Construction of a targeted DNA nanocarrier and its application in precise tumor gene therapy

By constructing a targeted DNA nanocarrier assembled from palindromic DNA components, the safety and efficiency issues of siRNA delivery vectors were resolved, achieving highly efficient targeted delivery and tumor-specific release of siRNA, significantly inhibiting tumor growth, and providing an effective nanoplatform for precision tumor gene therapy.

CN116870168BActive Publication Date: 2025-12-19FUZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310567942.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-19
Publication Date
2025-12-19
Estimated Expiration
2043-05-19

AI Technical Summary

Technical Problem

Existing siRNA delivery vectors suffer from immunogenicity, mutagenicity, and low transfection efficiency. In particular, non-viral vectors struggle to achieve safe and efficient tumor targeting and drug release when delivering siRNA.

Method used

By employing a targeted DNA nanocarrier assembled from palindromic DNA components, and introducing a targeting ligand and a sticky terminal tail, a carrier capable of specifically releasing siRNA into the cytoplasm was constructed, achieving tumor-targeted delivery through a GSH-stimulated loading mechanism.

Benefits of technology

It achieves efficient, stable delivery and specific release of siRNA, significantly inhibiting tumor growth and providing a nanoplatform for precise tumor gene therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application provides a construction of a targeted DNA nanocarrier and application of the targeted DNA nanocarrier in precise tumor gene therapy, and belongs to the technical field of nucleic acid nanomaterials. The construction of the targeted DNA nanocarrier is based on an assembling technology of 3D structural units which are stereoscopic growth in four directions and are raw materials of single nucleotides. The targeted DNA nanocarrier can efficiently load a gene therapy drug small interfering RNA (siRNA), specifically recognize tumor cells, and release the drug under the stimulation of high-concentration glutathione in cells, so as to inhibit the expression of PLK1 mRNA and protein and induce cancer cell apoptosis. The targeted DNA nanocarrier has the following characteristics: enhanced serum stability, specific targeting of cancer cells, and stimulative response release of the drug in the inside of the cancer cells, and is a tumor gene therapy method with application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of nucleic acid nanomaterials, and particularly relates to construction of a targeted DNA nanocarrier and application thereof in precise tumor gene therapy. BACKGROUND

[0002] RNA interference (RNAi) is considered to be very useful for treating intractable diseases, such as inflammation and cancer. As an alternative to traditional cancer treatment methods, such as surgical resection, chemotherapy and radiotherapy, RNAi can achieve an ideal anticancer effect by specifically inhibiting the expression level of post-transcriptional cancer-related gene products. By designing a corresponding interference RNA (siRNA) sequence to guide RISC to produce homologous mRNA in the cytoplasm, the silencing of the target gene of interest can be achieved. However, siRNA is susceptible to enzymatic degradation in the bloodstream, and a short plasma elimination half-life greatly reduces the possibility of siRNA penetrating complex biological barriers into cancer cells and guiding target mRNA cleavage. The lack of a safe and effective siRNA delivery carrier is a major obstacle to the transition of siRNA-based treatment methods to clinical applications. Therefore, many studies have contributed to the construction of nanocarriers for targeted delivery of siRNA drugs. So far, siRNA delivery carriers are mainly divided into two categories: viral vectors and non-viral vectors. High cell transfection efficiency is a significant advantage of viral vectors, but their immunogenicity and mutagenicity seriously limit their application. Compared with viral vectors, non-viral vectors are safer and more suitable for in vivo delivery of siRNA. However, non-viral vectors suffer from low transfection efficiency.

[0003] In the past few decades, many non-viral vectors have been developed, including lipids, dendrimers and inorganic nanoparticles. These delivery carriers improve the loading efficiency of siRNA, prolong the systemic circulation time, and enhance the tumor infiltration and accumulation. For example, the first siRNA drug approved by the US Food and Drug Administration for the treatment of multiple neuropathy, Onpattro (patisiran), uses a cationic lipid delivery system. However, due to delivery efficiency and safety issues, it is still a major challenge to construct a reliable siRNA carrier. The most commonly used non-viral vector (such as liposome) mainly relies on the cationic polymer component to compress siRNA to facilitate the delivery of siRNA into cells. However, high cationic charge can cause serious toxic side effects to normal tissues and accelerate the clearance of the carrier in the blood, resulting in insufficient gene drug delivery efficiency. Therefore, it is necessary to design an innovative non-cationic siRNA delivery system for gene therapy that is non-toxic, biocompatible and has precise tumor targeting properties.

