A xenotransplantation donor pig without DCUN1D3 gene expression and preparation method thereof

Abstract

The present invention provides a xenotransplantation donor pig that does not express the DCUN1D3 gene and a preparation method thereof. The DCUN1D3 gene can cause the risk of xenogeneic immune rejection. The DCUN1D3 gene is knocked out using the CRISPR / Cas9 system, and it is verified that the lack of DCUN1D3 gene expression can effectively reduce the binding ability of the donor pig's organs, tissues and / or cells with the recipient's IgG and IgM, improve the ability of the donor pig's organs, tissues and / or cells to resist the recipient's complement-mediated cytotoxicity, and prolong the survival time of the recipient of the donor pig's organs, tissues and / or pig cells.

Description

Technical Field

[0001] The present application belongs to the field of animal genetic engineering, and specifically relates to a xenotransplantation donor pig that does not express the DCUN1D3 gene and a preparation method thereof. Background Art

[0002] Organ transplantation is an effective treatment for patients with end-organ failure and is widely used clinically. However, it is limited by the shortage of human organ donors. Xenotransplantation, in which organs from another species are completely substituted for living organs, can fundamentally address organ supply issues once activated, making it a highly anticipated solution. Numerous studies have demonstrated that miniature pig organs, as xenotransplantation animal models, are morphologically and genetically similar to those of humans. The Yucatán and Göttingen miniature pigs are particularly well-used experimental animal models, yielding numerous research findings. However, current research indicates that miniature pig organ transplantation into humans can result in significantly more severe immune rejection than autologous or allogeneic transplants. This is due to numerous unknown risk factors for immune rejection, including the presence of foreign genes that can cause rejection and affect the long-term survival of pig tissues or organs after transplantation.

[0003] Current research on the DCUN1D3 gene is as follows: DCUN1D3 (Defective in Cullin Neddylation 1 Domain Containing 3) is a protein localized to the cell membrane and nucleus and involved in UVC response. DCUN1D3 regulates cell cycle progression and cell survival under conditions of DNA damage through the serum response element (SRE) pathway. DCUN1D3 significantly upregulates SRE activity, and inhibiting endogenous DCUN1D3 expression can protect cells from damage-induced apoptosis. Summary of the Invention

[0004] Research conducted by the present invention has found that the DCUN1D3 gene can cause the risk of xenotransplant rejection. However, the absence of DCUN1D3 gene expression can effectively reduce the ability of donor tissues and / or organ cells to bind to recipient IgG and IgM, improve their ability to resist complement-mediated cytotoxicity, and prolong the survival of donor tissues and / or organs after xenotransplantation. The present invention provides a xenotransplantation donor pig whose organs, tissues, or cells do not express the DCUN1D3 gene, and whose recipient is a human.

[0005] The DCUN1D3 gene non-expression described in the present invention can be achieved by gene knockout, gene knock-in, point mutation, deletion mutation, or a combination thereof.

[0006] The non-expression of the DCUN1D3 gene described in the present invention can be achieved by gene silencing.

[0007] The gene knockout described in the present invention is achieved by the CRISPR-Cas9 gene knockout system. The system includes a DCUN1D3 gene knockout vector, including vector one and vector two. The vector one is connected to sgRNA1, and the specific targeting sequence of the sgRNA1 is CTTAACAGAAGCCAAACAAG; the vector two is connected to sgRNA2, and the specific targeting sequence of the sgRNA2 is AAGTCTCT TCGATACCTTTG.

[0008] The method for constructing the DCUN1D3 gene knockout vector of the present invention is as follows:

[0009] The nucleotide sequence of the gene encoding the synthesized sgRNA1 is shown in SEQ ID NO. 1, and its complementary strand is shown in SEQ ID NO. 2. The single-stranded sgRNA DNA sequences are then annealed to form sgRNA1 oligonucleotide chains; the oligonucleotides are then ligated into the PX330 plasmid vector;

[0010] The nucleotide sequence of the gene encoding the synthesized sgRNA2 is shown in SEQ ID NO.3, and its complementary chain is shown in SEQ ID NO.4. The single-stranded sgRNA DNA sequence is then annealed to form an sgRNA2 oligonucleotide chain; the oligonucleotide is then ligated into the PX330 plasmid vector.

