A livestock breeding method for improving grazing effect during the greening period of alpine grassland

Abstract

The present invention discloses a livestock breeding method for improving the effect of grazing rest during the greening period of alpine grasslands in the field of animal husbandry and breeding technology. The livestock breeding method comprises mixing a Chinese herbal medicine feed additive accounting for 2-4% of the mass of conventional feed with conventional feed and using the mixture for livestock and poultry breeding. In order to solve the problem that the feeding effect of grazing rest in a barn is poor, resulting in weak adaptability and susceptibility to disease in livestock after greening, the present invention proposes to significantly improve the expression levels of disease-resistant and stress-related genes MAP3K7 and NFKBIA by combining the Chinese herbal medicine feed additive with hay, thereby facilitating the release of immune factors, improving the resistance level and stress capacity of livestock, reducing the morbidity of barn breeding during the greening period, and improving the stress level and survival level of free-range breeding after the greening period. The livestock breeding method provided by the present invention does not use antibiotics and the breeding method is simple and feasible, and has promotion value.

Description

Technical Field

[0001] The invention belongs to the technical field of animal husbandry, and specifically refers to a livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland. Background Art

[0002] Alpine grassland refers to the general term for alpine meadows, alpine steppes, alpine desert steppes and other grasslands distributed on the Qinghai-Tibet Plateau. During this period, grazing, eating and trampling will interfere with the normal growth of plants, reduce the number of shoots and germination of Elymus nutans, and force the redistribution of nutrients in the plant body. The nutrients stored in the roots of the grass cannot meet the normal growth and development of the grass, resulting in the reduction of the coverage, grass plant height and grassland productivity of the alpine grassland after grazing in the green period. This phenomenon can be avoided by implementing grazing ban in the green period.

[0003] Green-up grazing refers to the practice of conducting grazing breaks during the period from spring plant germination to green-up and leaf-out in winter-spring grasslands according to the plant growth and development rhythm. However, most grazing breaks in sheds use hay as feed, which has poor feeding effects and reduced resistance. As a result, livestock released during the green-up period and after the green-up period have weak adaptability and are prone to disease, causing great economic losses to farmers. Directly replacing the breeding population will lead to a decline in economic benefits. In order to reduce the adverse effects of green-up grazing on livestock breeding, the present invention proposes a livestock breeding method that improves the effect of green-up grazing on alpine grasslands. Summary of the Invention

[0004] In view of the above situation, in order to overcome the defects of the prior art, the present invention provides a livestock breeding method for improving the grazing effect during the greening period of alpine grasslands. In order to solve the problem that the feeding effect of barn feeding and grazing is poor, resulting in weak adaptability and susceptibility to disease in livestock after greening, the present invention proposes to use Chinese herbal feed additives in combination with hay to achieve the purpose of improving the expression levels of disease-resistant and stress-related genes MAP3K7 and NFKBIA, thereby releasing a large number of immune factors, improving the resistance level and stress capacity of livestock, reducing the incidence rate of barn feeding during the greening period, and improving the stress level and survival level of free-range feeding after the greening period. The livestock breeding method provided by the present invention does not use antibiotics and the breeding method is simple and feasible, and has promotion value.

[0005] In order to achieve the above-mentioned purpose, the technical solution adopted by the present invention is as follows: The present invention proposes a livestock breeding method for improving the grazing effect of alpine grassland during the greening period, wherein the livestock breeding method is to mix a Chinese herbal feed additive accounting for 2-4% of the mass of conventional feed with conventional feed and use the mixed feed for livestock and poultry breeding, wherein the livestock and poultry include yaks and Tibetan sheep.

[0006] The Chinese herbal medicine feed additive comprises the following components in parts by weight: 3-4 parts of functional fermentation composition, 2-3 parts of radish seed polysaccharide, 1-2 parts of Buddleja flavonoids, 20-30 parts of carrier corn, and 30-50 parts of beta-cyclodextrin.

