagent.
[0036] In some embodiments of the present invention, the primers are as shown in SEQ ID NO: 1 to 4.
[0037] In some embodiments of the present invention, the primers shown in SEQ ID NO: 1 to 2 are used to amplify the matK sequence.
[0038] In some embodiments of the present invention, the primers shown in SEQ ID NO: 3 to 4 are used to amplify the ITS sequence.
[0039] Of course, it should be understood that those skilled in the art can design and screen other primers according to actual usage needs to amplify the matK sequence or ITS sequence containing the above-mentioned SNP in this invention, so as to achieve the same effect as the technical solution of this invention.
[0040] In some embodiments of the present invention, the lengths of the amplified matK and ITS sequences obtained will vary depending on the genomic information of different Epimedium species. For example, the matK sequence length of Epimedium populations ranges from a minimum of 723 bp (e.g., E024) to a maximum of 941 bp (e.g., E004, E006), with a GC content of 32.4%–33.2%. The ITS sequence length ranges from a minimum of 479 bp (e.g., E044) to a maximum of 562 bp (e.g., E035, E041), with a GC content of 52.1%–53.4%. However, all of these sequences include the SNP sites mentioned above, and therefore should be understood to be within the scope of protection of the present invention.
[0041] A fourth aspect of the present invention provides the application of the method described in the first or second aspect of the present invention in the breeding of Epimedium varieties.
[0042] In some embodiments of the present invention, the method described in the first and second aspects of the present invention is used in conjunction with the breeding of Epimedium varieties.
[0043] In some embodiments of the present invention, the combination is as follows: based on the method described in the first aspect of the present invention, the method described in the second aspect of the present invention is used for species identification.
[0044] The beneficial effects of this invention are:
[0045] 1. This invention is the first to discover the light-foraging characteristics of Epimedium species, and based on these characteristics, it finds biomass indicators that can be effectively correlated. Based on these indicators, it constructs a grading standard for Epimedium species, and successfully verifies the efficiency and feasibility of quality resource breeding based on this standard.
[0046] 2. This invention designs highly efficient PCR primers to achieve efficient amplification of two DNA fragments commonly used for species identification in the chloroplast genome and nuclear genome. Through sequencing results, it guides the identification of parents and offspring in the breeding process of high-yielding Epimedium varieties. Combined with light-foraging characteristic indicators, it can be used efficiently for Epimedium variety breeding. Attached Figure Description
[0047] Figure 1 A schematic diagram of the measurement of the core leaf characteristics of Epimedium.
[0048] Figure 2 To assess the stability of field measurement methods for Epimedium species, where A represents petiole length (PL), B represents petiole diameter (PW), C represents leaf length (LL), and D represents leaf width (LW). RSD represents the coefficient of variation.
[0049] Figure 3 To assess the stability of the leaf area measurement method for Epimedium species, where A represents the area of the first leaflet, B represents the area of the second leaflet, C represents the area of the third leaflet, and D represents the total leaf area.
[0050] Figure 4 Phenotypic comparison of Epimedium plants at different growth stages, where A is the petiole length (FL), B is the petiole width (FW), C is the petiole length (PL), D is the petiole diameter (PW), E is the leaf length (LL), F is the leaf width (LW), and G is the leaf area (Area); *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0051] Figure 5Phenotypic comparisons of Epimedium plants under light conditions, where A is the petiole length (FL), B is the petiole width (FW), C is the petiole length (PL), D is the petiole diameter (PW), E is the leaf length (LL), F is the leaf width (LW), and G is the leaf area (Area); *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0052] Figure 6 This is a principal component analysis diagram of a population of Epimedium based on phenotypic trait data.
[0053] Figure 7 Correlation analysis of 10 phenotypic traits in 45 populations of the genus Epimedium (A) and correlation analysis of 11 phenotypic traits in 7 populations of the genus Epimedium (B).
[0054] Figure 8 Epimedium was classified and graded based on the width of its leaflets and petioles, a key characteristic of light-seeking.
[0055] Figure 9 Epimedium was classified and graded based on the core characteristic of photophilic foraging: the length of the petiole of the compound leaf.
[0056] Figure 10 Epimedium was classified and graded based on the width of its compound leaf petiole, a key characteristic of light-seeding.
[0057] Figure 11 Epimedium was classified and graded based on the core characteristic of light-seeding: the length of the leaflet petiole.
[0058] Figure 12 Epimedium was classified and graded based on leaf length, a key characteristic of light-seeding.
[0059] Figure 13 Epimedium was classified and graded based on leaf width, a key characteristic of light-seeding.
[0060] Figure 14 The relationship between leaf area and petiole width in different populations of Epimedium pubescens.
[0061] Figure 15 The relationship between leaf area and petiole width in different populations of Epimedium coarse hairs.
[0062] Figure 16 The relationship between leaf area and petiole width in different populations of Epimedium qianlingensis.
[0063] Figure 17 This is a photograph of the variety Epimedium koreanum var. polyphylla CS Cheng.
