Application of tppp3 as an action target in preparation of type i hypersensitivity reaction drugs

Abstract

The application discloses application of TPPP3 as an action target in preparation of a type I hypersensitivity reaction drug, and belongs to the technical field of biological medicine preparation.The application discloses application of an inhibitor of TPPP3 in preparation of a type I hypersensitivity reaction drug, wherein the inhibitor comprises siRNA interfering with gene expression of TPPP3 and / or Indibulin.The application knocks down the TPPP3 gene through RNAi technology, finds that deletion of the TPPP3 gene can significantly inhibit IgE-mediated mast cell degranulation, and reduces activity of an upstream signal molecule of an Fc epsilon RI signal pathway to regulate the type I hypersensitivity reaction, and also finds that Indibulin can inhibit RBL-2H3 cell degranulation in vitro, and can inhibit a PCA reaction in a mouse in vivo, indicating that the Indibulin has a treatment potential for type I hypersensitivity reaction diseases.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological medicine preparation, and particularly relates to application of TPPT3 as an action target in preparation of a type I hypersensitivity reaction drug. BACKGROUND

[0002] Hypersensitivity diseases are a series of diseases mediated by innate and adaptive immune responses and epithelial cells, and the immune system plays a crucial role in maintaining health and protecting the human body from microbial invasion. However, the same system can cause excessive immune and inflammatory responses, resulting in adverse consequences known as hypersensitivity. Hypersensitivity is an immune response to an excessive reaction to an allergen, which is divided into four types: type I, type II, type III and type IV. Type I, type II and type III reactions are the results of antibody action, while type IV reaction involves T cell lymphocytes and cell-mediated immune responses. In short, hypersensitivity is a general term, and the term "anaphylaxis" is mainly defined within the scope of type I hypersensitivity mediated by immunoglobulin E (IgE).

[0003] The incidence of type I hypersensitivity diseases is increasing year by year, which brings a great burden to the social economy. Some factors including pollution, climate change, reduction of biological diversity, urbanization, changes in lifestyle and dietary habits are considered to be the reasons for the substantial increase in cases. However, the current treatment of the disease still stays at the level of symptom control, and there is no exact cure method, so it is very difficult to cure. Type I hypersensitivity is caused by contact with antigens. The reaction to the antigen occurs in two stages: the sensitization stage and the effector stage. In the sensitization stage, antigen-presenting cells (APCs) deliver allergens (or antigens) to T cells. T cells send signals to stimulate B cells to produce IgE, an antibody that binds to Fc receptors on mast cells and basophils. Subsequently, cross-linking of IgE antibodies bound to free antigens occurs on mast cells, ultimately leading to mast cell degranulation and release of histamine (HA), proteolytic enzymes and other mediators (i.e. prostaglandins, cytokines, leukotrienes, platelet-activating factor, macrophage inflammatory proteins, trypsin-like enzymes, etc.). The result will cause increased vascular permeability, peripheral vasodilation, smooth muscle contraction, and the individual may have an itchy and local asthmatic reaction or a systemic hypersensitivity reaction. Throughout this process, mast cells play a key role.

[0004] Mast cells are the main response cells of type I hypersensitivity, and the release of allergic mediators caused by mast cell degranulation triggered by IgE / FcεRI signal is the key link of the occurrence of the disease. The process requires fine signal coordination between cytoskeleton reorganization and membrane fusion mechanism to achieve lipid bilayer mixing, thereby leading to the release of inflammatory mediators. In recent years, although people have had more research on the proximal signal downstream of mast cell FcεRI, the regulation of granule secretion and microtubule transport mechanism are still unclear.

[0005] Tubulin polymerization promoting protein 3 (TPPP3) is a member of the TPPP family, which can induce tubulin polymerization and microtubule bundling, and belongs to microtubule associated protein (MAPs). Vincze et al. first reported that TPPP3 is a member of the TPPP family, which can attach to microtubules and cause microtubule bundling activity. It is currently known that its family contains three members, the first discovered TPPP / p25 and the other two TPPP2 / p18 and TPPP3 / p20 which are 60% homologous to it. At present, more researches are focused on TPPI, which is related to diseases related to the nervous system, such as neurodegenerative diseases and multiple system atrophy, etc.; and relatively less researches are involved in TPPI and TPPII.

[0006] TPPP3 has the ability to promote tubulin polymerization and assembly, and is involved in intracellular material transport, and can also be involved in tumor, motor neuron disease, muscle and skeletal development, embryonic development and other physiological functions. Under different genetic backgrounds and different physiological conditions, TPPII shows different biological functions. So far, there is no related research on TPPII regulating type I hypersensitivity. SUMMARY

[0007] The purpose of the present application is to provide the application of TPPII as a target in the preparation of type I hypersensitivity drugs to solve the above-mentioned problems existing in the prior art. The present application knocks down the TPPII gene by RNAi technology, finds that the deletion of TPPII gene can significantly inhibit IgE-mediated mast cell degranulation, and reduces the activity of upstream signal molecules of FcεRI signaling pathway to regulate type I hypersensitivity. It is also found that Indibulin can inhibit the degranulation phenomenon of RBL-2H3 cells in vitro and inhibit the PCA reaction in mice, indicating that it has the potential for the treatment of type I hypersensitivity diseases.

[0008] To achieve the above-mentioned purpose, the present application provides the following scheme:

[0009] The application provides an application of an inhibitor of TPPP3 in preparation of a type I hypersensitivity reaction drug, wherein the inhibitor comprises siRNA interfering with expression of a TPPP3 gene and / or indibulin.

[0010] Further, the nucleotide sequence of the siRNA is shown as SEQ ID NO: 5-6.

[0011] Further, the siRNA plays a role in treating type I hypersensitivity reaction by improving morphological changes of mast cell degranulation, reducing cell apoptosis, reducing release amounts of histamine and beta-hexosaminidase of cells, and regulating a signal pathway.

