Application of an inhibitor of fetuin A in drugs for treating alcoholic fatty liver

Abstract

The present invention discloses the application of an inhibitor of fetuin A in the medicament for treating alcoholic fatty liver. In order to explore the new mechanism of the progression of ASH and find new therapeutic targets, we constructed a mouse model of alcoholic steatohepatitis with reference to the NIAAA method and performed liver tissue expression profiling sequencing, and found and verified that fetuin-A was positively correlated with alcoholic liver injury, hepatic steatosis and inflammatory changes, and inhibiting the level of fetuin-A had a protective effect on mouse alcoholic steatohepatitis (see Figures 1 to 6). These will contribute to understanding the occurrence and development process of ASH from a new perspective, contribute to the development of targeted drugs for this disease, and are expected to prevent or delay or even contribute to the reversal of the early ALD course by improving lipid metabolism disorders and reducing injury responses.

Description

Technical Field:

[0001] The present invention belongs to the field of medical biotechnology and relates to the application of an inhibitor of fetuin A in the preparation of a medicament for treating alcoholic fatty liver. Background Art:

[0002] Alcoholic liver disease (ALD) is the most prevalent chronic liver disease worldwide and is also on the rise year by year in China, having become one of the major chronic liver diseases. ALD is caused by long-term excessive alcohol consumption. In the initial stage, it presents as alcoholic fatty liver (AFL) with hepatic fat deposition, and then progresses to alcoholic steatohepatitis (ASH) with hepatic fat deposition accompanied by inflammation (neutrophil infiltration). When hepatic fat accumulation exacerbates liver damage and the inflammation index, chronic ASH will ultimately progress to liver fibrosis, cirrhosis, and even liver cancer. Among them, inflammation is a prerequisite for ASH to progress to fibrosis, cirrhosis, etc. If ASH (with or without cirrhosis) progresses rapidly, it will lead to acute alcoholic hepatitis (AH), which is associated with liver failure and high mortality. The pathogenesis of ALD includes hepatic steatosis, oxidative stress, acetaldehyde-mediated toxicity, and inflammation and fibrosis induced by cytokines and chemokines. Currently, the treatment principle for ALD is alcohol abstinence and nutritional support, and there is a lack of effective clinical treatment drugs. [3-5] Comprehensively and detailedly understanding ASH and preventing its further deterioration may be the key to preventing the progression of ALD to the advanced stage. Therefore, analyzing the key mechanisms in the pathogenesis of ASH, exploring effective therapeutic targets and prevention and treatment measures to block or reverse the progression of this disease is of great significance for the treatment of ALD.

[0003] After alcohol enters the human body, about 90% of it is metabolized in the liver. Under the action of relevant metabolic enzymes, alcohol is first converted into acetaldehyde and finally into acetate to enter the tricarboxylic acid cycle. The liver is the main organ for fat synthesis and oxidation. Alcohol directly or indirectly affects many aspects of the balance of hepatic lipid metabolism, thereby leading to hepatic lipid accumulation and liver damage. [6] Alcohol can directly reduce the expression of adenosine monophosphate-activated protein kinase (AMPK). The downregulation of AMPK is crucial for alcohol-induced lipid accumulation by stimulating sterol regulatory element-binding protein 1c (SREBP1c) and inhibiting the activity of peroxisome proliferator-activated receptor α (PPAR-α). [2]. Alcohol also directly induces the expression of cytochrome P4502E1 (CYP2E1) in liver tissue. In turn, the CYP2E1 enzyme efficiently catalyzes ethanol to produce acetaldehyde and a large number of reactive oxygen species (ROS). Acetaldehyde increases the expression of SREBP, and SREBP1c increases the biosynthesis of fatty acids through fatty acid synthase (FAS) and the enzyme responsible for fatty acid desaturation; acetaldehyde also causes mitochondrial damage, inhibits the expression and activity of PPAR-α in hepatocytes, thereby inhibiting fatty acid oxidation and leading to fatty liver formation. High concentrations of ROS can cause oxidative stress, endoplasmic reticulum stress (ERS) and steatosis. There are many types of ROS produced by alcohol metabolism, including superoxide anions, hydroxyl free radicals, hydrogen peroxide, hypochlorite ions, and singlet oxygen. Under physiological conditions, ROS, as a normal metabolite, has multiple biological functions, but under pathological conditions, excessive ROS interact extensively with a large number of molecules in the body, including proteins, lipids, carbohydrates, and nucleic acids, mediating redox modifications, causing lipid peroxidation, and then causing liver cell damage. [8] .