[0007] Preferably, the conventional feed comprises 45-60 parts of corn flour, 18-25 parts of wheat bran, 18-25 parts of meal, 2-10 parts of rice bran, 1-3 parts of molasses, and 0.1-0.15 parts of multivitamins.

[0008] Furthermore, the meal is one or more combinations of soybean meal, cottonseed meal, rapeseed meal and cottonseed meal, the complex vitamins include vitamin B, vitamin C and vitamin E, and the mass ratio of vitamin B, vitamin C and vitamin E is 1:1.1:0.7.

[0009] Preferably, the functional fermentation composition comprises 8-10 parts of fish scale powder, 4-6 parts of traditional Chinese medicine residues, and 2-3 parts of whey protein powder.

[0010] Preferably, the traditional Chinese medicine residue comprises the following components in parts by weight: 2-5 parts of Portulaca oleracea, 2-5 parts of Xanthium sibiricum, 2-3 parts of Kochia scoparia, 2-3 parts of Aristolochia, 1-2 parts of Campsis creeper, 1-3 parts of Andrographis paniculata, 1-2 parts of Chinaberry bark, and 1-2 parts of Schizonepeta tenuifolia.

[0011] Furthermore, the radish seed polysaccharide extraction method comprises the following steps: taking dried radish seed fruits, crushing and sieving, defatting with anhydrous ethanol under Soxhlet reflux, drying, extracting with water at 90°C, filtering, concentrating the extract under reduced pressure, precipitating with 95% ethanol, collecting the precipitate by centrifugation, washing the precipitate with acetone and anhydrous ethanol, respectively, and freeze-drying to obtain radish seed polysaccharide. Radish seeds have the effects of promoting digestion, relieving bloating, and reducing qi and resolving phlegm.

[0012] Furthermore, the preparation method of the flavonoids from the large-leaf Buddleja herb includes the following steps: drying the large-leaf Buddleja herb, crushing and sieving; adding a 50% ethanol aqueous solution to the large-leaf Buddleja herb powder, adjusting the pH to 8.0, and then heating the solution to 85°C for extraction to obtain an extract; cooling to room temperature and filtering to obtain a filtrate; adjusting the pH of the filtrate to 6.0 with citric acid; passing the filtrate through a macroporous adsorption resin chromatography column, first eluting with 3 column volumes of water; then eluting with 5 times the volume of 75% ethanol (v / v); collecting the eluate, and vacuum freeze-drying to obtain the flavonoids from the large-leaf Buddleja herb. The flavonoids from the large-leaf Buddleja herb can treat symptoms such as influenza, cough, asthma, rheumatic joint pain, and ascariasis.

[0013] Furthermore, the preparation method of the functional fermentation composition comprises the following steps:

[0014] (1) Add water to the crushed Chinese medicine residue, stir evenly, and sterilize at 120℃ for 30min;

[0015] (2) After the temperature of the Chinese medicine residue powder is lowered to 27-40°C, the fermentation bacteria are introduced and anaerobically fermented in a closed fermentation tank;

[0016] (3) Add sodium bicarbonate to the fermented product to adjust it to neutrality, stir it evenly, let it stand for 30 minutes, squeeze and filter it, and then spray-dry the fermentation liquid.

[0017] Preferably, the water content of the Chinese medicinal residue is 40%, and the fixed parameters in the fermentation conditions are: water content 60%, initial pH value 6.00, fermentation temperature 37° C., fermentation time 48 h, inoculation amount 1.0%, and initial pH value 5.75.

