Guide RNA for constructing gene-deficient Arabidopsis mutant plants, Arabidopsis mutant plants and preparation methods thereof

Abstract

The present invention discloses a guide RNA for constructing a gene-deficient Arabidopsis mutant plant, an Arabidopsis mutant plant and a preparation method thereof, wherein the guide RNA comprises a pair of sequences as shown in SEQ ID No: 1 and SEQ ID No: 2. The preparation method comprises: designing a primer pair according to the guide RNA; using the primer pair for PCR amplification, purification, and enzyme digestion, and then connecting with a vector to obtain a recombinant plasmid; using the recombinant plasmid to transform competent cells, and then screening and verifying to obtain an expression vector for knocking out a gene to be knocked out in Arabidopsis; transforming the obtained expression vector into Agrobacterium and soaking the flowers, and then screening to obtain an Arabidopsis mutant plant. The technical solution of the present invention overcomes the current shortcomings in plant breeding and other performances, can advance the bolting period of Arabidopsis, and provides important value for Arabidopsis in the direction of plant breeding.

Description

Technical Field

[0001] The present invention relates to the field of plant molecular genetics, and in particular to a guide RNA for constructing a gene-deficient Arabidopsis mutant plant, an Arabidopsis mutant plant and a preparation method thereof. Background Art

[0002] At present, many genetic screening systems have discovered some important proteins involved in the DNA demethylation pathway through years of research, such as ROS1, IDM1, IDM2, ROS3, MBD7 and other important proteins in the DNA demethylation pathway. This forward genetic screening of new protein factors is inefficient and takes so long that it is difficult to further discover some new protein factors.

[0003] Therefore, the present invention urgently needs to solve the problem of finding relevant protein factors in Arabidopsis thaliana, constructing Arabidopsis thaliana mutant plants on this basis, and improving the performance of Arabidopsis thaliana plants in plant breeding and other directions. Summary of the invention

[0004] In view of the above-mentioned prior art, the purpose of the present invention is to address the shortcomings of the Arabidopsis mutant plants constructed based on related protein factors in the prior art in terms of plant breeding and other performances, thereby providing a guide RNA for constructing gene-deficient Arabidopsis mutant plants, Arabidopsis mutant plants and their preparation methods, which can advance the bolting period and provide important value in the direction of Arabidopsis plant breeding.

[0005] In order to achieve the above object, the present invention provides a guide RNA for constructing a gene-deficient Arabidopsis mutant plant, wherein the guide RNA comprises a pair of sequences shown as SEQ ID No: 1 and SEQ ID No: 2.

[0006] The present invention also provides a method for preparing a mutant Arabidopsis plant, using the guide RNA as described above to knock out the gene to be knocked out in the Arabidopsis plant.

[0007] Preferably, the preparation method comprises:

[0008] S100, designing primer pairs based on the guide RNA;

[0009] S200, using plasmid pCBC-DT1T2 as a template, performing PCR amplification, purification, and restriction digestion using the primer pair described in step S100, and then connecting with a vector to obtain a recombinant plasmid;

[0010] S300, transforming competent cells with the recombinant plasmid, and then screening and verifying to obtain an expression vector for knocking out the gene to be knocked out in Arabidopsis;

[0011] S400, transforming the expression vector obtained in step S300 into Agrobacterium and soaking the flowers to obtain Arabidopsis mutant plants.

[0012] Preferably, in step S100, the primer pair includes a first primer pair corresponding to the sequence shown in SEQ ID No: 1, and a second primer pair corresponding to the sequence shown in SEQ ID No: 2;

[0013] The sequences of the first primer pair are shown in SEQ ID No: 3 and SEQ ID No: 4;

[0014] The sequences of the second primer pair are shown in SEQ ID No:5 and SEQ ID No:6.

[0015] Preferably, the carrier used in step S200 is pHEC401.