[0064] Figure 18 The relationship between leaf area and petiole width of the variety Epimedium praecox var. koreanum.
[0065] Figure 19 This is a comparison diagram of SNPs in the matK and ITS sequences of Epimedium plants with SNPs disclosed in the prior art, where A is a matK sequence SNP and B is an ITS sequence SNP.
[0066] Figure 20 Phylogenetic tree of Epimedium species matK NJ.
[0067] Figure 21 Phylogenetic tree of ITS NJ for Epimedium species. Detailed Implementation
[0068] The present invention will be further described in detail below through specific embodiments. Unless otherwise specified, the raw materials, reagents, or apparatus used in the embodiments and comparative examples are all available from conventional commercial sources or can be obtained by existing technical methods. Unless otherwise specified, the test or experimental methods are conventional methods in the art.
[0069] Experimental materials and their sources
[0070] In this embodiment of the invention, all Epimedium samples used were collected from the Epimedium Germplasm Resource Garden of Lushan Botanical Garden, Chinese Academy of Sciences. The varieties in the resource garden were collected from all over the country, and the specific information is shown in Table 1.
[0071] Table 1. Sample information of Epimedium
[0072]
[0073]
[0074] Photoforaging characteristics of Epimedium
[0075] (1) Method for determining the biomass of Epimedium:
[0076] In this embodiment, 3-6 healthy plants of each variety of Epimedium were randomly selected as test samples, exhibiting normal growth, no obvious defects, and free from pests and diseases. The morphological characteristics of each sample were recorded. The observation methods for the main indicator characteristics are as follows, and the corresponding physical demonstration images are shown below. Figure 1 As shown:
[0077] Compound leaf petiole length (FL): Measured with a ruler from the ground to the first branch, recorded as compound leaf petiole length (FL), in centimeters (cm). Compound leaf petiole width (FW): Measured with calipers at the thickest part of the compound leaf petiole, recorded as compound leaf petiole width (FW), in millimeters (mm). Petiole length (PL): Measured with a ruler from the petiole of the compound leaf or the second branch to the base of the leaf blade, recorded as leaflet petiole length (PL), in centimeters (cm). Leaflet petiole width (PW): Measured with calipers at the thickest part of the petiole, recorded as leaflet petiole width (PW), in millimeters (mm). Leaf blade length (LL): Measured with a ruler at the longest segment of the leaf blade parallel to the midrib, recorded as leaf blade length (LL), in centimeters (cm). Leaf blade width (LW): Measured with a ruler at the widest part of the leaf blade, recorded as leaf blade width (LW), in centimeters (cm). Leaf area (Area): Take a picture of the leaf and measure the area using ImageJ software. Record the area as leaf area (Area), with the unit being square centimeters (cm). 2 Dry weight of plants (DW): Take the above-ground parts, put them in an envelope, put them in an oven, blanch them at 110℃ for 15 minutes, dry them at a constant temperature of 80℃, weigh them once after 12 hours, and then weigh them every 6 hours until the weight of the leaves remains basically constant. This weight is the dry weight of the plants (DW).
[0078] When there are multiple petioles and leaves on the same plant, measurements and records are made separately, and multiple sets of data are then collected and analyzed together.
[0079] Data analysis was performed on the Epimedium biomass data obtained above. Since different units of measurement can affect the analysis, the original data matrix was standardized (STD) before each analysis to obtain standardized data. The standardized data were then used for biomass trait statistical analysis (t-test, one-way ANOVA) using GraphPad Prism 9 software, principal component analysis of biomass traits using SIMCA 14.1 software, and cluster analysis and correlation analysis using R 4.1.3 software.
[0080] (2) Feasibility verification of the determination method:
[0081] To ensure the validity, accuracy, stability, and repeatability of the data obtained by the above observation methods, the inventors conducted field measurement verification and area measurement verification to verify the stability of the above observation methods.
[0082] The Epimedium samples selected for field measurement and verification were three populations: E013 GZKL-LC, E020 SCDJY-TARM, and E044SXFP-LCP. Characteristic indicators (PL, PW, LL, LW) were collected according to the above method, and their standard deviation, mean, and coefficient of variation were calculated. Then, analysis of variance was performed on the coefficients of variation of each trait of the three populations.
[0083] The results are shown in Table 2 and Figure 2 As shown.
[0084] It was found that the coefficients of variation (PL, PW, LL, and LW) of the three Epimedium populations measured in the field did not differ. Except for PW, whose coefficient of variation was greater than 2% and less than 2.5%, the coefficients of variation of the other five biomass values were all less than 2%, indicating that the measurement method has good accuracy, stability, and repeatability.
[0085] Table 2. Stability of Field Measurement Methods for Epimedium Plants
[0086]
[0087] For area measurement validation, three leaves from the same petiole (in Epimedium species, a petiole typically has three leaves) were selected. The leaves on either side of the petiole were named the first and third leaflets, respectively, and the leaf in the middle was named the second leaflet. The total leaf area was calculated by adding the areas of the three leaves together. The selected Epimedium samples were from three populations: E010 SCPC-YS, E020 SCDJY-TARM, and E013 GZKL-LC. Characteristic indicators (leaf area) were collected using the method described above, the coefficient of variation was calculated, and analysis of variance was performed.