[0004] ASH inflammation is induced by multiple alcohol metabolites (such as ROS) and promoted by multiple cells, including macrophages and infiltrating monocytes, as well as other cell types in the innate and adaptive immune systems. [9] ROS generated by alcohol metabolism is a key factor in the development of fatty liver into hepatitis, which can induce the production of cytokines and chemokines, promote inflammatory response, and further aggravate lipid accumulation. Hepatitis is associated with severe poor prognosis. [7] ROS activates hepatic stellate cells (HSCs), and activated HSCs acquire strong proliferation ability and are in a continuously activated state, mediating liver damage and liver fibrosis.

[10] ROS can cause the synthesis of a large number of pro-fibrotic factors, such as transforming growth factor-beta (TGF-β) and tumor necrosis factor-α (TNF-α), and stimulate HSC to undergo phenotypic transformation, further increase ECM synthesis, increase the expression of inflammatory factors and cause fibrosis; the ethanol metabolism process will interfere with the adaptive immunity mediated by B cells, T cells and natural killer cells, release a variety of pro-inflammatory factors, and secrete chemokines to recruit other inflammatory cells to gather at the site of injury, thereby further aggravating inflammatory damage. [11,12] In addition, alcohol can stimulate abnormal activation of the innate immune molecule complement, affecting liver fat deposition and inflammation.

[13] , ethanol can induce alcoholic steatosis and liver injury by activating the classical pathway through complement C1q; in mice lacking complement factor D (CFD), liver injury, steatosis, and pro-inflammatory mediators were significantly increased after chronic ethanol exposure. [14,15] ; Both Kupffer cells and HSCs in the liver express C3a receptor (C3aR) and C5a receptor (C5aR). Early-activated complement promotes the expression of inflammatory cytokines in Kupffer cells by activating C3aR and C5aR. [16 , 17] . In addition, the main degradation product of lipid peroxidation is malondialdehyde (MDA). Excessive MDA can severely damage the structure of the liver cell membrane, leading to hepatocyte swelling and necrosis, and can reflect the degree of lipid peroxidation and cell oxidative damage in the human body. [5] . Kwon et al.

[18] found that in an alcohol model, the lack of aldehyde dehydrogenase 2 caused the accumulation of acetaldehyde in the mouse liver, and the increased content of malondialdehyde-acetaldehyde (MAA) mediated the paracrine activation of interleukin-6 (IL-6) in Kupffer cells, thus exacerbating liver inflammation and fibrosis. SOD is an important scavenger of free radicals in the human body, which can prevent the toxic effects caused by biomembrane peroxidation. However, excessive and long-term alcohol intake will reduce the activity of SOD and deplete endogenous antioxidants, causing changes including cell damage, inflammation, oxidative stress, intestinal flora imbalance and migration, etc., aggravating liver injury from multiple pathways and promoting the progression of ASH. Although there have been many studies on the pathogenesis of ASH, there are still many mysteries in its occurrence and development process. At present, there is no FDA-approved therapeutic drug at home and abroad.

[0005] Fetuin-A (alpha2-heremans-schmid glycoprotein / fetuin-A, AHSG / FetA) is mainly secreted by the liver and is a negatively charged serum glycoprotein that can disrupt insulin signaling and cause insulin resistance. The level of fetuin-A is affected by nutritional status and is related to factors such as alcohol, dairy products, and coffee.

[21] Fetuin-A has biological activity only after phosphorylation and is an inhibitor of insulin receptor tyrosine kinase (TK), participating in multiple metabolic pathways and being related to type 2 diabetes, tumors, obesity, and fatty liver, etc.

[22] . There is data indicating that moderate alcohol consumption will affect the blood fetuin-A level. Ley et al. conducted a large-scale survey and found that in women without type 2 diabetes, moderate alcohol consumption can reduce the blood fetuin-A; however, another clinical study showed that the fetuin-A level in overweight patients with excessive alcohol consumption increased, resulting in insulin resistance and inhibition of adiponectin release in adipose tissue, and the disease developed faster than that in normal-weight patients with excessive alcohol consumption.