[0004] Due to the unique properties of DNA nanostructures, such as good biocompatibility, predictable structure, editable functionality and convenient programmability, they show great potential in constructing non-cationic siRNA carriers. Recently, a variety of multifunctional DNA nano-carriers for siRNA delivery have been developed. For example, siRNA complexes, DNA tetrahedrons, spherical nucleic acids and DNA hydrogels. Unlike cationic nano-carriers, these negatively charged DNA assembled nano-carriers can perform tumor-targeted delivery through covalent coupling or non-covalent surface binding, rather than using electrostatic interactions. In particular, multivalent spherical nucleic acid nanoparticles exhibit excellent cellular uptake capacity due to their high binding affinity to cell surface scavenger receptors. However, previous reports of nano-materials delivering siRNA are often limited by cumbersome preparation steps, poor resistance to in vivo degradation, and lack of specific stimulus-induced cargo release mechanisms. For example, DNA origami-based nano-carriers require hundreds of carefully designed DNA strand components, which greatly increases experimental costs and complicates the design process. Therefore, it is necessary to develop a nano-carrier assembled from only a few DNA strands. Due to the unique property that palindromic oligonucleotides with the same base sequence can hybridize to each other, they are ideal candidates for reducing the number of DNA components to construct nano-carriers. In addition, due to the high local concentration of the introduced building blocks derived from palindromic fragments, the assembly efficiency can be significantly improved.

[0005] For the above reasons, the present application first verifies the feasibility of constructing a hierarchical spherical DNA nanostructure (SOPS3) by assembling a 3D structural unit from only one palindromic DNA component, and then by introducing targeting ligands and sticky-ended tails, develops an anti-degradation targeted DNA nano-carrier (Apt-CTPS3) that can encapsulate 1987 copies of siPLK1, a gene drug containing a disulfide bond. With the help of the targeted DNA nano-carrier, the loaded gene drug siPLK1 can be specifically transported to the cytoplasm and released 100% upon endogenous glutathione (GSH) reduction, and the GSH-stimulated siRNA drug-loaded targeted DNA nano-carrier can achieve efficient gene therapy by down-regulating the expression level of target PLK1 mRNA and corresponding protein at the cellular level, and significantly inhibit tumor growth in tumor-bearing nude mouse models, providing a promising nano-platform for precision tumor gene therapy. SUMMARY

[0006] The present application aims to provide a method for constructing a targeted DNA nano-carrier and its application in precision tumor gene therapy to solve the above problems.

[0007] To achieve the above object, the technical scheme adopted by the present application is as follows:

[0008] A construction method of a targeted DNA nanocarrier, which is to add a palindromic DNA sequence and a multifunctional DNA sequence into 1xTAE / Mg 2+ buffer, heated at 95℃ for 5 min, then naturally cooled to room temperature, and continued to react at room temperature for 1 h, to obtain the targeted DNA nanocarrier;

[0009] The palindromic DNA sequence is:

[0010] 5'-CTCTGAGCTCAGAGGTGTCTCGAGACACAAGAGGATCCTCTT-3',

[0011] The multifunctional DNA sequence is:

[0012] 5'-

[0013] CCTTGTGAAGTGTTTTTTTTCTCTGAGCTCAGAGGTGTCTCGAGACACAAGAGGATCCT CTTTTTTTTTTGCAGTTGATCCTTTGGATACCCTGG-3';

[0014] The molar ratio of the palindromic DNA sequence to the multifunctional DNA sequence is 1:1.

[0015] The 1xTAE / Mg 2+ buffer formula is: 40mM Tris, 20mM acetic acid, 2mM EDTA and 12.5mM MgAc2·4H2O; pH=7.4.

[0016] A targeted DNA nanocarrier obtained by the construction method.

[0017] The targeted DNA nanocarrier is used for preparing a drug-loaded composition for tumor gene therapy.

[0018] A drug-loaded composition comprising the targeted DNA nanocarrier and a drug-loaded substance.

[0019] The drug-loaded substance is an siRNA drug.