[0088] The results are as follows Figure 3 As shown.
[0089] It can be observed that there are no differences in the coefficients of variation of the first, second, and third leaflets and the total leaf area among the three populations, and the coefficients of variation are all less than 3%. This indicates that the measurement method has good accuracy, stability, and repeatability.
[0090] After verifying the effectiveness of the above method, the biomass of Epimedium leaves at different growth stages (young and mature stages) was measured using this method, and the results are as follows: Figure 4 As shown.
[0091] It was observed that, except for the petiole length (FL) of compound leaves, which showed no significant difference between the young and mature stages of Epimedium growth, other leaf biomass parameters (FW, PL, PW, LL, LW, and Area) varied across different growth stages, with the mature stage showing better results than the young stage. This result indicates that the petiole length of compound leaves in the young stage of Epimedium has already reached the mature stage length. Therefore, it is inferred that in order to obtain light nourishment, Epimedium plants preferentially elongate their above-ground stems and leaves in the early stages of growth to overcome the shading effect of surrounding plants; this characteristic is termed the plant's "photograssory foraging" ability. Subsequently, other parameters, such as the width of the compound leaf petiole, the length and width of the leaflet petioles, the length and width of the leaf blades, and the leaf area, only then show significant increases with the accumulation of growth time.
[0092] Two conditions were further established: unobstructed light and shaded conditions with tree cover, to determine that photoforaging characteristics are not influenced by the growth environment but are inherent characteristics of the germplasm. The selected Epimedium samples were E010 SCPC-YS and E055JXLS-LL. Biomass parameters were measured according to the above steps, and the results are as follows: Figure 5 As shown.
[0093] Comparative analysis revealed differences in the petiole length of compound leaves in the E055 JXLS-LL population and the leaf width (LW) in the E010 SCPC-YS population, with the latter showing better results under shaded conditions than under light conditions. However, no differences were found in other biomass parameters, indicating that light and shade do not have a substantial impact on the growth of Epimedium species. Light-seeking characteristics are an inherent feature of Epimedium and can be used as a stable detection indicator.
[0094] (3) Correlation analysis between Epimedium biomass measurement indicators and population:
[0095] For populations of the genus Epimedium, principal component analysis (PCA) was performed using the above-mentioned characteristic indicators (compound leaf petiole length FL, compound leaf petiole width FW, leaflet petiole length PL, leaflet petiole diameter PW, leaf blade length LL, leaf blade width LW, leaf blade area Area, ratio of compound leaf petiole to second node length FL / PL, ratio of compound leaf petiole to second node width FW / PW, and ratio of compound leaf petiole to second node volume Vf / Vp).
[0096] The results are as follows Figure 6 As shown.
[0097] It can be seen that most of the 45 Epimedium populations are clustered together, with only a few populations scattered.
[0098] Further correlation analysis was conducted, and the population correlation analysis diagram based on the biomass measurement index of Epimedium is shown in the figure below. Figure 7 As shown. Among them, Figure 7In the table, A represents the correlation analysis results of 10 phenotypic parameters from 45 populations of the genus *Epimedium*. It was found that the following parameters were highly positively correlated with leaflet petiole diameter (PW) (0.92), leaf width (LW) (0.84), and leaf length (LL) (0.81); while those strongly positively correlated were compound leaf petiole width (FW) (0.71) and compound leaf petiole length (FL) (0.7). Furthermore, leaflet petiole diameter (PW) is the most important linking parameter, showing strong positive correlations with compound leaf petiole length (FL), compound leaf petiole width (FW), leaf length (LL), leaf width (LW), and leaf area (Area). This indicates that it generally has a positive correlation with the main phenotypic parameters. Therefore, it is inferred that leaflet petiole diameter (PW) has a significant influence on the *Epimedium* phenotype and is an important parameter for judging high-quality *Epimedium* germplasm resources. Figure 7 B in the table represents the correlation analysis results of 11 phenotypic parameters (with one additional parameter: plant dry weight DW) from 7 populations of the genus Epimedium. The results showed that the following parameters were highly positively correlated with plant dry weight DW: petiole diameter PW (0.93), leaf area (Area) (0.89), compound leaf petiole width FW (0.87), and compound leaf petiole length FL (0.83). The following parameter was strongly positively correlated: leaf length LL (0.76). The following parameters were also highly positively correlated with leaf area: plant dry weight DW (0.89) and compound leaf petiole length FL (0.81). The following parameters were strongly positively correlated: compound leaf petiole width FW (0.78), leaf width LW (0.77), petiole diameter PW (0.75), and leaf length LL (0.73). Therefore, it can be found that if plant dry weight is used as the standard for measuring biomass, or if leaf area is used as the standard for measuring biomass when dry weight is not available, correlation analysis shows that the petiole diameter PW is highly positively correlated with plant dry weight or leaf area, at 0.93 and 0.92, respectively. Furthermore, it was found that the petiole length FL (0.81, 0.7), petiole width FW (0.87, 0.71), and petiole diameter PW (0.93, 0.92) of compound leaves also have a significant impact on plant dry weight and leaf area, all showing a high positive correlation. Since there is a mathematical relationship between leaf area (Area) and leaf length and width, the correlation between leaf length (LL) and leaf width (LW) and the two can be disregarded.