[24] 。A recent study evaluated the impact of daily alcohol consumption on glucose tolerance and the risk of diabetes development in the Japanese population and found that daily alcohol consumption was associated with reduced insulin secretion and an increased risk of diabetes development.

[0006] Fetuin-A protein levels play an important role in influencing insulin resistance in lipid metabolism. It has been reported in an article that when fetuin-A knockout mice were fed a high-fat diet, they were resistant to weight gain, showed a significant reduction in body fat, and there was an increase in the phosphorylation of insulin receptors and the downstream mitogen-activated protein kinases (MAPKs) and Akt in the liver and skeletal muscles, maintaining insulin sensitivity in the mice.

[27] Pal et al.

[28] found that a high-fat diet induced a significant increase in serum fetuin-A in mice; it was also found that fatty acids could induce insulin resistance only in the co-presence of fetuin-A and Toll-like receptor 4 (TLR4); the terminal galactoside moiety of fetuin-A directly binds to the residues Leu100–Gly123 and Thr493–Thr516 in TLR4; in summary, the study believes that fetuin-A acts as an endogenous ligand to bind to TLR4, promoting lipid-induced insulin resistance. There are also studies showing that high levels of free fatty acids induce the secretion of the fetuin-A gene and the expression of the protein in pancreatic β-cells through the overexpression of TLR4 and NF-κB; the NF-κB expression mediated by fatty acids enhanced the inflammatory response through the expression of cytokines (such as IL-1β and IL-6).

[29] 。These data demonstrate that a high-fat diet can increase the plasma fetuin-A concentration. Fetuin-A specifically inhibits the autophosphorylation of insulin receptors and subsequent metabolism, reduces insulin sensitivity, leading to insulin resistance and causing obesity and inflammation. It is a key substance in the insulin-dependent metabolic pathway. The role of fetuin-A in alcoholic steatohepatitis is still unclear. Summary of the Invention:

[0007] The object of the present invention is to provide the use of an inhibitor of fetuin-A in the medicament for treating alcoholic fatty liver.

[0008] Therefore, the present invention provides the use of an inhibitor of fetuin-A in the medicament for treating alcoholic fatty liver.

[0009] Preferably, the inhibitor of fetuin-A is an shRNA that inhibits fetuin-A.

[0010] Preferably, the shRNA is: the 5'-end is ACCGG, the stem is gtCTTGAATCAGATCGACAAA, the loop is TTCAAGAGA, the stem is TTTGTCGATCTGATTCAAGAC, and the 3'-end is TTTTT.

[0011] Preferably, the inhibitor of fetuin-A is an adenovirus containing shRNA that inhibits fetuin-A.

[0012] The second object of the present invention is to provide a drug for treating alcoholic fatty liver, which contains the above-mentioned inhibitor of fetuin-A as an active ingredient.

[0013] In order to explore the new mechanism of the progression of ASH and find new therapeutic targets, we constructed a mouse model of alcoholic steatohepatitis with reference to the NIAAA method and performed liver tissue expression profiling sequencing, and found and verified that fetuin-A was positively correlated with alcoholic liver injury, hepatic steatosis and inflammation (see Figures 1 to 6 ). These will help to understand the occurrence and development process of ASH from a new perspective, contribute to the development of targeted drugs for this disease, and are expected to prevent or delay and even contribute to the reversal of the early ALD course by improving lipid metabolism disorders and reducing injury responses. Description of the drawings:

[0014] Figure 1 Detection of serum biochemical indexes of mice with alcoholic steatohepatitis; A. ALT value; B. AST value; C. Level of triglyceride in serum; D. Level of TNF-α in serum; E. Level of IL-6 in serum.

[0015] Figure 2 Detection of liver tissue pathology and oxidative stress indexes of mice with alcoholic steatohepatitis, A. H&E and Oil Red O staining of mouse liver tissue; B. Level of triglyceride in mouse liver tissue; C. Level of MDA in mouse liver tissue; D. Level of SOD in mouse liver tissue.

[0016] Figure 3 Expression profiling sequencing of liver tissue of mice with alcoholic steatohepatitis and verification of Fetuin-A expression level, A. Expression profiling sequencing of liver tissue of experimental group mice and control group; B. Detection of mRNA level of Fetuin-A in mouse liver tissue by quantitative RT-PCR; C. Protein expression level of Fetuin-A in mouse liver tissue.