[0018] Preferably, the fermentation bacteria is obtained by mixing Lactobacillus acidophilus and Bacillus subtilis in a volume ratio of 1:2.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) In order to solve the problem that livestock have weak adaptability and are prone to disease after returning to green due to poor feeding effects during rest and grazing, the present invention proposes to increase the expression levels of disease resistance and stress-related genes MAP3K7 and NFKBIA by combining Chinese herbal feed additives with hay, thereby releasing a large number of immune factors and improving the resistance level and stress capacity of livestock;

[0021] (2) The present invention achieves the dual technical effects of reducing the morbidity of indoor breeding during the greening period while improving the stress level and survival level of free-range breeding after the greening period;

[0022] (3) The functional fermentation composition and radish seed polysaccharides and flavonoids of Buddleja scabra have the effect of synergistically improving the stress level of livestock during the greening period. The functional fermentation composition uses Chinese medicine residue as raw material and is fermented with fish scale powder, which helps to promote the release of active ingredients of Chinese medicine, enhance the efficacy, improve the bioavailability of drugs, save the dosage of drugs, etc., and the Chinese medicine residue and fish scale powder are both waste materials, which improves the reuse of resources;

[0023] (4) The livestock breeding method provided by the present invention does not use antibiotics and the breeding method is simple and feasible. It can significantly increase the weight gain of livestock breeding, enhance the body's immunity and anti-stress ability, improve the survival rate, promote growth, and improve the economic benefits of livestock breeding in the green period, and has promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a graph showing the results of alanine aminotransferase testing using the livestock breeding method provided by the present invention;

[0025] Figure 2 This is a graph showing the test results of blood protein content using the livestock feeding method provided by the present invention;

[0026] Figure 3 This is a graph showing the test results of aspartate aminotransferase content in livestock using the livestock feeding method provided by the present invention;

[0027] Figure 4 This is a graph showing the test results of alkaline phosphatase content using the livestock breeding method provided by the present invention;

[0028] Figure 5 This is a graph showing the total cholesterol content test results using the livestock feeding method provided by the present invention;

[0029] Figure 6 This is a graph analyzing the expression of MAP3K7 and NFKBIA genes using the livestock breeding method provided by the present invention.

[0030] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention. DETAILED DESCRIPTION

[0031] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments; based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only and are not intended to limit the scope of this application.

[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods; the experimental materials and test strains used in the following examples, unless otherwise specified, are all purchased from commercial channels.

[0034] Example 1

[0035] A livestock breeding method for improving grazing effect during the greening period of alpine grassland

[0036] The livestock breeding method comprises the following steps: mixing a Chinese herbal medicine feed additive accounting for 2-4% of the mass of conventional feed with conventional feed and then using the mixture for livestock and poultry breeding. The livestock and poultry include yaks and Tibetan sheep.

[0037] The Chinese herbal medicine feed additive comprises the following components in parts by weight: 3.5 parts of functional fermentation composition, 2.5 parts of radish seed polysaccharide, 1.5 parts of Buddleja flavonoids, 25 parts of carrier corn, and 40 parts of beta-cyclodextrin.

[0038] The conventional feed includes 50 parts corn flour, 20 parts wheat bran, 20 parts meal, 8 parts rice bran, 2 parts molasses, and 0.1 parts of multivitamins. The meal is one or a combination of soybean meal, cottonseed meal, rapeseed meal, and cottonseed meal. The multivitamins include vitamin B, vitamin C, and vitamin E, with the mass ratio of vitamin B, vitamin C, and vitamin E being 1:1.1:0.7.

[0039] The functional fermentation composition comprises 9 parts of fish scale powder, 5 parts of traditional Chinese medicine residue, and 2.5 parts of whey protein powder. The traditional Chinese medicine residue comprises the following components in parts by weight: 3 parts of purslane, 3 parts of Xanthium sibiricum, 2.5 parts of Kochia scoparia, 2.5 parts of Aristolochia, 1.5 parts of Campsis creeper, 1.5 parts of Andrographis paniculata, 1 part of Chinaberry bark, and 1 part of Schizonepeta tenuifolia.