[0012] Further, the signal pathway comprises Lyn / Fyn, PI3K / AKT and NF-κB.

[0013] Further, the indibulin plays a role in treating type I hypersensitivity reaction by improving morphological changes of mast cell degranulation, reducing cell apoptosis and reducing release amounts of histamine and beta-hexosaminidase of cells.

[0014] Further, the type I hypersensitivity reaction comprises IgE-mediated type I hypersensitivity reaction.

[0015] The application also provides a drug for preventing and treating type I hypersensitivity reaction, comprising siRNA interfering with expression of a TPPP3 gene and / or indibulin.

[0016] Further, the nucleotide sequence of the siRNA is shown as SEQ ID NO: 5-6.

[0017] Further, the drug further comprises a pharmaceutically acceptable carrier.

[0018] Further, the carrier comprises one or more of excipients, emulsifiers and surfactants.

[0019] The application discloses the following technical effects:

[0020] The application finds that microtubule-associated protein TPPP3 is closely related to IgE-mediated RBL-2H3 cell degranulation, and knocking down expression of the TPPP3 gene can inhibit degranulation of RBL-2H3 cells by regulating a signal pathway involving Lyn, AKT and NF-κB, and further affect type I hypersensitivity reaction, which indicates that TPPP3 is an effective drug target for type I hypersensitivity reaction. The application also finds that anti-microtubule aggregation drug indibulin inhibiting TPPP3 can inhibit degranulation of RBL-2H3 cells in vitro and inhibit PCA reaction in mice, which indicates that the indibulin has a treatment potential for type I hypersensitivity reaction.

[0021] The application analyzes the regulation and possible mechanism of TPPP3 in the type I hypersensitivity in vivo and in vitro, and provides experimental basis and scientific basis for revealing the pathogenesis of type I hypersensitivity and further studying the role of TPPP3 in type I hypersensitivity. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0023] Figure 1 Fig. 2 is the expression results of TPPP3 gene in each group;

[0024] Figure 2 Fig. 4 is the expression results of TPPP3 protein (n=3); (a) Western Blot results; (b) gray scale analysis results;

[0025] Figure 3 Fig. 6 is the neutral red staining results of the influence of knocking down TPPP3 on the morphology of RBL-2H3 cells (bar=100 μm);

[0026] Figure 4 Fig. 8 is the influence of knocking down TPPP3 on the release of β-Hex of RBL-2H3 cells induced by IgE (n=3);

[0027] Figure 5 Fig. 10 is the influence of knocking down TPPP3 on the release of HA of RBL-2H3 cells induced by IgE (n=3);

[0028] Figure 6 Fig. 12 is the influence of knocking down TPPP3 on the apoptosis of RBL-2H3 cells induced by IgE (n=3) (bar=100 μm);

[0029] Figure 7 Fig. 14 is the statistics of the influence of knocking down TPPP3 on the apoptosis rate of RBL-2H3 cells induced by IgE (n=3);

[0030] Figure 8Western Blot and gray scale analysis results of Western Blot for detecting the expression of key signal proteins after knocking down TPPP3; wherein the Western Blot results from left to right are p-Lyn / Lyn, p-Syk / Syk, p-ERK1 / 2 / ERK1 / 2, p-p65 / p65, p-AKT / AKT protein expression of each group; the gray scale analysis results of the first row from left to right are p-Lyn / Lyn, p-ERK1 / 2 / ERK1 / 2, p-AKT / AKT, and the second row from left to right are p-Syk / Syk, p-p65 / p65 protein expression;

[0031] Figure 9 Effects of Indibulin on the proliferation activity of RBL-2H3 cells; (a): RBL-2H3 cell proliferation activity under different concentrations of Indibulin; (b): half inhibitory concentration of Indibulin on RBL-2H3 cells;

[0032] Figure 10 Effects of Indibulin on the degranulation morphology of RBL-2H3 cells under neutral red staining (bar = 100 μm);

[0033] Figure 11 Effects of Indibulin on IgE-induced β-Hex release from RBL-2H3 cells (n = 3);

[0034] Figure 12 Effects of Indibulin on IgE-induced HA release from RBL-2H3 cells (n = 3);

[0035] Figure 13 Effects of Indibulin on IgE-induced apoptosis of RBL-2H3 cells (n = 3);

[0036] Figure 14 Statistical effects of Indibulin on IgE-induced apoptosis rate of RBL-2H3 cells (n = 3);

[0037] Figure 15 Therapeutic effects of Indibulin on IgE-mediated PCA reaction in the ears of mice (n = 8); (a) representative images of ear PCA; (b) ear swelling degree; (c) Evans Blue exudation content in the ear;

[0038] Figure 16 Therapeutic effects of Indibulin on IgE-mediated PCA reaction in the back skin of mice (n = 8); (a) representative images of back skin PCA; (b) back skin swelling degree; (c) Evans Blue exudation content in the back skin;

[0039] Figure 17 Therapeutic effect of Indibulin on IgE-mediated PCA reaction in mouse toe (n=8); (a) representative images of toe PCA; (b) toe swelling degree; (c) toe Evans Blue extravasation content;

[0040] Figure 18 Toluidine blue staining results of mouse ear sections (bar = 100 μm);

[0041] Figure 19 HE staining results of mouse ear (bar = 100 μm). DETAILED DESCRIPTION

[0042] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be merely illustrative in nature and are not to be considered as limiting the scope of the present application, and are understood to be within the scope of the present application.

[0043] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, the use of the term "about" in relation to a value or a range of values is to be understood to include each individual value or intermediate value within the range. Unless otherwise stated, all technical and scientific terms and any acronyms used herein have the same meanings as commonly understood by one of ordinary skill in the art in the field of the application. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, preferred methods and materials are described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. In case of conflict, the content of the present specification will control.