[0017] Figure 4 Reduction of hepatic lipid deposition and oxidative stress levels in mice with alcoholic steatohepatitis after knocking down Fetuin-A, after inhibition of mouse Fetuin-A by adeno-associated virus shRNA, A. mRNA level of Fetuin-A in mouse liver tissue; B. Protein level of Fetuin-A in mouse liver tissue; C. ALT level in serum; D. AST level in serum; E. H&E and Oil Red O staining of mouse liver tissue; F. Level of triglyceride in mouse liver tissue; G. Level of MDA in mouse liver tissue; H. Level of GSH in mouse liver tissue. *, P < 0.05; **, P < 0.01.

[0018] Figure 5 It is the expression of lipid metabolism-related genes in the liver tissue of mice with alcoholic steatohepatitis after knocking down Fetuin-A. After inhibiting Fetuin-A in mice with adeno-associated virus shRNA, the mRNA levels of A. Srebf1, B. Acc, C. Fasn, D. SCD1, E. PPAR-α, and F. CPT-1 in the liver tissue; G. Western blot was used to detect the protein levels of ACC, FASN, and SREBP1c. *, P < 0.05; **, P < 0.01.

[0019] Figure 6 It is that knocking down Fetuin-A reduces the liver inflammation level in mice with alcoholic steatohepatitis. After inhibiting Fetuin-A in mice with adeno-associated virus shRNA, A. Immunohistochemical staining of F4 / 80 in the liver tissue of mice; B. mRNA level of F4 / 80 in the liver tissue of mice; C. mRNA level of IL-1β in the liver tissue of mice; D. mRNA level of TNFα in the liver tissue of mice; E. mRNA level of Ly6g in the liver tissue of mice. **, P < 0.01; ***, P < 0.001. Specific implementation manner:

[0020] The following examples are further descriptions of the present invention, rather than limitations on the present invention.

[0021] Example 1:

[0022] (1) Preparation of the model, expression profiling sequencing and verification of mouse alcoholic steatohepatitis (NIAAA model).

[0023] Referring to the NIAAA method, a model was constructed using wild-type female mice with a C57BL / 6 background. After completion, serum was collected to detect liver function indicators (AST and ALT), triglycerides, inflammatory factors, etc.; fresh liver tissue was taken for frozen section, and Oil Red O staining was used to detect the degree of fatty degeneration; liver tissue was taken to prepare paraffin blocks, and H&E staining was used to detect the morphology of the liver tissue; immunohistochemistry was used to analyze the protein expression of related lipid metabolism and inflammatory changes; total RNA of mouse liver tissue was taken to detect the expression levels of lipid metabolism-related genes, inflammatory factors, etc. in the liver tissue. Fresh liver tissue from the experimental group and the control group of mice was taken for expression profiling sequencing, and Fetuin-A was obtained by analyzing differential expression, and quantitative RT-PCR and protein level verification were performed on the liver tissue.

[0024] (2) Function of Fetuin-A in the progression of mouse alcoholic steatohepatitis.

[0025] After inhibiting the expression of Fetuin-A gene in mice with adeno-associated virus AAV8-shRNA, the NIAAA method was used to establish a model. Serum and liver tissues were collected to detect liver function (AST and ALT), steatosis, oxidative stress, etc. Fresh liver tissues were frozen-sectioned and stained with Oil Red O to detect liver fat deposition; liver tissues were taken to prepare paraffin blocks and stained with H&E to detect the morphology of liver tissues; RNA and proteins were extracted from liver tissues to detect genes related to lipid metabolism and inflammatory responses, and to explore the function of Fetuin-A in the occurrence and development of alcoholic steatohepatitis in mice.