[0040] The preparation method of the functional fermentation composition comprises the following steps: (1) adding water to the crushed Chinese medicinal residue and stirring evenly, and sterilizing at 120°C for 30 minutes; (2) cooling the Chinese medicinal residue powder to 27-40°C, inoculating fermentation bacteria, and performing anaerobically fermentation in a closed fermentation tank; (3) adding sodium bicarbonate to the fermented product to adjust it to neutrality, stirring evenly, standing for 30 minutes, squeezing and filtering, and then spray-drying the fermentation liquid, wherein the water content of the Chinese medicinal residue is 40%, and the fixed parameters in the fermentation conditions are: water content 60%, initial pH value 6.00, fermentation temperature 37°C, fermentation time 48 hours, inoculation amount 1.0%, initial pH value 5.75, and the fermentation bacteria are obtained by mixing Lactobacillus acidophilus and Bacillus subtilis in a volume ratio of 1:2.

[0041] The radish seed polysaccharide extraction method comprises the following steps: taking dried radish seed fruits, crushing and sieving, defatting with anhydrous ethanol under Soxhlet reflux, drying, adding water for extraction at 90°C and filtering, concentrating the extract under reduced pressure, precipitating with 95% ethanol, collecting the precipitate by centrifugation, washing the precipitate with acetone and anhydrous ethanol respectively, and freeze-drying to obtain the radish seed polysaccharide.

[0042] The preparation method of flavonoids from Buddleja herba comprises the following steps: drying Buddleja herba, crushing and screening; adding 50% ethanol aqueous solution to Buddleja herba powder, adjusting the pH value to 8.0, and then heating to 85° C. for extraction to obtain an extract; cooling to room temperature and filtering to obtain a filtrate, and adjusting the pH value of the filtrate to 6.0 with citric acid; passing the filtrate through a macroporous adsorption resin chromatography column, first eluting with 3 times the column volume of water; and then eluting with 5 times 75% ethanol (V / V); collecting the eluate, and vacuum freeze-drying to obtain flavonoids from Buddleja herba.

[0043] Example 2

[0044] A livestock breeding method for improving grazing effect during the greening period of alpine grassland

[0045] The livestock breeding method comprises the following steps: mixing a Chinese herbal medicine feed additive accounting for 2-4% of the mass of conventional feed with conventional feed and then using the mixture for livestock and poultry breeding. The livestock and poultry include yaks and Tibetan sheep.

[0046] The Chinese herbal medicine feed additive comprises the following components in parts by weight: 3 parts of functional fermentation composition, 2 parts of radish seed polysaccharide, 1 part of flavonoids from Buddleja chinensis, 20 parts of carrier corn, and 30 parts of beta-cyclodextrin.

[0047] The conventional feed includes 45 parts corn flour, 18 parts wheat bran, 18 parts meal, 2 parts rice bran, 1 part molasses, and 0.1 part multivitamin. The meal is one or a combination of soybean meal, cottonseed meal, rapeseed meal, and cottonseed meal. The multivitamin includes vitamin B, vitamin C, and vitamin E, with the mass ratio of vitamin B, vitamin C, and vitamin E being 1:1.1:0.7.

[0048] The functional fermentation composition comprises 8 parts of fish scale powder, 4 parts of traditional Chinese medicine residue, and 2 parts of whey protein powder. The traditional Chinese medicine residue comprises the following components in parts by weight: 2 parts of purslane, 2 parts of Xanthium sibiricum, 2 parts of Kochia scoparia, 2 parts of Aristolochia, 1 part of Campsis creeper, 1 part of Andrographis paniculata, 1 part of Chinaberry bark, and 1 part of Schizonepeta tenuifolia. The preparation method of the functional fermentation composition comprises the following steps: (1) adding water to the crushed Chinese medicinal residue and stirring evenly, and sterilizing at 120°C for 30 minutes; (2) cooling the Chinese medicinal residue powder to 27-40°C, inoculating fermentation bacteria, and performing anaerobically fermentation in a closed fermentation tank; (3) adding sodium bicarbonate to the fermented product to adjust it to neutrality, stirring evenly, standing for 30 minutes, squeezing and filtering, and then spray-drying the fermentation liquid, wherein the water content of the Chinese medicinal residue is 40%, and the fixed parameters in the fermentation conditions are: water content 60%, initial pH value 6.00, fermentation temperature 37°C, fermentation time 48 hours, inoculation amount 1.0%, initial pH value 5.75, and the fermentation bacteria are obtained by mixing Lactobacillus acidophilus and Bacillus subtilis in a volume ratio of 1:2.