[0020] The technical principle of the present application is as follows:

[0021] As Figure 1As shown in A, the introduction of palindromic fragments into the middle of the DNA sequence can obtain DNA duplexes (double-stranded b domain, ds-b in the plan view) as the building blocks by intermolecular hybridization. In order to realize the hierarchical assembly mediated growth of DNA structure, four sticky ends (single-stranded fragments) pointing to four directions are designed to hybridize with each other. At the same time, in order to minimize the number of DNA components, the sticky ends are paired to have the same base sequence (i.e. palindromic sequence), obtaining two single-stranded a (ss-a) domains and two single-stranded c (ss-c) domains. Due to the spatial distance mediated by the structural rigidity of the ds-b domain, there is no interaction between the two identical palindromic sticky ends within one structural unit (referred to as no intra-unit interaction). In theory, by adjusting the number of base pairs (bp) of the ds-b domain in the longitudinal direction, the sticky ends can be accurately arranged in this structural unit, because after adding each bp, the helix rises about 0.34 nm, and the twist angle increases by about 34.3°. In this study, the ds-b domain is designed to have 14 base pairs to form a stable ds fragment, and the same palindromic sticky ends are staggered by 120° on the axial plane. Along this line, the structural units can self-assemble in a highly organized manner on different axial planes, producing 3D spherical DNA nanostructures made of only one kind of palindromic DNA component (referred to as SOPS3). Similar to the ds-b domain, ss-a and ss-c are also designed to have 14 base pairs. Only one annealing step is involved in the assembly process of SOPS3. On this basis, the palindromic DNA component is functionalized by adding aptamer MUC1 and sticky tail at the 3' end and 5' end of the palindromic DNA component, respectively. In addition, two spacers containing poly-T sequences (8 nt) are introduced to separate adjacent regions to ensure the flexibility and accessibility of the functional domains, thereby obtaining multifunctional DNA sequences. The palindromic DNA sequence works together with the multifunctional DNA sequence to obtain a targeted DNA nanocarrier. The gene drug siRNA modified with disulfide bonds is combined with the sticky tail on the multifunctional DNA sequence to obtain a drug-loaded targeted DNA nanocarrier. By utilizing the characteristics that the MUC1 aptamer can selectively recognize and bind to the glycoprotein mucin 1 highly expressed on tumor cells, the DNA nanocarrier can specifically recognize tumor cells, enter the cytoplasm, release the drug siRNA under the stimulation of GSH, inhibit the expression of target mRNA and related proteins, achieve gene silencing, and ultimately achieve the effect of precise tumor gene therapy.

[0022] The targeted DNA nanocarrier provided by the present application has the following advantages:

[0023] (1) The targeted DNA nanocarrier has good anti-degradation stability.

[0024] (2) The targeting DNA nanocarrier has high specificity and can distinguish cancer cells from healthy cells.

[0025] (3) The targeting DNA nanocarrier has a convenient drug loading method.

[0026] (4) The targeting DNA nanocarrier can be used for precise tumor gene therapy. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 : Design schematic diagram of constructing spherical DNA nanostructure. (A) Assembly process of spherical DNA nanostructure and two different views of 3D structure unit. (B) Schematic diagram of three palindromic fragments in palindromic DNA sequence and corresponding thermodynamic data.

[0028] Figure 2 : Design schematic diagram of two components (multifunctional DNA component and palindromic DNA component) for constructing targeting DNA nanocarrier. The multifunctional DNA component is composed of three functional regions, including single-stranded tail region, palindromic region and aptamer region. The palindromic DNA component only contains a palindromic region, which is composed of three different palindromic fragments (a, b and c).

[0029] Figure 3 : Atomic force microscope images of spherical DNA nanostructure (SOPS3), targeting DNA nanocarrier (Apt-CTPS3) and drug-loaded targeting DNA nanocarrier (Apt-CTPS3-siPLK1). The scale bar is 100 nm.

[0030] Figure 4 : Analysis of tumor cell-specific targeting ability of drug-loaded targeting DNA nanocarrier. The first column is the cell nucleus dye Hoechst channel image (405 nm); the second column is the drug siRNA channel image labeled with FAM fluorescent group (488 nm); the third column is the targeting DNA nanocarrier channel image labeled with Cy5 fluorescent group (638 nm), and the fourth column is the superimposed image.

[0031] Figure 5 : Resistance of drug-loaded targeting DNA nanocarrier to FBS degradation.