[0026] 1. Experimental methods

[0027] (1) Preparation of the mouse model of alcoholic steatohepatitis (NIAAA model). Referring to the NIAAA method (acute model of alcoholic liver disease), a 10-day Lieber-DeCarli ethanol liquid diet and a single alcohol gavage can induce liver injury, fatty liver and inflammation in mice. Each group consisted of 8 C57BL / 6 female mice, approximately 8 - 10 weeks old and weighing about 20 grams. The process was as follows: All the purchased mice were fed a normal diet for 3 days, then adaptively fed with liquid feed for 2 days, randomly caged, with 2 mice in each cage. The mice in the control group (Pair-fed group) were fed a control liquid feed; the mice in the alcohol experimental group (EtOH-fed group) were first fed with Lieber-DeCarli liquid feed with alcohol concentrations of 1%, 2%, and 4% (V / V) for 1 day each, and then continuously fed with alcohol liquid feed at a concentration of 5% for 10 days; all feeding times were in the evening, and the feeding amount for the day was adjusted according to the previous day's diet. The feeding amount of the control group was adjusted according to the experimental group (because the food intake of the mice in the alcohol group would change). Between 7 - 9 am on the day of sampling, a 1 mL gavage needle was used for gavage. The mice in the Pair-fed group were gavaged with 45% (wt / v) maltodextrin, and the mice in the EtOH-fed group were gavaged with 31.5% (v / v) alcohol. The gavage volume for each mouse was calculated at 20 μl / g body weight; then, the mice were placed back in their original cages and kept in a warm room; after fasting and water deprivation for 8 - 9 hours, the mice were anesthetized with isoflurane, weighed and recorded, and finally blood and liver tissues were taken.

[0028] After taking the supernatant of the blood, ALT, AST, TG, etc. can be measured. Some fresh liver tissues of the mice were immediately frozen in liquid nitrogen and then stored at -80°C for RNA or protein extraction; some fresh liver tissues of the mice were immediately added with OCT, frozen at -20°C, and then frozen-sectioned for Oil Red O staining; some fresh liver tissues were placed in formalin for 24 to 48 hours and then subjected to subsequent dehydration and paraffin embedding.

[0029] Fresh liver tissues from the control group and NIAAA model mice were frozen in liquid nitrogen and stored in dry ice, then sent to the company for sequencing to analyze differentially expressed genes and screen out Fetuin-A.

[0030] (2) Preparation of a mouse model of alcoholic steatohepatitis with knockdown of Fetuin-A gene expression. An adeno-associated virus shRNA (FetA-shRNA, as shown in Table 1) that inhibits Fetuin-A gene expression and a control adeno-associated virus (shRNA-NC, with a control insertion sequence of CGCTGAGTACTTCGAAATGTC) were prepared. Ten-week-old female C57BL / 6 mice purchased were fed a normal diet for 3 days and divided into 2 groups of 8 mice each. Under an auxiliary device for tail vein injection, adeno-associated virus was injected into the tail vein. One group was injected with the control adeno-associated virus (shRNA-NC group), and the other group was injected with the adeno-associated virus shRNA that inhibits Fetuin-A (FetA-shRNA group). Each mouse was injected with 1 - 2×10 11 U virus, and then fed a normal diet and sterilized water for one week. One week later, according to the NIAAA method, adaptive feeding and subsequent alcohol liquid diet feeding were carried out. Gastric gavage and fasting were performed 8 - 9 hours before sampling.

[0031] Table 1 Inhibitory sequences of adeno-associated virus for mouse Fetuin-A gene

[0032]

[0033] (3) Preparation of mouse serum and liver tissue samples.

[0034] 1) Serum treatment: After the mice were anesthetized, blood was taken from the eye socket and placed in a clean 1.5 ml centrifuge tube. It was left to stand at room temperature for 4 hours, centrifuged at 3000 rpm / min in a centrifuge at 4°C for 10 minutes. After sucking the supernatant, the blood cell residue was discarded to obtain a clear and transparent supernatant. Liver function (AST and ALT) indexes, triglycerides were detected by an automatic biochemical analyzer, and inflammatory factors and other indexes were detected by ELISA.

[0035] 2) Frozen section of liver tissue: After the mice were bled, the entire liver tissue was taken out through laparotomy. The liver was thoroughly washed with an appropriate amount of physiological saline, dried with a sterile gauze, weighed and recorded. The liver was cut into small pieces. Part of the left lateral lobe of the liver was placed in an embedding base mold and covered with OCT frozen section embedding agent. After being placed in a -20°C refrigerator for at least 2 hours, frozen sectioning could be carried out. Generally, sections were cut at a thickness of 8 - 10 μm.

[0036] 3) Paraffin embedding of liver tissue: Part of the left lateral lobe of the liver tissue was placed in about 6 ml of 10% neutral formalin solution prepared in advance and fixed at room temperature for about 24 hours, and then placed in 70% - 75% alcohol. Then the liver tissue was dehydrated by a dehydrator and finally embedded in paraffin. Generally, paraffin samples were cut at a thickness of 4 μm.