[0044] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art in the field of the application. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, preferred methods and materials are described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. In case of conflict, the content of the present specification will control.

[0045] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples presented herein are illustrative only and should not be considered limiting.

[0046] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" or the like are open-ended and do not exclude additional, unrecited elements or method steps.

[0047] IgE-triggered mast cell degranulation plays a key role in type I hypersensitivity, and the inventors previously screened type I hypersensitivity-related genes by transcriptome sequencing. The inventors performed transcriptome sequencing on RBL-2H3 cells after activation of the IgE / FcεRI pathway, and obtained differential genes. Through GO analysis, KEGG enrichment analysis and PPI interaction network construction, the inventors found that cytoskeleton-related genes were significantly enriched in the differential genes. Through differential fold screening and combined with literature data, the inventors finally selected the significantly up-regulated TPPP3 gene as the research target, and analyzed the correlation between the expression of the TPPP3 gene and type I hypersensitivity. The specific research is as follows:

[0048] Example 1 Effect of inhibition of expression of TPPP3 on degranulation of RBL-2H3 cells

[0049] 1 Experimental materials

[0050] The siRNA-608, siRNA-108, siRNA-419 and Negative Control (NC) of the TPPP3 gene knockdown sequence were designed and synthesized by GenScript Pharmaceutical Technology Co., Ltd. (The sequences of each si-RNA strand (5'-3') are as follows). The RBL-2H3 cells were obtained from the Shanghai Cell Bank of the Chinese Academy of Sciences.

[0051] siRNA-608:

[0052] F: GACACUAUGACGCCAAGGUTT (SEQ ID NO: 1), R: ACCUUGGCGUCAUAGGUGCTT (SEQ ID NO: 2);

[0053] siRNA-108:

[0054] F: GGCAGCAAGCACUGACAUATT (SEQ ID NO: 3), R: UAUGUCAGUGCUUGCUGCCTT (SEQ ID NO: 4);

[0055] siRNA-419:

[0056] F: GCAAGGAACCAGCCAACAUTT (SEQ ID NO: 5), R: AUGUUGGCUGGUUCCUUGCTT (SEQ ID NO: 6);

[0057] Negative control:

[0058] F: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 7), R: ACGUGACACGUUCGGAGAATT (SEQ ID NO: 8).

[0059] 2 Experimental methods

[0060] 2.1 siRNA strand screening

[0061] 2.1.1 TP PP3-siRNA transfection

[0062] RBL-2H3 cells were seeded into a six-well plate at 3x10 5 cells per well. The cells were divided into knockdown groups: siRNA-608, siRNA-108, siRNA-419, and siRNA-FAM were transfected using TPPP3-siRNA at a final concentration of 80 nM; negative control group (NC group): negative control siRNA was transfected; blank control group (Control group): cells without any transfection treatment. Each group had three replicates. When the cell growth density reached 80%, transfection was performed, and the specific steps were as follows:

[0063] (1) The GP-transfect-Mate transfection reagent was equilibrated at room temperature before transfection.

[0064] (2) According to the experimental grouping, the transfection reagent and siRNA were diluted with culture medium according to the amount specified in the GP-transfect-Mate transfection reagent instructions, mixed well, and then allowed to stand for 15 min.

[0065] (3) When transfecting, the 6-well plate was changed, and then the transfection complex was added and mixed gently.

[0066] (4) The cells were incubated in an incubator, and after 6 h, the plate was changed to complete culture medium. The fluorescence state in the cells was observed after 24 h to verify whether the siRNA was transferred into the cells.

[0067] 2.1.2 RT-qPCR detection of TP PP3 expression

[0068] (1) Extraction of total RNA and reverse transcription

[0069] The cells transfected for 36 h in 2.1.1 were collected, and the RNA was extracted using a cell tissue RNA extraction kit (Takara RNAisoPlus). The RNA was then reverse transcribed into cDNA according to the steps in the FastQuant cDNA first strand synthesis kit (PrimeScript TM RT reagent Kit with gDNA Eraser) instructions. The above kits were purchased from Takara Company.

[0070] (3) Amplification of TP PP3 gene

[0071] According to the mRNA full sequence of the gene, the primer is designed as follows: TP PP3:

[0072] F: TGGAGGAGAGTTTCCGCAAGTTTG;

[0073] R: TCCGTCAGCCACCTTACAGTCC.

[0074] PCR reaction system: SYBR Premix Taq TM II 10 μL, PCR Forward Prime 0.8 μL, PCR Reverse Primer 0.8 μL, cDNA 1 μL, ddH2O Up to 20 μL.

[0075] Set the PCR reaction conditions on ice: pre-denaturation - 95°C, 30 s; 95°C, 5 s; 60°C, 30 s; 72°C, 30 s; 40 cycles. Melting analysis: 95°C, 15 s; 55°C, 15 s; 95°C, 15 s.

[0076] 2.1.3 Western blot detection of TP PP3 protein expression

[0077] Collect the cells transfected for 72 h in 2.1.1 and detect the protein expression. The steps are as follows:

[0078] According to the IP cell lysis solution instruction, extract the total protein, mix the total protein with SDS Loading buffer according to the proportion, 100°C water bath for 5 min, and store at -20°C for standby; according to the BCA protein concentration quantitative kit instruction, detect the protein concentration of each group; the steps of protein immunoblotting Western blot are as follows:

[0079] (1) Preparation of SDS-PAGE gel

[0080] According to the molecular weight of TP PP3 protein 15KDa, prepare 15% separation gel and 5% concentration gel, with the following formula

[0081] (a) 15% separation gel 5mL: distilled water 1.2mL, 30% Acr-Bis(29:1) 2.5mL, Gel buffer A 1.25mL, 10% APS 0.05mL, TEMED 0.003mL;

[0082] (b) 5% concentration gel 2mL: distilled water 0.67mL, 30% Acr-Bis(29:1) 0.33mL, Gel buffer A 1.0mL, 10% APS 0.02mL, TEMED 0.002mL;

[0083] (2) Electrophoresis and membrane transfer

[0084] Load 60 μg protein sample and protein Marker, set electrophoresis conditions: concentrated gel 70 V, run 40 min, separation gel 120 V, run 60 min. After electrophoresis, cut the PVDF membrane and soak in methanol for 2 min, cut the gel according to the Maker instructions, soak the filter paper, gel and PVDF membrane in the membrane transfer buffer, and then align them in the order of filter paper-gel-PVDF membrane-filter paper on the semi-dry membrane transfer instrument. Since the molecular weight of TPPP3 protein is small, the membrane transfer conditions are selected as follows: constant voltage 16 V, 20 min.