[0016] Preferably, in step S300, the verification process includes identifying and sequencing the screened colonies; and,

[0017] The identification was performed using the sequence pair shown as SEQ ID No: 7 and SEQ ID No: 8;

[0018] The sequencing used the sequence pair shown as SEQ ID No:7 and SEQ ID No:9.

[0019] Preferably, the variety of the Arabidopsis thaliana plant having the gene to be knocked out is Col.

[0020] The present invention also provides an Arabidopsis mutant plant, which is obtained by the above-mentioned preparation method.

[0021] Preferably, the bolting period of the Arabidopsis mutant plant is advanced.

[0022] Preferably, the length of the gene fragment deleted in the Arabidopsis mutant plant is not less than 100 bp.

[0023] Through the above technical scheme, the present invention proposes a pair of guide RNAs for knocking out genes in Arabidopsis, and constructs Arabidopsis mutant plants based on the guide RNA, so that the Arabidopsis mutant plants not only antagonize transgenic silencing, but also cause changes in genome-wide DNA methylation. It can also advance the bolting period of Arabidopsis mutant plants, providing important value for the research of Arabidopsis in plant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present invention but do not constitute a limitation of the present invention. In the accompanying drawings:

[0025] Figure 1 is the sequencing result diagram of the positive transgenic seedlings in Verification Example 1;

[0026] Figure 2 It is the fluorescence imaging picture of the positive transgenic seedling, positive control and negative control in Verification Example 2;

[0027] Figure 3 It is a fluorescence quantitative PCR test result diagram of the positive transgenic seedlings, positive control and negative control in Verification Example 3;

[0028] Figure 4 This is a growth comparison diagram of the positive transgenic seedlings in the application example and the conventional Arabidopsis thaliana plant Col-0;

[0029] Figure 5 It is the comparison result of whole genome DNA methylation sequencing of positive transgenic seedlings, positive control and negative control in Verification Example 4. DETAILED DESCRIPTION

[0030] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0031] Among them, pCBC-DT1T2 is consistent with the pCBC-DT1T2 used in the article entitled "A CRISPR / Cas9 toolkit for multiplex genome editing in plants" (BMC Plant Biol. 2014 Nov 29; 14: 327.pii: s12870-014-0327-y.doi: 10.1186 / s12870-014-0327-y. PubMed PMID: 25432517.) published by Chen Qijun's laboratory at the College of Life Sciences of China Agricultural University. Of course, any conventional commercially available pCBC-DT1T2 that any person skilled in the art considers suitable can be used here, and the present invention is not limited to the pCBC-DT1T2 used in this specific embodiment.

[0032] The primer pairs used were synthesized and sequenced by GenScript Biotech; the plasmid mini-extraction kit was a conventional commercial product of GenScript Biotech.

[0033] The preparation method of Agrobacterium competent state is as follows: streak the GV3101 Agrobacterium strain on the YEP solid medium containing rifampicin resistance (25 mg / L), invert and culture at 28°C in the dark for 2-3 days until a single colony grows on the surface of the medium; pick a single Agrobacterium colony, inoculate it in 5mL YEP liquid medium containing rifampicin resistance, and culture it at 28°C, 220g shaking overnight; transfer 3-4mL of the overnight culture to a sterile conical flask containing 20mL YEP liquid containing rifampicin antibiotics, and culture it at 28°C, 220g shaking overnight; after the bacteria are incubated , pour all the remaining culture solution into a sterile conical flask containing 250mL of YEP liquid containing rifampicin antibiotics, and culture at 28℃, 220g shaking until the OD value is between 0.5-0.6; transfer the culture to a sterile centrifuge tube in a clean bench, place it on ice at 4℃ for 10min, and centrifuge it at 4000g for 5min to precipitate the bacteria; resuspend the bacteria with 50mL of 0.15mol / L NaCl solution precooled on ice, and then centrifuge it at 4℃, 4000g for 5min, and discard the supernatant; add 5mL of 20mM CaCl precooled on ice 2 The solution was resuspended with bacteria, centrifuged at 4000 g for 5 min at 4 °C, and then 5 mL of 20 mM CaCl pre-cooled on ice was added again. 2 The solution was resuspended, divided into 100 μL portions per tube, and quickly placed in liquid nitrogen and stored in a -80°C refrigerator.