[0099] In summary, the above methods (whether based on hierarchical clustering or K-means clustering) can distinguish the populations of the Epimedium genus. Furthermore, based on the actual situation, only the three biomass traits FL, FW, and PW can be selected for population clustering analysis, and the results can also group the populations.
[0100] (4) Grading of germplasm resources based on biomass measurement indicators of Epimedium:
[0101] Based on the population clustering analysis of biomass traits in the above embodiments, the inventors found that when the petiole width (PW) of the leaflets is ≥0.7cm, the leaf area (Area) is generally ≥20cm². 2 The germplasm resources of this Epimedium can be considered as a high-quality germplasm population (Category A population); when 0.4cm ≤ PW < 0.7cm, its leaf area is generally greater than 10cm². 2 But less than 20cm 2 The germplasm resources of this Epimedium can be considered as a good germplasm population (Category B population); when PW < 0.4 cm, its leaf area (Area) is generally < 10 cm². 2 At that time, the germplasm resources of Epimedium were considered as ordinary germplasm populations (Category C populations). The specific classification is shown in Table 3.
[0102] Table 3. Criteria for Germplasm Population Classification of Epimedium
[0103] germplasm level Compound leaf petiole length FL / cm Leaflet petiole width PW / cm <![CDATA[Leaf area Area / cm 2 > high quality A ≥14 ≥0.7 ≥20 good B 10~14 0.4~0.7 10~20 ordinary C <10 <0.4 <10
[0104] To verify the feasibility and effectiveness of this classification, the inventors used the method to conduct confirmatory tests on confirmed Epimedium species.
[0105] The results are as follows Figures 8-13 As shown, it can be observed that Epimedium is classified and graded based on the core characteristic of light-seeking: leaflet petiole width. The leaf area, compound leaf petiole length, compound leaf petiole width, leaflet petiole length, leaf length, and leaf width of Epimedium are positively correlated with the leaflet petiole width, and this is consistent with the situation of confirmed Epimedium species.
[0106] In addition, the inventors also conducted confirmatory tests using Epimedium brevicornu, Epimedium coarse-haired, Epimedium kanran, and Epimedium koreanum as samples, and the results were as follows: Figures 14-18 As shown. Among them, Epimedium koreanum var. polyphylla CS Cheng is a variant of Epimedium koreanum, which has far more leaves than the normal 9 leaves, up to 27 leaves, and has been verified to belong to the Class A germplasm defined in this invention.
[0107] The results showed that the above method can effectively identify the germplasm grade of Epimedium with no error rate, indicating that the method has extremely high feasibility.
[0108] Methods for analyzing the genetic background of Epimedium populations based on matK and ITS sequences
[0109] In this embodiment, 3 to 9 leaves were randomly selected from each variety of Epimedium as experimental materials. After natural air drying, nucleic acid extraction, PCR amplification, electrophoresis identification, PCR product purification, and sequencing were performed (by BGI Genomics Co., Ltd.).
[0110] The target amplification objects are the matK gene and the ITS sequence.
[0111] The PCR amplification primers used were:
[0112] matK gene primers:
[0113] Upstream primer: 5'-TATGACAATAAATCCAGTTC-3' (SEQ ID NO: 1);
[0114] Downstream primer: 5'-ATGCCCCGATACGTTACAAA-3' (SEQ ID NO: 2).
[0115] ITS sequence primers:
[0116] Upstream primer: 5'-AAATAGACGACGAAACAACAC-3' (SEQ ID NO: 3);
[0117] Downstream primer: 5'-AGAACGACCAGCGAACTT-3' (SEQ ID NO: 4).
[0118] Sequencing revealed that the matK sequence lengths of the 56 Epimedium populations ranged from a minimum of 723 bp (e.g., E024) to a maximum of 941 bp (e.g., E004, E006), with GC content ranging from 32.4% to 33.2%. The ITS sequence lengths ranged from a minimum of 479 bp (e.g., E044) to a maximum of 562 bp (e.g., E035, E041), with GC content ranging from 52.1% to 53.4%. Furthermore, numerous SNP sites were identified based on the matK and ITS sequences of the 56 Epimedium populations. ClustalW alignment was performed on the 56 sequences. Due to the varying sequence lengths, the leading and trailing deficient regions were removed. Using the longest sequence, E004 (941 bp), as a reference, the SNP sites of the matK gene sequences from the 56 populations were counted, and the results are shown in Tables 4 and 5. The same method was used to count the SNP sites of the ITS sequences from the 56 populations, and the results are shown in Table 6.