[0049] The radish seed polysaccharide extraction method comprises the following steps: taking dried radish seed fruits, crushing and sieving, defatting with anhydrous ethanol under Soxhlet reflux, drying, adding water for extraction at 90°C and filtering, concentrating the extract under reduced pressure, precipitating with 95% ethanol, collecting the precipitate by centrifugation, washing the precipitate with acetone and anhydrous ethanol respectively, and freeze-drying to obtain the radish seed polysaccharide.

[0050] The preparation method of flavonoids from Buddleja herba comprises the following steps: drying Buddleja herba, crushing and screening; adding 50% ethanol aqueous solution to Buddleja herba powder, adjusting the pH value to 8.0, and then heating to 85° C. for extraction to obtain an extract; cooling to room temperature and filtering to obtain a filtrate, and adjusting the pH value of the filtrate to 6.0 with citric acid; passing the filtrate through a macroporous adsorption resin chromatography column, first eluting with 3 times the column volume of water; and then eluting with 5 times 75% ethanol (V / V); collecting the eluate, and vacuum freeze-drying to obtain flavonoids from Buddleja herba.

[0051] Example 3

[0052] A livestock breeding method for improving grazing effect during the greening period of alpine grassland

[0053] The livestock breeding method comprises the following steps: mixing a Chinese herbal medicine feed additive accounting for 2-4% of the mass of conventional feed with conventional feed and then using the mixture for livestock and poultry breeding. The livestock and poultry include yaks and Tibetan sheep.

[0054] The Chinese herbal medicine feed additive comprises the following components in parts by weight: 4 parts of functional fermentation composition, 3 parts of radish seed polysaccharide, 2 parts of Buddleja flavonoids, 30 parts of carrier corn, and 50 parts of beta-cyclodextrin.

[0055] The conventional feed includes 60 parts corn flour, 25 parts wheat bran, 25 parts meal, 10 parts rice bran, 3 parts molasses, and 0.15 parts of multivitamins. The meal is one or a combination of soybean meal, cottonseed meal, rapeseed meal, and cottonseed meal. The multivitamins include vitamin B, vitamin C, and vitamin E, with the mass ratio of vitamin B, vitamin C, and vitamin E being 1:1.1:0.7.

[0056] The functional fermentation composition comprises 10 parts of fish scale powder, 6 parts of traditional Chinese medicine residue, and 3 parts of whey protein powder. The traditional Chinese medicine residue comprises the following components in parts by weight: 5 parts of purslane, 5 parts of Xanthium sibiricum, 3 parts of Kochia scoparia, 3 parts of Aristolochia, 2 parts of Campsis Flos, 3 parts of Andrographis paniculata, 2 parts of Chinaberry bark, and 2 parts of Schizonepeta tenuifolia.

[0057] The preparation method of the functional fermentation composition comprises the following steps: (1) adding water to the crushed Chinese medicinal residue and stirring evenly, and sterilizing at 120°C for 30 minutes; (2) cooling the Chinese medicinal residue powder to 27-40°C, inoculating fermentation bacteria, and performing anaerobically fermentation in a closed fermentation tank; (3) adding sodium bicarbonate to the fermented product to adjust it to neutrality, stirring evenly, standing for 30 minutes, squeezing and filtering, and then spray-drying the fermentation liquid, wherein the water content of the Chinese medicinal residue is 40%, and the fixed parameters in the fermentation conditions are: water content 60%, initial pH value 6.00, fermentation temperature 37°C, fermentation time 48 hours, inoculation amount 1.0%, initial pH value 5.75, and the fermentation bacteria are obtained by mixing Lactobacillus acidophilus and Bacillus subtilis in a volume ratio of 1:2.