[0085] (3) Immunoreaction and imaging

[0086] Take out the PVDF membrane, block it with 5% skim milk powder at room temperature for 1 h. Incubate the PVDF membrane with TPPP3 (1:500) and β-actin (1:3000) primary antibodies at 4°C overnight. Then wash the membrane with TBST for 3 times, 10 min each time, and incubate the membrane with HRP-labeled secondary antibody (1:5000) at room temperature for 1 h. Then wash the membrane with TBST for 3 times, 10 min each time. Prepare ECL luminescent solution, drop it onto the PVDF membrane after removing the water, and develop it in the chemiluminescence imaging instrument. Use Image J to analyze the gray scale of the bands.

[0087] Select the siRNA chain with the most significant knockdown effect on TPPP3 for subsequent experiments.

[0088] 2.2 Effect of TPPP3 knockdown on the morphology of RBL-2H3 cells

[0089] Pave RBL-2H3 cells (8 x 10 4 per well) in a 24-well plate. Set up groups: normal group (Control); model group (Model); negative control group (NC); experimental group (TPPP3-siRNA); 3 replicate wells for each group. After 12 h, transfect siRNA with a final concentration of 80 nM in the negative control group and the experimental group, and perform the transfection as described in 2.1.1. After 1 d of transfection, wash with PBS buffer for 3 times, add 500 μL of DMEM containing 0.4 μg / mL DNP-IgE to each group except the Control group, and add the same amount of DMEM to the Control group. After 12 h, add 200 μL of PIPES buffer containing 10 μg / mL DNP-BSA to each group except the Control group, and add the same amount of PIPES buffer to the Control group. After 1 h, terminate the reaction by ice bath for 10 min. Add neutral red staining solution to each well, incubate at room temperature for 10 min, then wash with distilled water for 2 times, 2 min each time, and observe and take pictures under a microscope.

[0090] 2.3 Knockdown of TPPP3 on IgE-induced β-Hex release from RBL-2H3 cells

[0091] RBL-2H3 cells (8 x 10 4 cells / well) were plated in 24-well plates. The cell grouping, transfection steps and sensitization and challenge of cells were the same as 2.2. After the reaction was terminated by ice bath for 10 min, the supernatant of each group was collected and centrifuged at 12000 rpm at 4°C for 5 min. The cells in the Control group were lysed with 0.5% Triton X-100 on ice for 10 min as the total enzyme wells. 50 μL of supernatant of each group was incubated with 50 μL of 1 mM color developing solution at 37°C for 1 h, and then 200 μL of 0.1 mol / L stop solution was added to each well to terminate the reaction, and the absorbance at 405 nm was measured by a microplate reader.

[0092]

[0093] 2.4 Knockdown of TPPP3 on IgE-induced HA release from RBL-2H3 cells

[0094] RBL-2H3 cells (8 x 10 4 cells / well) were plated in 24-well plates. The cell grouping, transfection steps and sensitization and challenge of cells were the same as 2.2. After the reaction was terminated by ice bath for 10 min, the supernatant of each group was collected and centrifuged at 12000 rpm at 4°C for 5 min, and the operation was performed according to the instructions of the histamine ELISA detection kit.

[0095] 2.5 Knockdown of TPPP3 on IgE-induced apoptosis of RBL-2H3 cells

[0096] RBL-2H3 cells (8 x 10 4 cells / well) were plated in 24-well plates. The cell grouping, transfection steps and sensitization and challenge of cells were the same as 2.2. After the reaction was terminated by ice bath for 10 min, the operation was performed according to the instructions of the AO / EB staining kit, and the cell images of 5 fields were randomly taken under a fluorescence microscope. The number of cells of different colors was quantitatively analyzed using ImageJ software, and the apoptosis rate was analyzed and calculated using the following formula.

[0097]

[0098] 2.6 Effect of knockdown of TPPP3 on proteins in the IgE signaling pathway of RBL-2H3 cells during degranulation

[0099] Protein extraction, quantification and electrophoresis

[0100] RBL-2H3 cells (8 x 10 4Cells (number per well) were seeded into 24-well plates. Cell grouping, transfection, and sensitization / challenge procedures were the same as in 2.2. After terminating the reaction by incubating on ice for 10 min, proteins were extracted from each group. Protein extraction, quantification, and electrophoresis were performed as in 2.1.3.

[0101] 2.7 Statistical Analysis

[0102] Experimental data are expressed as mean ± SD. One-way ANOVA was used for pairwise comparisons. All statistical significance was set to **p < 0.05 and ***p < 0.01.

[0103] 3 Experimental Results

[0104] 3.1 Screening for TPPP3 gene knockdown and TPPP3-siRNA chain

[0105] 3.1.1 RT-qPCR detection of TPPP3 gene expression levels in each group

[0106] RNA quantification results showed ( Figure 1 Using cells transfected with negative control siRNA as a control, each TPPP3-siRNA chain showed varying degrees of knockdown, but siRNA-419 showed the best knockdown effect and the highest significance.