[0119] Using E004 as a reference (its matK sequence is shown in SEQ ID NO: 5, and its ITS sequence is shown in SEQ ID NO: 6), blank indicates that the polymorphism at this position is the same as the reference, and del indicates that it is missing.
[0120] 5'-ATTACTCGAATGTATCAACAGAAGCATTTGATTCTCTTTGATAATGATTTTAACCA AAATACATTTCGTGATCAGAATCAGAAGAAGCATTTTTATTCTAAAATGATATCAGAGGGTTTTTCACTCATTGTGGAAATTCCATTCCCTCTGCGATTAGTACCTTCCCTAGAAGCGAAAGAAATAGCAAAATCTCATAATTTACGATCAATTCATTCAACATTTCCCTTTTTAGAGGATAAATTATCACATTTAAATAATGCCTTAGATATACTAATACCCTACCCCATCCATTTGGAACTCTTGATTCAAACCCTTCGCTATTGGATACAGGATACCCCCGCTTTGCATTTATTACGATTCTTTCTCTACGAGTCTCAGAATTCGAATAATCTGATTACTCAAAAAAAAATCGATATTTCGCATTTTTCAAATCAGAATCAAAGATTTTTCTTGTTCCTATATAATATTCATATATATGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCTGTTCATTTACGATCAAGATCGTATAGAGC CCTTCTTGAGCGAACACATTTTTATCGAAAAATAGACAAGTTTTTCTTCATTTTTCATAAAAATTTTCAGACCACCTTATGGTTGTTCAAGGATCCTTTCATGAATTATGTCAGATATCAAGGAAAAGCCATTCTGGCTTCAAAAGGAACACCTCTTCTGATAAAAAAATGGAAGTATTACCTTGTCAATTTTTGTCAAGGTTATTTTGACTTGTGGCCTCAACCAGATAGAATTCAAATAAACCAATTCTCCAAGCACTCCCTCGATTTTCTGGGCCATCTTTCAAGTTTACGGCTAAAGCCTTGTGTGGTAAGGAGTCAAATGTTAGAAAATTTATTTATTATAGATGTTTCTATTAATAAGTTTGATACTATAGTCCCCACAATTCCTTGATA-3'(SEQ ID NO:5)。
[0121] 5'-TTGTGAAAAACACTTATGGGAGGGACGAAGGGGTGCTAACCTTGAATCCTTCCTA CTGGGTCACTTGGGACGATTGTGTCGTGAAAGCGACAACGACGCCCCTCGTTGATTCAAATAACAACTCGGCGCGGTCTGCGCCAAGGAAAATCTTAACGGATAGAGCACGTCTTCATGACGATGTTGTAATTCCGATCTTATAACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGA ACGCAAGTTGCGCCCAAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACGCACAGCGTCGCTCCCACCATGATGCCTTTGTTCTGTTATCAGGCAACTGCAACGTGGCTTGGGAAGCGGA TATTGGCCCCCCGTACCTTTGTAGGCGCGGCCGGCCTAAAATTCGGCCCTCGGCGACGAGCGTCACGATCAGTGGTGGTTGAATAACCCCTTTGTCATAGACCGGTATCGTGTTGTTC-3'(SEQ ID NO: 6).
[0122] The results showed that the matK gene sequences of 56 populations contained 54 polymorphic sites. Among them, 11 populations (E002, E003, E010, E011, E012, E014, E018, E025, E027, E028, and E039) had consecutive A bases at six consecutive base sites from 612 to 617. Population E017 showed significant differences from other populations at 106 base sites. Sequencing results of the ITS sequences of the 56 populations revealed that 25 sequences contained heterozygous sites, while the remaining 31 sequences did not. Among these 25 sequences, the number of heterozygous sites ranged from a minimum of one to a maximum of four. Except for population E054, which had three heterozygous bases at the 98th base site, the rest were all two heterozygous bases.
[0123] Comparing the SNPs of the matK and ITS sequences of Epimedium plants disclosed in existing technologies, the results are as follows: Figure 19 As shown, the SNP coverage in this embodiment includes SNP sites that have not yet been discovered in the art.
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132] (2) Construction of the phylogenetic tree of the matK gene sequence:
[0133] Based on the matK gene sequences of 56 populations obtained from the above embodiments, 188 matK gene sequences of the genus Epimedium downloaded from the NCBI public database, and 2 outgroup sequences (Vancouveria hexandra and Vancouveria planipetala), a phylogenetic tree of the genus Epimedium matK NJ was constructed. The results are shown in […]. Figure 20 .