[0058] The radish seed polysaccharide extraction method comprises the following steps: taking dried radish seed fruits, crushing and sieving, defatting with anhydrous ethanol under Soxhlet reflux, drying, adding water for extraction at 90°C and filtering, concentrating the extract under reduced pressure, precipitating with 95% ethanol, collecting the precipitate by centrifugation, washing the precipitate with acetone and anhydrous ethanol respectively, and freeze-drying to obtain the radish seed polysaccharide.

[0059] The preparation method of flavonoids from Buddleja herba comprises the following steps: drying Buddleja herba, crushing and screening; adding 50% ethanol aqueous solution to Buddleja herba powder, adjusting the pH value to 8.0, and then heating to 85° C. for extraction to obtain an extract; cooling to room temperature and filtering to obtain a filtrate, and adjusting the pH value of the filtrate to 6.0 with citric acid; passing the filtrate through a macroporous adsorption resin chromatography column, first eluting with 3 times the column volume of water; and then eluting with 5 times 75% ethanol (V / V); collecting the eluate, and vacuum freeze-drying to obtain flavonoids from Buddleja herba.

[0060] Comparative Example 1

[0061] This comparative example provides a livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland. The only difference between this method and Example 1 is that all components do not contain live Chinese herbal medicine feed additives, and the remaining components and component contents are the same as those in Example 1.

[0062] Comparative Example 2

[0063] This comparative example provides a livestock breeding method for improving the grazing effect of alpine grassland during the greening period. The only difference between the comparative example and Example 1 is that all components do not contain radish seed polysaccharides and large-leaf Buddleja flavonoids, and the remaining components and component contents are the same as those in Example 1.

[0064] Comparative Example 3

[0065] This comparative example provides a livestock breeding method for improving the grazing effect of alpine grassland during the greening period. The only difference between this method and Example 1 is that all components do not contain the functional fermentation composition, and the remaining components and component contents are the same as those in Example 1.

[0066] Comparative Example 4

[0067] This comparative example provides a livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland. The difference between this method and Example 1 is that the functional fermentation composition does not contain fish scale powder. The remaining components and component contents are the same as those in Example 1.

[0068] Experimental Example 1

[0069] The livestock feeding method provided by the present invention is applied to livestock feeding in the green period to improve the grazing effect of alpine grassland

[0070] Group settings:

[0071] Test group: the Chinese herbal medicine feed additive prepared in Example 1;

[0072] Control group: the Chinese herbal feed additive prepared in Comparative Examples 2-4;

[0073] Blank group: the Chinese herbal medicine feed additive prepared in Comparative Example 1.

[0074] Experimental Methods: At this experimental site, winter grazing occurred from the beginning of winter to May 15th of the following year, and spring grazing occurred from May 15th to July 5th. All treatments underwent winter grazing. Therefore, yaks were kept in enclosures from May 15th to June 30th of the following year. Each plot measured 20 m × 30 m, with spacing greater than 20 m between plots. The rest period lasted from May 15th to July 5th, for a total of 50 days. To minimize the impact of spatial heterogeneity on experimental results, each treatment was replicated three times, and the average was used. The experimental yaks were divided into six groups of 20 yaks each. Each group was fed according to the group settings, and feeding, disease prevention, and management practices were consistent with normal practices.

[0075] The observation and recording items include: mainly average daily weight gain, morbidity rate and mortality rate.

[0076] As shown in Table 1, the daily weight gain of yaks in the green period using the livestock feeding method of Example 1 was higher than that of the control group and the blank group, the morbidity and mortality rates of the control group and the blank group were higher than those of Example 1, and the effect of Comparative Example 1 was similar to that of the blank group, indicating that the live Chinese herbal feed additive has the ability to improve the stress resistance of yaks in the green period, while the effects of Comparative Examples 2-4 were all reduced, indicating that there is a synergistic improvement effect among the components.