[0032] Figure 6 : Analysis of the ability of drug-loaded targeting DNA nanocarrier to silence target genes in cancer cells. (A) Real-time fluorescence quantitative evaluation of the expression level of PLK1 mRNA in MCF-7 cells treated with different drug-loaded siPLK1 nanomaterials. (B) Western blot analysis of the expression level of PLK1 protein in MCF-7 cells treated with different drug-loaded siPLK1 nanomaterials. DETAILED DESCRIPTION

[0033] In order to make the content of the present application more convenient to understand, the technical solutions of the present application are further described below in combination with specific embodiments. However, the following examples are only examples of the present application and do not represent the scope of the protection of the present application. The scope of the protection of the present application is subject to the claims.

[0034] The DNA, siRNA and primer sequences involved in the following examples are as follows:

[0035] Palindromic DNA sequence:

[0036] 5'-CTCTGAGCTCAGAGGTGTCTCGAGACACAAGAGGATCCTCTT-3';

[0037] Multifunctional DNA sequence:

[0038] 5'-CTCTGAGCTCAGAGGTGTCTCGAGACACAAGAGGATCCTCTT-3';

[0039] CCTTGTGAAGTGTTTTTTTTCTCTGAGCTCAGAGGTGTCTCGAGACACAAGAGGATCCTCTTTTTTTTTTGCAGTTGATCCTTTGGATACCCTGG-3';

[0040] siPLK1-sense: 5'-UAAGGAGGGUGAUCUUCUUCAdTdT-3',

[0041] siPLK1 antisense-Linker:

[0042] 5'-CACTTCACAAGG-s-s-UAAGGAGGGUGAUCUUCUUCAdTdT-3';

[0043] Specific primers for qRT-PCR amplification of PLK1:

[0044] PLK1-forward:

[0045] 5'-AGCCTGAGGCCCGATACTACCTAC-3',

[0046] PLK1-reverse:

[0047] 5'-ATTAGGAGTCCCACACAGGGTCTTC-3';

[0048] Specific primers for qRT-PCR amplification of GAPDH:

[0049] GAPDH-forward:

[0050] 5'-TTCACCACCATGGAGAAGGC-3',

[0051] GAPDH-reverse:

[0052] 5'-GGCATGGACTGTGGTCATGA-3'.

[0053] The 1×TAE / Mg 2+ buffer formula is: 40mM Tris, 20mM acetic acid, 2mM EDTA and 12.5mM MgAc2·4H2O; pH = 7.4.

[0054] Example 1

[0055] A preparation method of a spherical DNA nanostructure, comprising the following steps:

[0056] 2μL of 10μM palindromic DNA sequence is added to 18μL of 1×TAE / Mg 2+ buffer, heated at 95℃ for 5min, then slowly cooled to room temperature, and continue to react at room temperature for 1h to obtain the spherical DNA nanostructure (SOPS3).

[0057] Example 2

[0058] A preparation method of a targeted DNA nano-carrier, comprising the following steps:

[0059] 2μL of 10μM palindromic DNA sequence and 2μL of 10μM multifunctional DNA sequence are added to 16μL of 1×TAE / Mg 2+ buffer, heated at 95℃ for 5min, then slowly cooled to room temperature, and continue to react at room temperature for 1h to obtain the targeted DNA nano-carrier (Apt-CTPS3).

[0060] Example 3

[0061] A preparation method of a drug-loaded targeted DNA nano-carrier, comprising the following steps:

[0062] (1) 2μL of 10μM palindromic DNA sequence and 2μL of 10μM multifunctional DNA sequence are added to 16μL of 1×TAE / Mg 2+ buffer, heated at 95℃ for 5min, then slowly cooled to room temperature, and continue to react at room temperature for 1h to obtain the targeted DNA nano-carrier (Apt-CTPS3);

[0063] (2) 2 μL of 10 μM siPLK1-sense and 2 μL of 10 μM siPLK1 antisense-Linker were added into 16 μL of 1 × TAE / Mg 2+ buffer, and heated at 95 °C for 5 min, then slowly cooled to room temperature, and continued to react at room temperature for 1 h to obtain siRNA drug;

[0064] (3) 20 μL of the targeting DNA nanocarrier obtained in step (1) and 20 μL of the siRNA drug obtained in step (2) were mixed uniformly, and incubated at room temperature for 2 h to obtain the siRNA drug-loaded targeting DNA nanocarrier (Apt-CTPS3-siPLK1).