[0134] It can be found that in this phylogenetic tree, there are 188 matK sequences of Epimedium species downloaded from the NCBI database, covering 60 species of this genus. Among them, 33 species have 3 or fewer sequences (12 species have only 1 sequence, 12 species have 2 sequences, and 9 species have 3 sequences), and the species with the most sequences has 6 sequences. The phylogenetic tree shows that sequences downloaded from the NCBI database are not entirely clustered by species. For example, *E. mikinorii* and *E. flavum* cluster with *E. pseudowushanense*. Similar clusters occur with *E. alpinum*, *E. diphyllum*, and *E. trifoliolatobinatum*. It is common for the distribution of the same species on the phylogenetic tree to not be monophyletic. For instance, *E. pseudowushanense* has six sequences, three of which cluster together, the remaining two are separate, and one is more closely related to *E. coactum*. *E. mikinorii* has two clustered sequences and two separate sequences. *E. flavum* clusters in pairs. *E. campanulatum* has two separate sequences, which are quite far apart. *E. coactum* has three separate sequences, which are quite far apart. *E. pubescens*... Although 7 sequences are relatively close, 5 cluster together and the remaining 2 are dispersed; 3 *E. sutchuenense* sequences cluster together, and the other is far apart; 4 *E. franchetii* sequences are dispersed, with 3 clustered together; 2 *E. rhizomatosum* sequences cluster together, and the other 3 are dispersed, with the 4 groups being far apart; 2 *E. acuminatum* sequences cluster together, with one close to the other and the other far apart; 2 *E. chlorandrum* sequences cluster together, and the other is far apart; 2 *E. parvifolum* sequences are dispersed; 4 *E. leptorrhizum* sequences are dispersed; 3 *E. hunanense* sequences are far apart; 5 *E. baojingense* sequences are dispersed; 3 *E. dewuense* sequences are far apart; 4 *E. franchetii* sequences are dispersed; 2 *E. tianmenshanensis* sequences are dispersed; 6 *E. brevicornu* sequences cluster together, and 1 is far apart; *E. ecalcaratum* Two are together, one is far apart; *E. platypetalum*: Two are together, three are scattered and far apart; *E. elatum*: Two are far apart; *E. stellulatum*: Two are far apart; *E. pudingense*: Two are together, the other is far apart; *E. jinchengshanense*: Two are together, one is far apart; *E. lishihchenii*: Four are scattered; E.*Fargesii* has 2 clustered sequences and 2 dispersed sequences, similar to *E. shuichengense*; *E. shuichengense* has 3 dispersed sequences; *E. ilicifolium* has 2 clustered sequences and the other is far apart; *E. zhushanense* has 2 clustered sequences far apart; *E. epsteinii* has 2 far apart sequences; *E. davidii* has 6 dispersed sequences; *E. doolichostemon* has 4 dispersed sequences; *E. rhizomatosum* has 2 clustered sequences and 2 dispersed sequences; *E. qingchengshanense* has 4 dispersed sequences; *E. simplicifolium* has 2 clustered sequences and 1 dispersed sequence; *E. truncatum* has 3 clustered sequences and 1 dispersed sequence; *E. myrianthum* has 3 dispersed sequences; *E. sagittatum* has 2 clustered sequences and 4 dispersed sequences; *E. xichangense* has 2 sequences containing *E. sagittatum*; *E. muhuangense* has 2 dispersed sequences. Statistically, a total of 41 species exhibit a dispersed distribution of matK sequences on the phylogenetic tree. This indicates that the species boundaries of the genus Epimedium are very blurred.
[0135] Furthermore, all matK sequences of seven species clustered completely on the phylogenetic tree. For example: E. wushanense clustered 4 sequences; E. perralderianum clustered 2 sequences; E. pinnatum clustered 4 sequences; E. alpinum clustered 2 sequences; E. koreanum clustered 6 sequences; E. latisepalum clustered 2 sequences; and E. borealiguizhouense clustered 4 sequences. Therefore, it can be shown that a phylogenetic tree constructed solely based on matK sequences can only show clustering at a few positions. Samples in these clusters may originate from the same species. This phylogenetic position can only infer that a sample may be closely related to a particular species, and cannot achieve effective differentiation.
[0136] (3) Construction of the phylogenetic tree of ITS gene sequences:
[0137] Based on the ITS sequences of 56 populations obtained from the sequencing examples above, 215 ITS sequences of the genus Epimedium downloaded from the NCBI public database, and 2 outgroup sequences (Vancouveria hexandra and Vancouveria planipetala), a phylogenetic tree of Epimedium ITS NJ was constructed. The results are shown in […]. Figure 21 .