[0077] Table 1 Results of a livestock feeding method that improves the effect of grazing during the greening period of alpine grasslands and is applied to livestock feeding during the greening period

[0078] Group Average daily weight gain / Kg Incidence / % mortality rate / % Comparative Example 1 (blank) 0.69 23.12 7.24 Example 1 1.45 10.1 0 Comparative Example 2 0.92 12.69 4.35 Comparative Example 3 0.71 20.49 6.25 Comparative Example 4 1.35 13.69 3.21

[0079] In addition, blood was drawn from yaks on the 30th day of house feeding to measure the content of various components in the blood, such as Figure 1-Figure 5 As shown, the feeding method provided by the present invention can significantly increase the content of blood protein in yak serum, thereby improving the body resistance of yaks; the four indicators of alanine aminotransferase ALT, aspartate aminotransferase AST, alkaline phosphatase ALP, and total sterol are effectively improved, indicating that the liver function is improved.

[0080] At the same time, the NFKBIA gene is a yak disease resistance-related gene, and MAP3K7 is a yak stress resistance-related gene. In this example, the serum RNA of the yak in the test group was extracted (TRIZOL method), and the expression levels of MAP3K7 and NFKBIA genes were analyzed by qRT-PCR after reverse transcription (Novozyme). The specific method was carried out according to the instructions. The primers for MAP3K7 were "CTGAAGGCAAGAGGATGAG" and "TTCTGACGCTAGGACTGG", and the primers for NFKBIA were "ACCTGGTGTCACTCCTATTG" and "TCCTCATCCTCGCTCTCC". Figure 6 As shown, 1-5 are the feeding methods adopted in Comparative Example 1, Example 1, Comparative Example 2, Comparative Example 3, and Comparative Example 4, respectively. A is the gene expression level of MAP3K7, and B is the expression level of NFKBIA gene. The feeding method of the present invention can increase the expression of MAP3K7 and NFKBIA genes, thereby releasing immune factors to prevent further bacterial infection, which is beneficial to improving the resistance and adversity resistance of poultry during the greening period, thereby reducing the mortality rate.

[0081] Experimental Example 2

[0082] Effect of a livestock breeding method for improving the grazing effect of alpine grassland during the greening period provided by the present invention on breeding after the greening period

[0083] Experimental Method: The yaks used in the experiment in Example 1 were regrouped and released into the open-range stocking. Mortality rates within 14 days of release were calculated, with sudden death rates representing the percentage of yaks that died within the first five days of release. As shown in Table 2, the feeding method provided by the present invention can reduce the mortality rate of yaks released into the open-range stocking, improve their ability to withstand environmental stress, and reduce the likelihood of sudden death.

[0084] Table 2 Effect of a livestock feeding method to improve the effect of grazing rest during the greening period of alpine grassland on post-greening period breeding

[0085] Group Incidence / % mortality rate / % Sudden death rate / % Comparative Example 1 (blank) 5.64 2.54 1.09 Example 1 2.16 0 0 Comparative Example 2 3.15 1.35 0.48 Comparative Example 3 5.34 1.59 0.86 Comparative Example 4 2.98 0.58 0.37

[0086] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

[0087] The present invention and its embodiments are described above. Such description is not restrictive. The drawings show only one embodiment of the present invention, and actual applications are not limited thereto. In short, if a person skilled in the art is inspired by the above, and does not deviate from the purpose of the present invention, any method and embodiment similar to the technical solution without creative design shall fall within the scope of protection of the present invention.