[0107] 3.1.2 Western blot analysis of TPPP3 protein expression levels in each group

[0108] From Western-Blot results Figure 2 It can be seen that the expression level of TPPP3 protein in each group is the lowest and the difference is significant, indicating that siRNA-419 has the best knockdown effect. Therefore, the following experiments will use siRNA-419 as the TPPP3-siRNA group for research.

[0109] 3.2 Effect of TPPP3 knockdown on RBL-2H3 cell morphology

[0110] After staining with neutral red, it can be seen under a microscope ( Figure 3 In the normal group, cells were generally spindle-shaped or fusiform, with intact morphology, good growth, and deep staining. In the model group, most cells began to swell and become rounded, with lighter staining; some cell membranes ruptured, and vacuoles appeared. In the TPPP3-siRNA group, after inhibiting the TPPP3 gene, cell swelling was reduced, and the cell shape became spindle-shaped, showing a significant improvement compared to the model group. The negative control siRNA group showed no difference from the model group.

[0111] 3.3 Effect of TPPP3 knockdown on IgE-induced β-Hex release from RBL-2H3 cells

[0112] The release of β-Hex in each group of cells was determined by Figure 4 It was found that the release rate of β-Hex in the normal group was 12.24%, and the release rate of β-Hex in the model group was 58.60%, which was significantly different from that of the normal group. After the TPPP3 gene was silenced, the release rate of β-Hex in RBL-2H3 cells decreased to 28.57%, which was significantly different from that of the model group. The results showed that inhibiting the TPPP3 gene could reduce the release of β-Hex in IgE-induced RBL-2H3 cells.

[0113] 3.4 Effect of TPPP3 Knockdown on IgE-induced Release of HA in RBL-2H3 Cells

[0114] The release of HA in each group of cells was determined by Figure 5 It was found that the release rate of HA in the normal group was 13.19%, and the release rate of HA in the model group was 24.40%, which was significantly different from that of the normal group. After the TPPP3 gene was silenced, the release rate of HA in RBL-2H3 cells decreased to 15.21%, which was significantly different from that of the model group. The results showed that inhibiting the TPPP3 gene could reduce the release of HA in IgE-induced RBL-2H3 cells.

[0115] 3.5 Effect of TPPP3 Knockdown on IgE-induced Apoptosis in RBL-2H3 Cells

[0116] In this experiment, AO / EB staining was used to double-stain live cells and necrotic cells. It was found that Figure 6 , Figure 7 It was found that most of the cells in the normal group emitted bright green fluorescence, and the cell morphology was spindle-shaped, with intact cell membranes, and the apoptosis rate was 1.91%. In the model group, there were more orange-red fluorescent dead cells, and the cell morphology was round, with structure rupture, and the apoptosis rate was 35.20%, which was significantly different from that of the normal group. After the TPPP3 gene was silenced, the apoptosis rate decreased to 18.64%, which was significantly different from that of the model group. The apoptosis rate of the negative control group was 39.53%, which was not significantly different from that of the model group. It was thus proved that after the TPPP3 gene was inhibited, the apoptosis after degranulation could be reduced.

[0117] 3.6 Effect of TPPP3 Knockdown on IgE Signaling Pathway Proteins in RBL-2H3 Cells During Degranulation

[0118] Figure 8The expression of p-Lyn / Lyn, p-Syk / Syk, p-ERK1 / 2 / ERK1 / 2, p-p65 / p65, and p-AKT / AKT proteins in each group was detected. FcεRI-mediated signaling is initiated by phosphorylation of the ITAM motifs in the cytoplasmic tails of the β and γ subunits of FcεRI. Tyrosine-phosphorylated ITAMs recruit Syk kinase, which, together with proximal Src protein tyrosine kinases (such as Fyn and Lyn) at the activated receptor, mediates phosphorylation and subsequent reorganization of scaffold proteins at the activated FcεRI complex. Therefore, we determined the expression of key signaling proteins Lyn and Syk by immunoblotting to verify whether TPPP3 regulates FcεRI-mediated signaling. Gray scale analysis showed that, compared with the model group, the expression of p-Lyn and p-Syk decreased significantly after knocking down the TPPP3 gene, suggesting that TPPP3 may regulate Lyn and Syk.

[0119] The signaling of the MAPK kinase pathway is also an important pathway for the generation and release of inflammatory factors in mast cell degranulation. Nuclear factor-kB (NF-kB) is an important nuclear transcription factor in cells, which is involved in the inflammatory response and immune response of the body, and can regulate apoptosis and stress response. Therefore, we detected the phosphorylation levels of important proteins ERK1 / 2 and p-65 in the MAPK kinase pathway and the NF-kB pathway. Compared with the model group, the expression of p-65 decreased significantly after inhibiting the TPPP3 gene. However, p-ERK1 / 2 did not change significantly.

[0120] Ca 2+ The non-dependent pathway (Fyn, Gab2, PI3K, RhoA, RasGRP1, Arf1, Nck2, DOCK5, Akt) is essential for microtubule and actin reorganization mediated by cell granule transport and fusion. Therefore, the phosphorylation of Akt protein was detected in this experiment. The results showed that, compared with the model group, the expression of p-Akt decreased significantly. Therefore, it is concluded that the inhibition of TPPP3 gene protein expression can also affect the phosphorylation of Akt protein, and thus affect the regulation of RBL-2H3 cell microtubules and mast cell degranulation.

[0121] Example 2 Effect of the microtubule inhibitor Indibulin inhibiting TPPP3 on type I hypersensitivity reaction

[0122] 1 Materials and methods

[0123] 1.1 Experimental reagents and instruments

[0124] Experimental animals: SPF grade 6-7 week old female Kunming mice were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd. with license number SCXK (Jing) 2019-0010.