[0037] (4) Diagnosis of fatty liver: Oil Red O staining of the liver, detection of the contents of triglyceride (TG) and total cholesterol in serum and liver tissue.

[0038] A. Oil Red O staining.

[0039] 1) Fixation: The cut samples with a thickness of 10 μm are placed in 10% formaldehyde-calcium solution for at least 10 minutes and washed with distilled water for 3 minutes.

[0040] 2) Immersion washing: Immerse in 60% isopropanol solution for 30 - 60 seconds.

[0041] 3) Oil Red O staining: Immerse in 60% Oil Red O staining solution after rewarming for 10 minutes.

[0042] 4) Differentiation: Differentiate in 60% isopropanol solution for about 20 seconds until the stroma is clear, and wash with distilled water for 3 minutes.

[0043] 5) Hematoxylin staining: Stain with modified Harris hematoxylin staining solution for 3 minutes and rinse with tap water for 5 minutes.

[0044] 6) Mounting and scanning: After rinsing with tap water, wipe off the moisture around the tissue, mount with glycerin gelatin melted with warm water, and scan with a slide scanner.

[0045] B. Detection of the contents of serum triglyceride (TG) and serum total cholesterol (TCH): Take mouse serum and operate according to the instructions of the detection kit.

[0046] C. Detect serum TG and TCH in the supernatant of mouse whole blood with an automatic biochemical analyzer.

[0047] D. Detection of the contents of TG and TCH in liver tissue: Take about 0.1 g of fresh (or stored in a -80°C refrigerator) liver, grind it in liquid nitrogen, and operate according to the instructions of the TG enzymatic method and TCH enzymatic method detection kits of Nanjing Jiancheng Company.

[0048] (5) Liver function determination: Detect ALT and AST in mouse serum with an automatic biochemical analyzer.

[0049] (6) Pathological changes of liver tissue: H&E staining.

[0050] 1) Deparaffinization and dehydration: Place the paraffin sections in a 60°C oven for about 2 hours, take them out and cool to room temperature, then place them in xylene cylinders 1, 2, and 3 for 6 - 8 minutes each, in absolute ethanol cylinder 1 for 5 minutes, and in absolute ethanol cylinders 2, 90% ethanol, 80% ethanol, 70% ethanol, 50% ethanol cylinders, and distilled water cylinder for 2 minutes each.

[0051] 2) Hematoxylin staining: Stain in the modified Harris hematoxylin staining solution cylinder for 4 minutes and rinse with tap water for 5 minutes.

[0052] 3) Eosin staining: Eosin staining solution for 30 seconds, then rinse with tap water for 30 seconds.

[0053] 4) Dehydration and clearing: Place in 70%, 80%, and 90% ethanol cylinders for 10 seconds each, and then in absolute ethanol cylinder for 20 seconds.

[0054] 5) Mounting and scanning: After drying thoroughly, add neutral balsam for mounting, and then scan with a slide scanner.

[0055] (7) Oxidative stress detection: Take about 0.1 g of fresh liver or liver stored in a -80°C refrigerator, grind it in liquid nitrogen, and operate according to the instructions of the SOD assay kit and MDA assay kit (TBA method) from Nanjing Jiancheng Company. Detect the CYP2E1 expression level in mouse liver tissue.

[0056] (8) Detection of lipid metabolism-related genes: qRT-PCR, Western blot, and immunohistochemistry. Take about 0.1 g of fresh (or stored in a -80°C refrigerator) liver, grind it in liquid nitrogen, extract RNA, and perform quantitative PCR after reverse transcription to detect the transcriptional levels of metabolism-related genes such as Srebp-1, acetyl-CoA carboxylase (Acc), fatty acid synthase (Fasn), and carnitine palmitoyltransferase 1 (Cpt-1). Take the liver tissue grinding solution and detect the protein expression of each related gene by Western Blot. Take the paraffin samples of liver tissue for immunohistochemical detection.

[0057] (9) Detection of inflammatory factors: ELISA, qRT-PCR, and immunohistochemistry to detect related factors. ELISA is used to detect serum inflammatory factors (TNF-α, IL-6); immunohistochemistry is used to detect the expression of F4 / 80 in liver tissue; take liver tissue, grind it in liquid nitrogen, extract RNA, and perform qPCR with related primers after reverse transcription to detect the mRNA levels of inflammatory factors such as IL-1β, TNFα, and Ly6g in liver tissue.