[0065] Example 4

[0066] A preparation method of a drug-loaded nanocarrier assembled by a multifunctional DNA sequence, comprising the following steps:

[0067] (1) 2 μL of 10 μM multifunctional DNA sequence was added into 18 μL of 1 × TAE / Mg 2+ buffer, and heated at 95 °C for 5 min, then slowly cooled to room temperature, and continued to react at room temperature for 1 h to obtain DNA nanocarrier (Apt-PS3t);

[0068] (2) 2 μL of 10 μM siPLK1-sense and 2 μL of 10 μM siPLK1 antisense-Linker were added into 16 μL of 1 × TAE / Mg 2+ buffer, and heated at 95 °C for 5 min, then slowly cooled to room temperature, and continued to react at room temperature for 1 h to obtain siRNA drug;

[0069] (3) 20 μL of the DNA nanocarrier obtained in step (1) and 20 μL of the siRNA drug obtained in step (2) were mixed uniformly, and incubated at room temperature for 2 h to obtain the drug-loaded nanocarrier assembled by the multifunctional DNA sequence (Apt-PS3t-siPLK1).

[0070] Example 5

[0071] A preparation method of a drug-loaded targeting DNA nanocarrier without disulfide bond, comprising the following steps:

[0072] (1) 2 μL of 10 μM multifunctional DNA sequence was added into 18 μL of 1 × TAE / Mg 2+ buffer, and heated at 95 °C for 5 min, then slowly cooled to room temperature, and continued to react at room temperature for 1 h to obtain DNA nanocarrier (Apt-PS3t);

[0073] (2) 2 μL of 10 μM siPLK1-sense and 2 μL of 10 μM siPLK1 antisense-Linker (without disulfide bond) were added into 16 μL of 1 × TAE / Mg 2+ buffer, heated at 95 °C for 5 min, then slowly cooled to room temperature, and continued to react at room temperature for 1 h to obtain siRNA drug;

[0074] (3) 20 μL of DNA nanocarrier obtained in step (1) and 20 μL of siRNA drug obtained in step (2) were mixed uniformly, incubated at room temperature for 2 h to obtain drug-loaded targeted DNA nanocarrier without disulfide bond (Apt-PS3t-siPLK1-N).

[0075] Example 6

[0076] A preparation method of drug-loaded liposome, comprising the following steps:

[0077] (1) 2 μL of 10 μM siPLK1-sense and 2 μL of 10 μM siPLK1 antisense were added into 16 μL of 1 × TAE / Mg 2+ buffer, heated at 95 °C for 5 min, then slowly cooled to room temperature, and continued to react at room temperature for 1 h to obtain unmodified siRNA drug;

[0078] (2) 20 μL of siRNA drug obtained in step (1) and 0.8 μL of transfection reagent Lip8000 were mixed uniformly, reacted at room temperature for 1 h to obtain drug-loaded liposome (Lip8000-siPLK1).

[0079] Atomic force microscopy was used to characterize the morphology of SOPS3, Apt-CTPS3, and Apt-CTPS3-siPLK1. The specific steps are as follows: 10 μL of prepared SOPS3, Apt-CTPS3, and Apt-CTPS3-siPLK1 were diluted 10 times with 1 × TAE / Mg 2+ buffer, 15 μL of the diluted solution was added dropwise onto a mica sheet, and the mica sheet was placed at room temperature for 20 min; then, the mica sheet was washed with 100 μL of ddH2O three times and dried under nitrogen; finally, MultiMode 8 atomic force microscope (Bruker, Germany) was used to characterize the morphology of each sample. Atomic force imaging results show that Figure 3 SOPS3, Apt-CTPS3, and Apt-CTPS3-siPLK1 are all spherical structures, and the size gradually increases.