[0125] Main experimental reagents: CCK-8 kit, purchased from Shengong Bioengineering Co., Ltd.; Indibulin, purchased from Shanghai Taoshu Biological Technology Co., Ltd.; Formamide, purchased from Shengong Bioengineering Co., Ltd.; Dexamethasone, purchased from Meilun Bio-technology Co., Ltd.; Evans blue, purchased from Shengong Bioengineering Co., Ltd.

[0126] 1.2 Experimental method

[0127] 1.2.1 Effect of Indibulin on the proliferation activity of RBL-2H3 cells

[0128] RBL-2H3 cells were inoculated in 96-well plates at 1×10 4 Blank group: no cells were inoculated, only DMEM; control group: cells were inoculated, no drug was given; Indibulin drug group (experimental group): cells were inoculated, and drugs were given (Indibulin was diluted with DMEM, and the final concentrations were 0.1, 0.5, 1, 5, 10, 25, and 50 nM, respectively). Five replicate wells were set for each sample. After 24 h, the old culture medium was discarded, and the cells were washed with PBS for 3 times. Then, 100 μL of DMEM containing different concentrations of Indibulin was added to each well. The next day, 10 μL of CCK-8 reagent was added to each well, and the cells were incubated in the incubator for 1 h. The absorbance value of each well was measured at 450 nm by using a microplate reader. The half maximal inhibitory concentration (IC 50 ) value was calculated by using GraphPad Prism software.

[0129]

[0130] 1.2.2 Effect of Indibulin on the morphology of RBL-2H3 cells during degranulation

[0131] RBL-2H3 cells (8×10 4RBL-2H3 cells were seeded in 24-well plates at a density of 2 x 105cells / well. The cells were divided into normal group (Control), model group (Model) and drug treatment group (Indibulin 1 nM, Indibulin 10 nM, dexamethasone (Dexa) 10 μM). After 24 h of culture, the old culture medium was discarded, and the cells were washed with PBS for 3 times. Except for the Control group, each group was sensitized with DMEM containing 0.4 μg / mL DNP-IgE overnight, and the Control group was added with the same amount of DMEM. After 12 h, the liquid was discarded, and the cells were washed with PBS for 2 times. The drug group was added with high and low concentrations of Indibulin and 10 μM Dexa (positive drug) for pre-incubation for 60 min. The liquid was discarded, and the cells were washed with PBS for 3 times. Then, except for the Control group, each group was added with PIPES buffer containing 0.4 μg / mL DNP-BSA, and the cells were stimulated at 37 °C for 60 min, and the reaction was terminated by ice bath for 10 min. Neutral red staining liquid was added to each well, and the cells were stained according to the neutral red staining procedure described in 2.2 of Example 1.

[0132] 1.2.3 Effect of Indibulin on IgE-induced release of β-Hex from RBL-2H3 cells

[0133] The cells were divided and treated as described in 1.2.2. After the stimulation was completed, the β-Hex was measured according to 2.3 of Example 1.

[0134] 1.2.4 Effect of Indibulin on IgE-induced release of HA from RBL-2H3 cells

[0135] The cells were divided and treated as described in 1.2.2. After the stimulation was completed, the HA was measured according to 2.4 of Example 1.

[0136] 1.2.5 Effect of Indibulin on IgE-induced apoptosis of RBL-2H3 cells

[0137] The cells were divided and treated as described in 1.2.2. After the stimulation was completed, the cells were observed by taking photos under a fluorescence microscope and counted by software according to 2.5 of Example 1.

[0138] 1.2.6 Effect of Indibulin on passive cutaneous anaphylaxis of mice

[0139] 1.2.6.1 Grouping of experimental animals

[0140] Forty Kunming mice were randomly divided into 5 groups: Indibulin low, medium and high concentration groups: 2 mg / kg, 5 mg / kg and 10 mg / kg; dexamethasone (Dexa, positive drug) group 10 mg / kg, normal group (Control), model group (Model), 8 mice in each group.

[0141] 1.2.6.2 Experimental animal sensitization

[0142] The mice were anesthetized with sodium pentobarbital, and the mice in each group except the Control group were injected with 0.5 μg of DNP-IgE intradermally in the right ear, intradermally on the back, and intradermally on the right toe, and the mice in the Control group were injected with the same volume of normal saline at the corresponding sites.

[0143] 1.2.6.3 Experimental animal administration

[0144] After 24 h, the mice in the Dexa and Indibulin groups were injected intraperitoneally with 200 μL of the corresponding drug dose according to the body weight of the mice, and the mice in the other groups were injected intraperitoneally with the same volume of normal saline.

[0145] 1.2.6.4 Experimental animal challenge

[0146] After 30 min of administration, the mice were injected intravenously with 200 μL of a challenge agent prepared from 0.5 mg of DNP-BSA and 1% Evans Blue except the Control group, and the mice were killed by cervical dislocation after 30 min of challenge.

[0147] The exudation and swelling of the ears and toes of the mice were photographed, and the ears of each mouse were cut at the same position to the same size, and the swelling was measured and recorded with a vernier caliper. The ears were then placed in 700 μL of formamide, soaked in a 63°C water bath overnight to extract the Evans Blue dye, and an equal amount of ear extract was taken from each sample, added to a 96-well plate, and the absorbance value was measured at 620 nm.

[0148] The skin on the back of the mice was taken, the exudation of Evans Blue in the skin was photographed, and the diameter of the blue spot was measured. The same size of the blue spot skin was taken at the same position, and then placed in 700 μL of formamide, soaked in a 63°C water bath overnight to extract the Evans Blue dye, and an equal amount of back skin extract was taken from each sample, added to a 96-well plate, and the absorbance value was measured at 620 nm.

[0149] The toes were cut at the same position on the ankle joint of the mice, photographed, and weighed on a balance. The toes were dried and the same weight of toes was taken at the same position, and then placed in 700 μL of formamide, soaked in a 63°C water bath overnight to extract the Evans Blue dye, and an equal amount of foot skin extract was taken from each sample, added to a 96-well plate, and the absorbance value was measured at 620 nm.