[0058] (10) Expression profiling sequencing and data processing: Take fresh liver tissues from the control group and NIAAA model mice, quickly freeze them in liquid nitrogen, and send them to a sequencing company for sequencing after storing in dry ice. Screen for the differentially expressed gene Fetuin-A and verify it.

[0059] 2. Experimental results:

[0060] (1) Preparation of mouse alcoholic steatohepatitis (NIAAA model). Refer to the NIAAA method for establishing an acute model of alcoholic liver disease. The control group (Pair-fed) is fed a control liquid diet, and the alcohol group (EtOH-fed) is fed a Lieber-DeCarli liquid diet containing 5% alcohol for 10 days plus one alcohol gavage. After sampling, analyze various serum indicators with an automatic biochemical analyzer. Figure 1It can be seen that compared with the Pair-fed group, the alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the EtOH-fed group were significantly increased, indicating that alcohol stimulation damaged the liver function of mice; the content of triglyceride (TG) in the serum increased significantly, suggesting that alcohol increased the triglyceride level in the serum; the inflammatory cytokines tumor necrosis factor α (TNF-α) and interleukin 6 (IL-6) in the serum were also significantly higher than those in the control group.

[0061] Furthermore, paraffin samples were taken for pathological examination, and fresh liver tissues were used for the detection of TG and oxidative stress indexes. Figure 2 It can be seen that after H&E staining of the paraffin samples of mouse liver tissues, compared with the Pair-fed group, the lipid droplets in the liver tissues of the EtOH-fed group were obvious, while no obvious lipid droplets were found in the control group; the oil red O staining results of fresh liver tissues showed that the oil droplets in the liver tissues of the EtOH-fed group of mice were significantly accumulated; at the same time, the triglyceride in the liver tissues was detected by the kit, and it was found that the triglyceride level in the liver tissues of the EtOH-fed group of mice increased significantly compared with that of the control group; all these indicated that under alcohol stimulation, the fat deposition in the mouse liver tissues was obvious. After grinding the frozen liver tissues into samples, the kit detection results showed that compared with the Pair-fed group, the final product of lipid oxidation malondialdehyde (MDA) in the liver of the EtOH-fed group of mice was significantly elevated, and at the same time, the superoxide dismutase (SOD) was significantly decreased.

[0062] The increase in the production of MDA indicated that alcohol caused liver damage and lipid peroxidation, and the damage of cell membranes was aggravated; SOD could scavenge superoxide free radicals in organisms, and the decrease in SOD indicated that the antioxidant ability of mice was weakened. These results showed that alcohol could promote liver injury, liver fat deposition and inflammatory changes in mice, indicating that the mouse model of alcoholic fatty hepatitis was successfully established, laying a solid foundation for the next experiment.

[0063] (2) Expression and verification of Fetuin-A in the liver tissues of mice with alcoholic fatty hepatitis. Fresh liver tissues of the experimental group of the NIAAA model and those of the control group were taken for expression profile sequencing. The results showed that compared with the Pair-fed group, there were a large number of differentially expressed genes in the liver tissues of the EtOH-fed group of mice ( Figure 3 ). We analyzed the sequencing results and found that the expression of Fetuin-A in the liver tissues of the EtOH-fed group of mice was significantly higher than that of the control group. Further, we detected Fetuin-A by quantitative RT-PCR and western blot, and the results showed that alcohol did stimulate the up-regulation of the transcriptional level of the Fetuin-A gene in the mouse liver tissues, with significant differences compared with the control group; the protein expression level also increased significantly.

[0064] (3) Inhibit the protective effect of Fetuin-A in murine alcoholic steatohepatitis. To investigate the role of Fetuin-A in the progression of murine alcoholic hepatitis, an adeno-associated virus AAV8-shRNA against Fetuin-A (FetA-shRNA) and a control adeno-associated virus (shRNA-NC) were prepared, and a murine NIAAA model was established one week after injection. After sampling, the hepatic lipid deposition, oxidative stress, and inflammatory factor levels in murine liver tissues were detected ( Figure 4 , Figure 5 , Figure 6 ).