[0011] The DCUN1D3 gene knockout vector of the present invention is introduced into transformed cells, and the transformed cells are used to prepare donor pigs for xenotransplantation. The COP1 gene is not expressed in the organs, tissues or cells of the donor pigs.

[0012] The present invention also provides a method for preparing a xenotransplantation donor, comprising transplanting the transformed cells into a denuclearized egg cell to form a nuclear transplanted egg, and then transplanting the nuclear transplanted egg into the fallopian tube of a surrogate mother.

[0013] The present invention also provides a method for delaying, reducing or preventing rejection, separation or adverse reactions to xenotransplanted organs or tissues in human recipients, wherein the method comprises genetically modifying the DCUN1D3 gene of a donor or a donor tissue or organ so that the DCUN1D3 gene is not expressed in the pig tissue, pig organ or pig cell of the donor pig.

[0014] The xenotransplantation donor pig organ of the present invention includes liver, lung, kidney or skin.

[0015] The xenotransplantation donor pig tissue of the present invention includes nerves.

[0016] The beneficial effects are as follows:

[0017] The present invention discovers for the first time that the DCUN1D3 gene can cause the risk of xenotransplant rejection. Based on this, a xenotransplant donor is provided, in which the DCUN1D3 gene is not expressed in the xenotransplant donor through gene knockout or gene silencing. The DCUN1D3 gene is not expressed, which can effectively reduce the binding ability of donor tissue and / or organ cells to human recipient IgG and IgM, improve the ability of donor tissue and / or organ cells to resist complement-mediated cytotoxicity of human recipients, and prolong the survival time of donor tissue and / or organ after xenotransplantation.

[0018] The present invention also uses the CRISPR / Cas9 system to design dual sgRNA to knock out the DCUN1D3 gene. The obtained gene knockout cell line can be used as a donor for somatic cell nuclear transplantation. After DCUN1D3 knockout, the binding ability of pig kidney cells to human IgG and IgM can be effectively reduced, and the ability of pig kidney cells to resist human complement-mediated cytotoxicity can be improved, providing a favorable research tool for in-depth exploration of the biological function of the DCUN1D3 gene.

[0019] Knockout of the risk factor DCUN1D3 gene identified in the present invention increases the probability of xenogeneic cell survival and further improves the feasibility of xenotransplantation. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a diagram for identifying positive clone cells with DCUN1D3 gene knockout;

[0021] Figure 2 This is a graph showing the cell survival of wild pig kidney cells and DCUN1D3 knockout pig kidney cells after incubation with human serum;

[0022] Figure 3 This is a graph showing the binding ability of wild pig kidney cells and DCUN1D3 knockout pig kidney cells to human IgG and IgM. DETAILED DESCRIPTION

[0023] The present invention is further described by way of examples below, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or alteration of the present invention that can be easily implemented by a person skilled in the art will fall within the scope of the claims of the present invention.

[0024] Example 1: Construction of DCUN1D3 gene knockout vector.

[0025] DCUN1D3 gene knockout in porcine kidney cells was achieved using the CRISPR / Cas9 system, using sgRNAs including sgRNA1 and sgRNA2. The DNA sequence of sgRNA1 is shown in SEQ ID NO: 1, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 2; the DNA sequence of sgRNA2 is shown in SEQ ID NO: 3, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 4.

[0026] Two sgRNA sequences targeting the porcine DCUN1D3 gene (NCBI accession number: 100525983) were designed. The four single-stranded sgRNA DNA sequences were annealed to form two oligonucleotide chains targeting different sites of the porcine DCUN1D3 gene; these oligonucleotides were then ligated into the PX330 plasmid vector.

[0027] sgRNA-F1 sequence: 5-CACCCTTAACAGAAGCCAAACAAG-3; SEQ ID NO: 1 sgRNA-R1 sequence: 5-AAACCTTGTTTGGCTTCTGTTAAG-3; SEQ ID NO: 2 sgRNA-F2 sequence: 5-CACCAAGTCTCTTCGATACCTTTG-3; SEQ ID NO: 3 sgRNA-R2 sequence: 5-AAACCAAAGGTATCGAAGAGACTT-3. SEQ ID NO: 4

[0028] Example 2: Preparation of DCUN1D3 gene knockout pig kidney cells.