[0150]

[0151]

[0152] 1.2.7 Histological analysis of mouse ear

[0153] Mouse ears were removed, and 5μm thick paraffin sections were cut using a microtome and baked at 65℃ for 4.5 hours. The sections were then dewaxed in xylene, and hydrated in anhydrous ethanol, 95% ethanol, 90% ethanol, 80% ethanol, 70% ethanol, and distilled water. The cell nuclei were stained with hematoxylin for 3-8 minutes, washed with tap water, differentiated in 1% hydrochloric acid ethanol for a few seconds, rinsed with running water, blued with 0.6% ammonia solution, and rinsed with tap water. The cytoplasm was stained with eosin for 1-3 minutes, dehydrated again with ethanol, mounted, and then mounted with neutral resin. The sections were then photographed under an optical microscope.

[0154] Tissue sections were stained with 0.5% toluidine blue reagent for 30 minutes, rinsed with running water for 5 minutes, and photographed under an optical microscope.

[0155] 1.2.8 Statistical Analysis

[0156] Experimental data are expressed as mean ± SD. One-way ANOVA was used for pairwise comparisons using GraphPadPrism 7.00. Statistical significance was set at **p < 0.05 and ***p < 0.01.

[0157] 1.3 Experimental Results

[0158] 1.3.1 Effect of Indibulin on the Proliferative Activity of RBL-2H3 Cells

[0159] like Figure 9 As shown, after 24 hours of treatment with Indibulin, cell viability in all experimental groups reached over 90% at concentrations of 0–10 nM. At concentrations above 50 nM, it significantly inhibited cell proliferation, and the inhibitory effect increased with increasing concentration. The half-maximal inhibitory concentration (IC50) of Indibulin on RBL-2H3 cells was [not specified in the original text]. 50 The concentration was 42.07 nM. Based on the test results, subsequent experiments selected Indibulin concentrations of 1 and 10 nM as high and low concentration groups, respectively.

[0160] 1.3.2 Effects of Indibulin on the morphology of RBL-2H3 cells during degranulation

[0161] After staining with neutral red, it can be seen under a microscope ( Figure 10 In the normal group, cells were generally spindle-shaped or fusiform, with intact morphology, good growth, and deep cell staining. In the model group and the 1 nM Indibulin group, most cells began to swell and become rounded, with lighter staining; some cell membranes ruptured, and vacuoles appeared. In the 10 nM Indibulin group and the dexamethasone group, the degree of cell swelling was reduced, and the cell state was close to that of the normal group cells.

[0162] 1.3.3 Effect of Indibulin on IgE-induced release of β-Hex from RBL-2H3 cells

[0163] The effect of indibulin on cellular release of β-Hex is as follows: Figure 11 As shown, the β-Hex release rate in the normal group was 9.29%. After indibulin treatment, the release rates in the 1 nM group and the 10 nM group were 36.91% and 25.26%, respectively. The 10 nM group showed a significant difference from the 40.18% release rate in the model group. However, it also showed a certain difference from the 13.22% release rate in the dexamethasone group.

[0164] 1.3.4 Effect of Indibulin on IgE-induced HA release from RBL-2H3 cells

[0165] The effect of indibulin on the release of HA from cells is as follows: Figure 12 As shown, the HA release from normal cells was 13.81 ng / mL. After treatment with Indibulin, the release rates of the 1 nM group and the 10 nM group were 19.81 ng / mL and 16.45 ng / mL, respectively. The release rate of the 10 nM group was significantly different from that of the model group (40.18 ng / mL) and was close to that of the dexamethasone group (15.80 ng / mL).

[0166] 1.3.5 Effect of Indibulin on IgE-induced apoptosis in RBL-2H3 cells

[0167] Cells were stained with AO / EB and their morphology was observed under a microscope. Cell counts were also performed. Figure 13 , Figure 14 The results showed that the normal group cells had normal morphology and an extremely low apoptosis rate of 2.54%. The model group cells exhibited significant swelling and rupture, with an apoptosis rate of 35.02%. However, the presence of 1 nM and 10 nM indibulin significantly reduced cell swelling, with apoptosis rates of 33.21% and 17.09%, respectively. In the dexamethasone group, the cell state was close to that of the normal group, with an apoptosis rate of 8.98%. The apoptosis rate in the 10 nM indibulin group was significantly different from that in the model group (p<0.01).

[0168] 1.3.6 Effects of Indibulin on Passive Cutaneous Anaphylaxis in Mice

[0169] 1.3.6.1 Effect of Indibulin on PCA Response in Mouse Ears

[0170] like Figure 15, the diameter of blue spot and the degree of swelling of the ear of mice in the model group were significantly increased, and the diameter of blue spot of the ear of mice in the Indibulin administration group was reduced. The results of ear swelling measurement showed that the degree of ear swelling of the model group was 74.36%, which was significantly higher than that of the normal group 6.06%. After intraperitoneal injection of Indibulin, the degree of ear swelling of mice decreased to 69.44%, 55.56%, 42.42%, which was significantly lower than that of the model group. Consistent with the results of ear swelling, Indibulin inhibited the increased Evans Blue exudation of the ear of mice due to hypersensitivity. The amount of dye exuded at high dose (10 mg / kg) of Indibulin was significantly reduced. The amount of Evans Blue exudation decreased with the increase of the concentration of Indibulin, showing a dose-dependent manner.