[0065] The transcriptional and protein levels of Fetuin-A were detected in the liver tissues of the control and experimental group mice. The results showed that both the transcriptional and translational levels of Fetuin-A in the liver tissues of the experimental group mice were significantly lower than those of the control group (shRNA-NC), indicating that the adeno-associated virus shRNA had a good inhibitory effect on Fetuin-A ( Figure 4 A and 4B); the liver function indexes were detected by an automatic biochemical analyzer and found that the levels of ALT and AST in the serum of the FetA-shRNA group mice were decreased compared with the control ( Figure 4 C and 4D); the results of H&E staining of liver tissue paraffin sections and Oil Red O detection of fresh liver tissues both showed that compared with the shRNA-NC control group, the lipid deposition in the liver tissues of mice with inhibited Fetuin-A expression in vivo was decreased, the lipid droplets became smaller, and the number became fewer ( Figure 4 E); the TG content in the liver tissues of the FetA-shRNA group mice was also less than that of the control ( Figure 4 F).

[0066] ELISA detection found that compared with the control group, the MDA level in the liver tissues of the FetA-shRNA group mice decreased, while the SOD level increased, indicating that inhibiting Fetuin-A in mice could reduce the oxidative stress level caused by alcohol, decrease free radical generation, enhance the antioxidant capacity of mice, and thus protect against alcoholic liver injury ( Figure 4 G and 4H).

[0067] Many studies have shown that alcohol exposure can stimulate the increased expression of genes related to fatty acid synthesis in murine liver tissues and inhibit β-oxidation, resulting in hepatic steatosis. From Figure 5It was observed that in the NIAAA model, after adenovirus-associated virus shRNA inhibited Fetuin-A in mice, the expression levels of genes related to lipogenesis, namely Srebf1 (sterol regulatory element-binding transcription factor 1), Acc (acetyl-CoA carboxylase), Fasn (fatty acid synthase), and Scd1 (stearoyl-CoA desaturase 1), all decreased correspondingly, reducing hepatic lipogenesis; while PPAR-α and CPT-1 (carnitine palmitoyltransferase I), the rate-limiting enzyme of fatty acid β-oxidation, increased, indicating that after the reduction of Fetuin-A in mice, fatty acid oxidative metabolism could be increased, thereby promoting lipid consumption( Figure 5 ). Further verification was performed by Western blot. After knocking down Fetuin-A, the protein levels of ACC, FASN, and SREBP1c in the liver tissue of mice decreased( Figure 5 G).

[0068] Liver tissues of mice with alcoholic steatohepatitis model were taken for detection of inflammation. It could be seen from the immunohistochemical results that after inhibiting Fetuin-A in mice, the positivity of F4 / 80 significantly decreased( Figure 6 A); the qRT-PCR results showed that after inhibiting Fetuin-A, the mRNA level of F4 / 80 decreased( Figure 5 B); in addition, the mRNA expression levels of inflammatory factors IL-1, TNFα, and Ly6g decreased( Figure 6 C-E). Further confirmation at the molecular level showed that inhibiting Fetuin-A could down-regulate the expression of inflammation-related genes, indicating that low levels of Fetuin-A have a protective effect on alcohol-induced inflammation.

Claims

1. Use of an inhibitor of fetuin A in the preparation of a medicament for treating alcoholic fatty liver, wherein the inhibitor of fetuin A is an shRNA that inhibits fetuin A, and the shRNA is: with ACCGG at the 5'-end, stem being gtCTTGAATCAGATCGACAAA, loop being TTCAAGAGA, stem being TTTGTCGATCTGATTCAAGAC, and TTTTT at the 3'-end.

2. The use according to claim 1, characterized in that The inhibitor of fetuin A is an adeno-associated virus containing shRNA that inhibits fetuin A.

3. A medicament for treating alcoholic fatty liver, characterized in that Comprising an inhibitor of fetuin A as an active ingredient, the inhibitor of fetuin A is shRNA that inhibits fetuin A, and the shRNA is: with ACCGG at the 5'-end, stem being gtCTTGAATCAGATCGACAAA, loop being TTCAAGAGA, stem being TTTGTCGATCTGATTCAAGAC, and TTTTT at the 3'-end.

4. The medicament according to claim 3, characterized in that The inhibitor of fetuin A is an adeno-associated virus containing shRNA that inhibits fetuin A.

Images