[0029] After sequencing and verifying the constructed pair of sgRNA expression vectors, the target plasmids were extracted and ethanol precipitated. The purified sgRNA expression vectors at a certain concentration were introduced into pig kidney cells via electroporation and cultured for 12 hours before the medium was changed. After 72 hours, the genome of each cell group was extracted and cell clones were obtained by limiting dilution. PCR reactions were then performed using specific primers. The PCR products were analyzed by agarose gel electrophoresis or sequencing, and the sgRNA cleavage of the cells was evaluated by sequencing peak analysis. Figure 1 Obtain positive pure and knockout clones.

[0030] Example 3: Detecting the resistance of DCUN1D3 knockout pig kidney cells to human complement-mediated cytotoxicity.

[0031] When the confluence of wild-type pig kidney cells and DCUN1D3 knockout pig kidney cells reached approximately 70%, human serum was diluted in DMEM at a ratio of 1:3 and incubated with the cells. After 45 minutes, the supernatant was discarded, the cells were washed twice with PBS, and then stained with PI propidium iodide for 10 minutes. Subsequently, cell death was detected by flow cytometry. Figure 2 : Compared with PK cells, after incubation with 75% serum, DCUN1D3 gene knockout cells can significantly reduce the toxicity of human serum to pig cells.

[0032] Example 4: Detecting the binding ability of DCUN1D3 knockout pig kidney cells to human IgG and IgM.

[0033] Trypsinize wild-type pig kidney cells and DCUN1D3 knockout pig kidney cells into a 1.5 mL centrifuge tube and wash twice with PBS. Dilute human serum inactivated at 56°C for 1 hour with PBS at a ratio of 1:4 and incubate the cells at room temperature. After 30 minutes, wash twice with PBS and add 1:200 diluted human IgG or IgM fluorescently labeled antibodies to the cells and incubate at room temperature for 30 minutes. After washing with PBS, flow cytometry was used to detect the binding capacity of DCUN1D3 knockout pig kidney cells to human IgG and IgM. Figure 3 : Compared with PK cells, the binding of DCUN1D3 gene knockout cells to human IgG or IgM was significantly reduced.

[0034] The above examples show that knocking out the DCUN1D3 gene can effectively reduce the binding ability of pig kidney cells to human IgG and IgM, and improve the ability of pig kidney cells to resist human complement-mediated cytotoxicity.

[0035] The present invention also verifies the resistance of DCUN1D3 gene knockout pig lung cells and pig liver cells to human complement-mediated cytotoxicity and the ability to bind to human IgG and IgM through examples, and obtains the same conclusion as the pig kidney cell experiment.

[0036] The present invention also verifies through examples the resistance of DCUN1D3 gene-silenced pig kidney cells to human complement-mediated cytotoxicity and their ability to bind to human IgG and IgM, and obtains the same experimental conclusions as the gene knockout method.

[0037] The present invention also obtains transgenic pigs through the preparation method of transgenic pigs for xenotransplantation, transplants pig kidney, lung or liver cells with DCUN1D3 gene knockout into denuclearized oocytes to form cell nucleus transplanted eggs, and transplants the obtained cell nucleus transplanted eggs into the oviduct of a surrogate pig, and the pregnant sows give birth to transgenic piglets for xenotransplantation. The piglets are used as donor animals for xenotransplantation of organs and cells between different species.

[0038] Therefore, the transgenic cloned pigs of the present invention can be used as donor animals for organ and cell transplantation between different species.

[0039] The vectors of the present invention may contain primer sequences, for example, a CAG promoter. Furthermore, any promoter capable of mammalian expression, such as the EF1α promoter, which is generally considered equivalent to the CAG promoter, may also be used. Furthermore, mammalian tissue-specific promoters, such as the ICAM2 promoter, may be used to express foreign genes using the CAG promoter as one type of gene expression promoter.