[0138] It can be observed that the phylogenetic tree contains 215 ITS sequences of Epimedium species downloaded from the NCBI database, encompassing 58 species within the genus. Of these, 37 species have 3 or fewer sequences (8 species have only 1 sequence, 16 species have 2 sequences, and 13 species have 3 sequences), with the most having 12 sequences. Similar to the Epimedium NJ phylogenetic tree constructed based on matK sequences, the species sequences downloaded from NCBI do not cluster into a single monophyletic group within the phylogenetic tree.For example, *E. acuminatum* has 3 colonies clustered together, while the other 9 are scattered; *E. qingchengshanense* has 2 scattered colonies; *E. mikinorii* has 4 scattered colonies; *E. epsteinii* has 5 scattered colonies; *E. brevicornu* has 2 colonies clustered together, while 8 are scattered; *E. elongatum* has 3 scattered colonies; *E. pubescens* has 3 clustered colonies, 2 clustered colonies, and the remaining 3 scattered colonies; *E. shuichengense* has 3 scattered colonies; *E. simplicifolium* has 3 scattered colonies; *E. baojingense* has 3 clustered colonies and 3 scattered colonies; *E. coactum* has 4 scattered colonies; *E. leptorrhizum* has 6 scattered colonies; *E. pseudowushanense* has 3 scattered colonies; *E. stellulatum* has 3 scattered colonies; *E. franchetii* has 3 clustered colonies, 2 clustered colonies, and the remaining 5 scattered colonies; *E. myrianthum* has 6 scattered colonies; *E. wushanense* has 6 scattered colonies; *E. platypetalum* has 3 scattered colonies; *E. sutchuenense* 3 clustered, 4 scattered; E. lishihchenii 2 scattered; E. davidii 3 clustered, 2 scattered; E. fargesii 2 scattered; E. sagittatum 2 groups of 3 clustered, the remaining 4 scattered; E. brachyrrhizum 3 scattered; E. hunanense 2 scattered; E. ilicifolium 2 scattered; E. latisepalum 2 scattered; E. truncatum 2 scattered; E. jinchengshanense 2 scattered; E. sempervirens 2 scattered; E. ogisui 2 clustered, 1 scattered; E. zhushanense 2 clustered, 1 scattered; E. dewuense 2 clustered, 1 close; E. pinnatum 2 clustered, 1 scattered; E. doolichostemon 2 clustered, 2 scattered, located close together; E. alpinum Three ITS sequences clustered together, and one was dispersed; *E. diphyllum* had four sequences, with two clustered together; *E. chlorandrum* had two clustered together and three dispersed; *E. pauciflorum* had five dispersed sequences; *E. rhizomatosum* had three clustered together and three dispersed, with relatively close proximity; *E. koreanum* had six clustered together and one dispersed. Statistically, a total of 41 species showed a dispersed distribution of ITS sequences on the phylogenetic tree.
[0139] In addition, all ITS sequences of 9 species clustered on the phylogenetic tree. These are as follows: E. borealiguizhouense (2 clusters); E. ecalcaratum (2 clusters); E. fangii (2 clusters); E. flavum (2 clusters); E. reticulatum (2 clusters); E. campanulatum (2 clusters); E. perralderianum (3 clusters); E. pubigerum (3 clusters); and E. elatum (4 clusters).
[0140] Using only ITS gene sequence-based phylogenetic trees has the same problems as using only matK sequence-based phylogenetic trees.
[0141] (3) Identification results combining the phylogenetic trees of Epimedium matK and ITS NJ:
[0142] By comparing two phylogenetic trees, the inventors discovered that combining them resulted in highly consistent clustering of some groups. For example, E050-E052 clustered with *Epimedium koreanum* in phylogenetic trees constructed based on different sequences; E002 and E054 clustered with *Epimedium qianbeiense* in both phylogenetic trees; and E017 clustered with *Epimedium qianlingense*. These consistent clustering patterns across different phylogenetic trees demonstrate that combining the two methods effectively overcomes the incomplete clustering consistency issues inherent in using either method alone.
[0143] To verify the effectiveness of the above method, the inventors conducted blind selection verification from different populations. The results showed that the species ultimately identified in the selected populations were all species of the genus *Epimedium*: 3 *Epimedium baoxingense*, 2 *Epimedium baojingense*, 1 *Epimedium shizhenense*, 3 *Epimedium koreanum*, 1 *Epimedium chuanxiense*, 3 *Epimedium coarse-hairedense*, 1 *Epimedium sagittatum*, 2 *Epimedium jinchengshanense*, 1 *Epimedium lushanense*, 2 *Epimedium lvyaoense*, 1 *Epimedium mucosae*, 2 *Epimedium pseudowushanense*, and *Epimedium skewers*. One *Epimedium*, six *Epimedium qianlingense*, one *Epimedium qianggenense*, nine *Epimedium yurunense*, one *Epimedium tianpingshanense*, one *Epimedium tianquanense*, one *Epimedium wushanense*, one *Epimedium agnosticum*, one *Epimedium xiaoyeense*, two *Epimedium*, three *Epimedium yurunense*, one *Epimedium longistylum*, one *Epimedium zhenpingense*, three *Epimedium zhizhiense*, two *Epimedium bell-shaped*, and two *Epimedium qianbeiense*. Among these, the most common species is *Epimedium yurunense*, followed by *Epimedium qianlingense*, with an accuracy rate of 100%. Furthermore, among the species identified through phylogenetic trees, 18 populations showed completely consistent species identification results with introduction records compared to species identified using conventional methods when collected from their native habitats. These populations are: E002 GUTCM4, E003 GUTCM5, E015 HNZJJ-YJX, E019 SCBX-FTZ, E020 SCDJY-TARM, E021 SCDJY-EWM, E023 HNYS-LX, E031 GZJH-LC, E033 SCBX-LD, E034 SCLB-HW, E035 SCYJ-SP, E037 SCDX-LG, E043 SXPL-GF, E047 HNLC-CDG, E050LNFC-DGL, E051 JLLJ-XLJ, E052 JLDH-JY, and E055-JXLS-LL. Species identification results from 39 populations showed inaccuracies in the initial introduction information (verified by comparing sequencing and morphological results). Therefore, it can be concluded that combining the matK and ITS NJ phylogenetic trees of the *Epimedium* genus provides excellent accuracy for the identification of *Epimedium* species. A method for classifying and breeding *Epimedium* varieties based on a combination of light-foraging characteristics and genetic background testing is also presented.