[0080] The tumor cell-specific targeting ability of Apt-CTPS3-siPLK1 was analyzed using a laser confocal microscope, and the specific steps were as follows: human breast cancer cells (MCF-7 cells) and human normal liver cells (L02 cells) were inoculated on a 24-well plate containing 500 μL of DMEM complete medium (containing 10% FBS and 1% penicillin-streptomycin) respectively, and cultured at 37°C in a humidified environment containing 5% CO2; after 24 h of culture, the old culture medium was removed, and the cells were washed with PBS three times; then, 80 μL of the prepared drug-loaded targeted DNA nanocarrier was added to the wells with MCF-7 cells and L02 cells, respectively, and 420 μL of DMEM medium (without FBS and penicillin-streptomycin) was added. After incubation of the carrier with the cells at 37°C for 2 h, the cells were washed with PBS three times, and the cells were fixed with 4% paraformaldehyde at 37°C for 15 min. After washing with PBS buffer three times again, the cell nuclei were stained with 300 μL of Hoechst 33342 solution (10 μg / mL) for 10 min. Finally, the cells were washed with PBS buffer, and the cover glass with cells was inverted onto a microscope glass slide pretreated with an anti-fluorescence quencher. The uptake of DNA nanocarriers by cells was analyzed using a Leica SP8 laser scanning confocal microscope. The confocal results show that Figure 4 Cy5 fluorescence representing Apt-CTPS3 and FAM fluorescence representing siPLK1 can be observed in MCF-7 cells, while no Cy5 fluorescence and FAM fluorescence can be observed in L02 cells, which means that Apt-CTPS3-siPLK1 can actively enter the inside of target MCF-7 cells but not non-target L02 cells, indicating that the Apt-CTPS3-siPLK1 designed in the application has tumor cell-specific targeting ability.

[0081] Apt-CTPS3-siPLK1 was incubated with fetal bovine serum, and its stability was evaluated using denaturing polyacrylamide gel electrophoresis, and the specific steps were as follows: in order to explore the stability of the drug-loaded targeted DNA nanocarrier in fetal bovine serum, Apt-CTPS3-siPLK1 (final concentration 500 nM) was mixed with 2 μL of fetal bovine serum (final concentration 10%, v / v) uniformly, and incubated at 37°C for 0 h, 1 h, 2 h, 4 h, 6 h and 8 h respectively, to obtain a reaction mixture solution, and the gel sample was prepared by mixing 10 μL of the reaction mixture solution with 10 μL of 2x loading buffer, and the stability of the drug siRNA in the nanocarrier was evaluated by 10% denaturing polyacrylamide gel electrophoresis. The stability evaluation results show that Figure 5), the naked drug siRNA without Apt-CTPS3 as a protective medium after 10% fetal bovine serum treatment was completely degraded in 1 h of incubation, losing the drug effect, while the siRNA in Apt-CTPS3-siPLK1 still existed at 8 h, indicating that Apt-CTPS3 can enhance the stability of drug siRNA in fetal bovine serum, which is conducive to the application in complex biological environment.