[0040] In the present invention, "transgenic" refers to the process of introducing DNA into a host and making it replicable as an extrachromosomal factor or through chromosomal integration. Transgenic includes any method for introducing nucleic acid molecules into an organism, cell, tissue or organ. It can be carried out by selecting appropriate standard techniques known in the relevant field according to the host cell, for example, including electroporation, calcium phosphate precipitation, calcium chloride precipitation, microinjection, polyethylene glycol method, DEAE-dextran method, cationic liposome method and lithium acetate-dimethyl sulfoxide method, but not limited to these. In order to distinguish the transformation of eukaryotic cells by plasmid or non-plasmid naked DNA from the transformation meaning of tumorization of cells, it is also called "transfection", which has the same meaning in the present invention.

[0041] The present invention provides a method for preparing a transgenic pig for xenotransplantation and a transgenic cloned pig for xenotransplantation produced by the method, comprising the steps of transplanting the transformed cell into a denuclearized oocyte to form a nucleus-transplanted egg; and transplanting the nucleus-transplanted egg into the oviduct of a surrogate mother.

[0042] In the present invention, "nuclear transplantation" refers to a gene manipulation technique that artificially combines the nuclear DNA of other cells with cells without nuclei to form the same traits, and methods known in the technical field to which the present invention belongs can be used.

[0043] In the present invention, "nuclear transplanted oocyte" refers to an oocyte into which a donor cell has been introduced or fused.

[0044] In the present invention, the "enucleated oocyte" refers to an oocyte from which the nucleus has been removed.

[0045] In the present invention, the term "organ" refers to a collection of tissues connected in a structural unit to perform a common function. An organ can be a solid organ. A solid organ is an internal organ with a fixed tissue consistency that is neither hollow (such as gastrointestinal organs) nor liquid (such as blood). Examples of solid organs include the heart, kidney, liver, lung, pancreas, spleen, and adrenal gland.

[0046] In the present invention, the term "tissue" refers to the cellular organization level intermediate between cells and organs. Tissue is a population of similar cells from the same origin that perform a specific function together. Organs are then formed by the functional aggregation of multiple tissues. Examples of tissues considered by the present invention include, but are not limited to, connective tissue, muscle tissue, neural tissue, epithelial tissue, and mineralized tissue. Blood, bones, tendons, ligaments, fat, and cellulite are examples of connective tissue, which can also be divided into fibrous connective tissue, skeletal connective tissue, and fluid connective tissue. Muscle tissue is divided into three different categories: visceral or smooth muscle, which is found in the inner walls of organs; skeletal muscle, which is usually attached to bones and produces large-scale movements; and cardiac muscle, which is found in the heart and contracts to pump blood through the organism. Cells containing central nervous system and peripheral nerve cells are classified as neural (or nerve) tissue. In the central nervous system, neural tissue forms the brain and spinal cord. In the peripheral nervous system, neural tissue forms cranial nerves and spinal nerves, including motor neurons.

[0047] As used herein, the terms "transformation" and "transfection" refer to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transformed" cell is one that has been transfected, transformed, or transduced with an exogenous nucleic acid. Such cells include the subject's primary cell and its progeny.

[0048] The present invention will be described in detail below by way of examples. The following examples are only provided to illustrate the present invention, and the present invention is not limited to the following examples.

Claims

1. A method for preparing a transgenic donor pig for xenotransplantation, comprising: Transplanting the transformed cells into a denuclearized oocyte to form a nuclear transplanted egg, and transplanting the nuclear transplanted egg into the fallopian tube of a surrogate mother; The transformed cells are introduced with DCUN1D3 Gene knockout vectors, transformed cells are used to prepare donor pigs for xenotransplantation; The donor pig DCUN1D3 Gene not expressed; The DCUN1D3 The gene knockout vector includes vector 1 and vector 2: the vector 1 is connected to sgRNA1, whose specific targeting sequence is CTTAACAGAAGCCAAACAAG; the vector 2 is connected to sgRNA2, whose specific targeting sequence is AGTCTCTTCGATACCTTTG; The DCUN1D3 Gene non-expression is achieved by gene knockout, gene knock-in, point mutation, deletion mutation, or a combination thereof, or by gene silencing; The recipient of the organs, tissues or cells of the xenotransplantation donor pig is a human.

Images