[0171] 1.3.6.2 Effect of Indibulin on PCA reaction of mouse skin

[0172] As shown in the figure, Figure 16 , the diameter of blue spot of the skin of mice in the model group was significantly increased, and the diameter of blue spot of the skin of mice in the Indibulin administration group was reduced. The results of skin blue spot diameter measurement showed that the diameter of blue spot of the model group was 4.2 cm, which was significantly higher than that of the normal group 0 cm. After intraperitoneal injection of Indibulin, the diameter of blue spot of mice decreased to 3.9 cm, 3.33 cm, 2.1 cm, which was significantly lower than that of the model group. Consistent with the results of blue spot diameter, Indibulin inhibited the increased Evans Blue exudation of the skin of mice due to hypersensitivity. The amount of dye exuded at high dose (10 mg / kg) of Indibulin was significantly reduced, and the amount of Evans Blue exudation decreased with the increase of the concentration of Indibulin, showing a dose-dependent manner.

[0173] 1.3.6.3 Effect of Indibulin on PCA reaction of mouse toe

[0174] As shown in the figure, Figure 17 , the diameter of blue spot and the degree of swelling of the toe of mice in the model group were significantly increased, and the diameter of blue spot and the degree of swelling of the toe of mice in the Indibulin administration group were reduced. The results of toe swelling measurement showed that the degree of toe swelling of the model group was 65.17%, which was significantly higher than that of the normal group 2.98%. After intraperitoneal injection of Indibulin, the degree of toe swelling of mice decreased to 63.22%, 39.05%, 16.08%, which was significantly lower than that of the model group. Consistent with the results of toe swelling, Indibulin inhibited the increased Evans Blue exudation of the toe of mice due to hypersensitivity. The amount of dye exuded at high dose (10 mg / kg) of Indibulin was significantly reduced. The amount of Evans Blue exudation decreased with the increase of the concentration of Indibulin.

[0175] 1.3.7 Ear pathological staining

[0176] like Figure 18 As shown, after toluidine blue staining, vasodilation, significant thickening of the auricle, and loose and edematous subcutaneous tissue were observed in the ear sections of mice in the model group. In the magnified image, there was a significant increase in oval-shaped mast cells that appeared as deep blue-purple. In the Indibulin-treated group, the edema of the subcutaneous tissue and the number of mast cells in the ear of mice decreased in a dose-dependent manner.

[0177] like Figure 19 As shown, in the model group, after staining the ear sections of mice with hematoxylin and eosin (H&E), vasodilation, significant thickening of the auricle, loose and edematous subcutaneous tissue, and inflammatory cell infiltration were also observed. In the Indibulin-treated group, the edema and inflammatory infiltration of the subcutaneous tissue of the mouse ears decreased in a dose-dependent manner.

[0178] In summary, this invention investigated the effect of TPPP3 knockdown on RBL-2H3 cell degranulation through in vitro experiments. The TPPP3 gene was knocked down using siRNA, and cell morphology was observed using neutral red staining, apoptosis was detected using AO / EB staining, histamine (HA) was detected by ELISA, and β-aminohexosidase (β-HEX) release was detected by colorimetric assay. Results showed that silencing TPPP3 improved the morphological changes of RBL-2H3 cells during degranulation, reduced apoptosis, and decreased HA and β-HEX release. Immunofluorescence results showed that silencing TPPP3 inhibited microtubule aggregation during cell degranulation. Western blotting results revealed that silencing TPPP3 could regulate type I hypersensitivity by modulating the Lyn / Fyn, PI3K / AKT, and NF-κB signaling pathways upstream and downstream of the IgE / FcεRI pathway.

[0179] The application also uses in-vivo and in-vitro tests to study the effect of microtubule polymerization inhibitor Indibulin on hypersensitivity, uses CCK-8 reagent to determine the safe dose of Indibulin on cell effect, and selects 1nM and 10nM as the inhibiting concentration of Indibulin on degranulation. The results show that 10nM Indibulin can significantly improve the change of cell morphology during degranulation, inhibit cell apoptosis, and reduce the release amount of β-Hex and HA. The results of mouse PCA model show that Indibulin can significantly inhibit IgE-induced passive cutaneous anaphylaxis reaction such as ear, toe and back skin Evans blue exudation and tissue swelling. After hematoxylin-eosin and toluidine blue staining of ear tissue sections, it is found that Indibulin can significantly inhibit the expansion of tissue blood vessels, inflammatory cell infiltration and the increase of mast cells.

[0180] The application applies the previous transcriptome sequencing technology to screen the new protein molecule TPPP3 involved in mast cell degranulation, and studies the regulatory role and possible mechanism of TPPP3 in type I hypersensitivity by in-vivo and in-vitro administration of siRNA or Indibulin for inhibiting TPPP3, thereby providing experimental basis and scientific basis for revealing the pathogenesis of type I hypersensitivity and in-depth study of the role of TPPP3 in type I hypersensitivity.

[0181] The above-described embodiments are only used to describe the preferred modes of the application, and do not limit the scope of the application. Without departing from the design spirit of the application, various modifications and improvements of the technical solutions of the application made by those skilled in the art shall fall within the protection scope determined by the claims of the application.

Claims

1. Use of an inhibitor of TPPP3 in the manufacture of a medicament for the treatment of a type I hypersensitivity reaction, characterized in that, The inhibitor is siRNA interfering with expression of the TPPP3 gene; The nucleotide sequence of the siRNA is shown as SEQ ID NO: 5-6; The siRNA plays a role in treating type I hypersensitivity by improving morphological changes of mast cell degranulation, reducing cell apoptosis, reducing the release amount of histamine and beta-hexosaminidase of cells, and regulating signal pathways.

2. Use according to claim 1, characterized in that, The signal pathways include Lyn / Fyn, PI3K / AKT and NF-κB.

3. Use according to any one of claims 1-2, characterized in that, The type I hypersensitivity includes IgE-mediated type I hypersensitivity.

4. Use according to claim 1, characterized in that, The drug further comprises a pharmaceutically acceptable carrier.

5. Use according to claim 4, characterized in that, The carrier includes a surfactant.

6. Use according to claim 4, characterized in that, The carrier includes an emulsifier.

Images