Claims

1. A livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland, characterized by: The livestock feeding method comprises mixing a Chinese herbal medicine feed additive accounting for 2-4% of the mass of conventional feed with conventional feed and then using the mixture for livestock feeding; The Chinese herbal medicine feed additive comprises the following components in parts by weight: 3-4 parts of a functional fermentation composition, 2-3 parts of radish seed polysaccharide, 1-2 parts of flavonoids from Buddleja chinensis, 20-30 parts of carrier corn, and 30-50 parts of β-cyclodextrin. The preparation method of the functional fermentation composition comprises the following steps: (1) Add water to the crushed Chinese medicine residue and stir evenly, then sterilize at 120℃ for 30min; (2) After the temperature of the Chinese medicine residue powder is lowered to 27-40°C, the fermentation bacteria are introduced and anaerobic fermentation is carried out in a closed fermentation tank; (3) Add sodium bicarbonate to the fermented product to adjust it to neutral, stir evenly, let it stand for 30 minutes, squeeze and filter, and then spray dry the fermentation liquid; The radish seed polysaccharide extraction method comprises the following steps: taking dried radish seed fruits, crushing and sieving, defatting with anhydrous ethanol under Soxhlet reflux, drying, adding water for extraction at 90°C, filtering, concentrating the extract under reduced pressure, precipitating with 95% ethanol, collecting the precipitate by centrifugation, washing the precipitate with acetone and anhydrous ethanol respectively, and freeze-drying to obtain the radish seed polysaccharide; The preparation method of flavonoids from Buddleja herba comprises the following steps: drying Buddleja herba, crushing and screening; adding a 50% ethanol aqueous solution (V / V) to the Buddleja herba powder, adjusting the pH value to 8.0, and then heating the mixture to 85° C. for extraction to obtain an extract; cooling the mixture to room temperature and filtering the mixture to obtain a filtrate, and adjusting the pH value of the filtrate to 6.0 with citric acid; passing the filtrate through a macroporous adsorption resin chromatography column, first eluting with 3 times the column volume of water; and then eluting with 5 times the column volume of 75% ethanol (V / V); collecting the eluate, and performing vacuum freeze-drying to obtain flavonoids from Buddleja herba.

2. The livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland according to claim 1, characterized in that: The conventional feed comprises 45-60 parts of corn flour, 18-25 parts of wheat bran, 18-25 parts of meal, 2-10 parts of rice bran, 1-3 parts of molasses, and 0.1-0.15 parts of complex vitamins.

3. The livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland according to claim 2, characterized in that: The meal is one or more combinations of soybean meal, cottonseed meal, rapeseed meal and cottonseed meal, and the complex vitamins include vitamin B, vitamin C and vitamin E, and the mass ratio of vitamin B, vitamin C and vitamin E is 1:1.1:0.

7.

4. The livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland according to claim 3, characterized in that: The functional fermentation composition comprises 8-10 parts of fish scale powder, 4-6 parts of traditional Chinese medicine residues, and 2-3 parts of whey protein powder.

5. The livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland according to claim 4, characterized in that: The traditional Chinese medicine residue comprises the following components in parts by weight: 2-5 parts of purslane, 2-5 parts of Xanthium sibiricum, 2-3 parts of Kochia scoparia, 2-3 parts of Aristolochia, 1-2 parts of Campsis creeper, 1-3 parts of Andrographis paniculata, 1-2 parts of Chinaberry bark, and 1-2 parts of Schizonepeta tenuifolia.

6. The livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland according to claim 5, characterized in that: The fermentation bacteria are obtained by mixing Lactobacillus acidophilus and Bacillus subtilis in a volume ratio of 1:

2.

7. The livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland according to claim 6, characterized in that: The water content of the traditional Chinese medicine residue is 40%, and the fixed parameters in the fermentation conditions are: water content 60%, initial pH value 6.00, fermentation temperature 37°C, fermentation time 48h, inoculation amount 1.0%, and initial pH value 5.

75.

8. The livestock breeding method for improving the effect of grazing rest during the greening period of alpine grassland according to claim 7, characterized in that: The livestock is one of yak and Tibetan sheep.

Images