[0082] The ability of Apt-CTPS3-siPLK1 to silence target genes in cancer cells was evaluated by real-time fluorescence quantitative (qRT-PCR) and Western Blot analysis, and the specific steps were as follows: (1) qRT-PCR evaluation of the expression level of PLK1 mRNA in target MCF-7 cells: first, MCF-7 cells were cultured in 6-well plates at a density of 4 x 10 5 cells / well at 37°C for 24 hours. When grown to about 80%, the MCF-7 cells were washed with PBS three times and incubated with different siRNA-loaded materials at a final concentration of 200 nM siPLK1, including naked drug siPLK1, nanocarriers assembled by multifunctional DNA sequences (Apt-PS3t-siPLK1), drug-loaded targeting DNA nanocarriers without disulfide bonds (Apt-CTPS3-siPLK1-N), drug-loaded targeting DNA nanocarriers (Apt-CTPS3-siPLK1), and drug-loaded liposomes (Lip8000-siPLK1), with PBS as a control. After 2 hours of incubation, DMEM complete medium was used to replace the DMEM culture solution, and the incubation was continued for 46 hours. Subsequently, the cells were washed with PBS buffer three times, total RNA was extracted using a Trizol kit (Invitrogen), the total RNA of each sample was uniformly adjusted to 1 μg, cDNA was obtained by reverse transcription using an Evo M-MLV RT Kit (Accurate Biotechnology (Hunan) Co., Ltd), and then qPCR amplification was performed on a SYBR Green Premix ProTag HS qPCR Kit in a CFX96 Real-Time PCR Detection System (Bio-RAD, Singapore). The expression level of PLK1 mRNA was calculated by 2 TM -ΔΔCt ​Methods: The expression level of PLK1 mRNA in each sample was estimated, and GAPDH was selected as an internal reference. (2) Western Blot evaluation of the expression level of PLK1 protein in target MCF-7 cells: MCF-7 cells were inoculated in a 6-well plate and incubated at 37°C in a humidified environment with 5% CO2 for 24 hours, then the DMEM complete medium was removed, and different drug-loaded materials were added respectively and incubated for 2 hours, PBS was used as a control, fresh DMEM complete medium was used to replace the old culture medium and incubated for 46 hours, then the cells were washed with PBS three times, and the cells were lysed with 100 μL of RIPA lysis buffer containing 1% PMSF (phenylmethanesulfonyl fluoride) on ice for 15 minutes, the total protein in each sample was obtained by collecting the supernatant after centrifuging the cell lysate (4°C, 14000 rpm, 20 min), and quantified by BCA protein detection kit, the total amount of protein in each sample was adjusted to 5 μg / μL using PBS buffer, electrophoretic separation was performed by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), after protein transfer to polyvinylidene fluoride (PVDF) membrane, the membrane was blocked by incubating in 5% skim milk solution (prepared in 1xTBST buffer containing 1.5M NaCl, 20mM Tris-HCl and 0.1% Tween-20) for 2 hours, adding primary antibody PLK1 mouse monoclonal antibody and β-actin rabbit monoclonal antibody, and incubating overnight at 4°C with gentle shaking, followed by the introduction of horseradish peroxidase (HRP) labeled secondary antibody, and incubating at room temperature for 2 hours, after washing three times with 1xTBST buffer, the membrane was stained with ECL working solution for 2 minutes, and the expression level of target protein (PLK1 and β-actin) was analyzed by XRS imaging system. TM XRS imaging system analyzes the expression level of target protein (PLK1 and β-actin). The results of qRT-PCR show that Figure 6 A), Apt-CTPS3-siPLK1-N, Lip8000-siPLK1 and Apt-CTPS3-siPLK1 groups all inhibit the expression of target PLK1 mRNA in MCF-7 cells, and the inhibition efficiency of Apt-CTPS3-siPLK1 group is slightly higher than that of the other two groups, which shows that the designed Apt-CTPS3-siPLK1 can effectively silence the target gene and inhibit the expression of PLK1 mRNA. Similarly, the results of Western Blot evaluation show that Figure 6 B), Apt-CTPS3-siPLK1-N, Lip8000-siPLK1 and Apt-CTPS3-siPLK1 groups all inhibit the expression of target PLK1 protein in MCF-7 cells, which shows that the designed Apt-CTPS3-siPLK1 of the application can effectively silence the target gene and inhibit the expression of PLK1 protein.

[0083] The above merely describes preferred embodiments of the present application, and any equivalent changes and modifications made within the scope of the present application should be included in the scope of the present application.

Claims

1. A method for constructing a targeted DNA nanocarrier, characterized by: The palindromic DNA sequence and the multifunctional DNA sequence are added into 1 × TAE / Mg 2+ buffer, heated at 95℃ for 5 min, naturally cooled to room temperature, and continuously reacted at room temperature for 1 h to obtain the targeted DNA nanocarrier. The palindromic DNA sequence is: 5'-CTCTGAGCTCAGAGGTGTCTCGAGACACAAGAGGATCCTCTT-3', The multifunctional DNA sequence is: 5'-CCTTGTGAAGTGTTTTTTTTCTCTGAGCTCAGAGGTGTCTCGAGACACAAGAGGATCCTCTTTTTTTTTTGCAGTTGATCCTTTGGATACCCTGG-3'.

2. The construction method of claim 1, wherein: The molar ratio of the palindromic DNA sequence to the multifunctional DNA sequence is 1:

1.

3. The construction method of claim 1, wherein: The 1 x TAE / Mg 2+ The buffer formula is: 40 mM Tris, 20 mM acetic acid, 2 mM EDTA and 12.5 mM MgAc2-4H2O; pH = 7.

4.

4. A targeted DNA nanocarrier obtained by the construction method of claim 1.

5. Use of the targeted DNA nanocarrier of claim 4 in the preparation of a drug-loaded composition for tumor gene therapy.

6. A drug-loaded composition, characterized by: The targeted DNA nanocarrier of claim 4 and a drug-loaded substance; the drug-loaded substance is an siRNA drug.