[0144] Based on the results of the above embodiments, the detection method based on light-foraging characteristics can effectively group Epimedium populations, while the detection method based on genetic background can achieve specific identification of Epimedium species. Therefore, combining the two can efficiently achieve the breeding of high-yielding Epimedium varieties. This effectively solves the problem of classification difficulties in Epimedium species caused by its unique geographical distribution, complex morphological variations, and fertile interspecific hybridization, which are common in traditional methods. It also avoids inaccuracies or misjudgments that occur when systematically studying the evolution of this genus using morphological, geographical distribution, cellular, chemical, palynological, and molecular systematic methods. It provides an important reference for judging high-quality Epimedium germplasm resources and avoids the problem of inconsistent quality of medicinal Epimedium on the market that remains unresolved.
[0145] Specifically, in this embodiment, the specific steps are as follows:
[0146] The biomass information of the sample to be tested is determined or calculated according to the detection method of light foraging characteristics in the above embodiments. Based on the biomass information, a high-quality germplasm population (Category A population) is screened out. Then, the genetic background-based detection method (based on SNP determination in matK and ITS sequences) in the above embodiments is used for identification to determine the specific species relationship, thereby judging its hybridization with the male parent when used as the female parent, so as to obtain Epimedium germplasm resources that can be used for subsequent breeding.
[0147] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A method for screening Epimedium germplasm, comprising the following steps: Biomass information of the sample to be tested is obtained by measurement or calculation, and high-quality germplasm populations are screened based on the biomass information. The biomass information includes the length of the compound leaf petiole, the width of the leaflet petiole, and the leaf area.
2. The method for screening Epimedium germplasm according to claim 1, characterized in that, The superior germplasm population has at least the following characteristics: Compound leaves with petiole length ≥10cm, leaflet petiole width ≥0.4cm, and leaf blade area ≥10cm². 2 .
3. The method for screening Epimedium germplasm according to claim 2, characterized in that, The superior germplasm population has at least the following characteristics: Compound leaves with petiole length ≥14cm, leaflet petiole width ≥0.7cm, and leaf area ≥20cm². 2 .
4. The method for screening Epimedium germplasm according to claim 1, characterized in that, The method further includes identifying the species and genus of the selected high-quality germplasm population to determine its hybridization ability; wherein the species and genus identification includes at least one of morphological classification, ecological classification and molecular biological classification.
5. The method for screening Epimedium germplasm according to claim 4, characterized in that, The species identification includes the following steps: Nucleic acid was extracted from the plant sample to be tested and isolated. matK Sequence and ITS sequence, and detection matK The SNP sites in the sequence and ITS sequence are used to determine the species relationship of the plant sample to be tested based on the correspondence between the SNP sites and plants of the genus Epimedium. Among them, the genomic information of the Epimedium E004 population was used as a reference, in matK In the sequence, polymorphisms were detected at bases 51, 53, 57, 66, 67, 68, 70, 89, 90, 96, 106, 151, 190, 197, 239, 284, 296, 331, 395, 412, 413, 421, 497, 581, 584, 612, 613, 614, 615, 616, 617, 648, 651, 652, 664, 766, 776, 787, 812, 830, 831, 845, 849, 855, 858, 869, 879, 889, 892, 894, 903, 907, 910, and 925. In the ITS sequence, the polymorphism and heterozygosity of bases at positions 59, 72, 90, 91, 98, 103, 118, 153, 159, 170, 174, 176, 182, 358, 384, 391, 393, 398, 400, 407, 412, 419, 437, 446, 447, 450, and 480 were examined. The Epimedium E004 population matK The sequence is shown in SEQ ID NO: 5; The ITS sequence of the Epimedium E004 population is shown in SEQ ID NO:
6.
6. The method for screening Epimedium germplasm according to claim 5, characterized in that, The correspondence between the SNP sites and Epimedium species is shown in Tables 4-6 of the specification.
7. The method for screening Epimedium germplasm according to claim 5, characterized in that, Targeted amplification of Epimedium species matK Primers for the sequence and ITS sequence are shown in SEQ ID NO: 1~4.
8. The application of the Epimedium germplasm screening method according to any one of claims 1 to 7 in the breeding of Epimedium varieties.