[0034] The following is further described by means of specific examples.

[0035] Example 1: Construction of an expression vector for knocking out a gene to be knocked out in Arabidopsis

[0036] A pair of gRNA sequences as shown in SEQ ID No: 1 and SEQ ID No: 2 are designed, and a first primer pair as shown in SEQ ID No: 3 and SEQ ID No: 4 and a second primer pair as shown in SEQ ID No: 5 and SEQ ID No: 6 are constructed according to the gRNA sequence. In the second primer pair, the gRNA as shown in SEQ ID No: 2 needs to be added in reverse.

[0037] TCCTATGCATTCTAACATG(SEQ ID No:1)

[0038] GAATCCCAAGTATCTAGAA(SEQ ID No:2)

[0039] DT1-BsF:ATATATGGTCTCGATTGTCCTATGCATTCTAACATGGTT(SEQ ID No:3)

[0040] DT1-F0:TGTCCTATGCATTCTAACATGGTTTTAGAGCTAGAAATAGC(SEQ ID No:4)

[0041] DT2-R0:AACTTCTAGATACTTGGGATTCCAATCTCTTAGTCGACTCT AC(SEQ ID No:5)

[0042] DT2-BsR:ATTATTGGTCTCGAAACTTCTAGATACTTGGGATTCCAA(SEQ ID No:6)

[0043] PCR amplification was performed using pCBC-DT1T2 diluted 25 times as a template and the first primer pair and the second primer pair as primers, wherein the concentration of the primers shown in SEQ ID No: 3 and SEQ ID No: 6 was 10 μmol / L, and the concentration of the primers shown in SEQ ID No: 4 and SEQ ID No: 5 was 1 μmol / L.

[0044] The PCR product was purified and recovered, and an enzyme digestion-ligation system was established according to the system shown in Table 1 to obtain a recombinant plasmid.

[0045] Table 1

[0046]

[0047] After purifying the obtained recombinant plasmid, 1 μL was taken to transform Escherichia coli competent cells, and then kanamycin was used for screening. The screened colonies were identified using the sequence pair shown in SEQ ID No: 7 and SEQ ID No: 8, and sequenced using the sequence pair shown in SEQ ID No: 7 and SEQ ID No: 9 to obtain an expression vector for knocking out the gene to be knocked out in Arabidopsis thaliana.

[0048] U626-F:TGTCCCAGGATTAGAATGATTAGGC(SEQ ID No:7)

[0049] U629-R:AGCCCTCTTTCTTTCGATCCATCAAC(SEQ ID No:8)

[0050] U629-F:TTAATCCAAACTACTGCAGCCTGAC(SEQ ID No:9)

[0051] Among them, the specific operation process for the transformation of Escherichia coli competent cells is as follows: take out the Escherichia coli competent cells from the -80℃ refrigerator and insert them on ice until the competent cells are completely melted. After the competent cells are melted, add the recombinant plasmid (i.e., the enzyme-linked product), and gently blow and mix with a pipette tip, and ice bath for about 30 minutes. Heat shock in a 42℃ water bath for 90s, quickly insert into ice, and ice bath for 2-5min. Add 500μL of LB liquid culture medium (without antibiotics) and mix well, then resume culture at 37℃ shaker 180g for 40-60min. After resuming culture, pour the competent cell liquid into the LB solid culture medium containing the corresponding antibiotics in the clean bench, spread it evenly with a sterilized 1mL pipette tip, seal the culture medium after it is completely dry, and invert and culture at 37℃ for 14-16h.

[0052] In the present invention, plasmid extraction uses a plasmid small-scale extraction kit. The plasmid extraction here is the operation used when purifying the PCR product, which is the enzyme digestion purification and recovery of the aforementioned PCR product and pHEC401 vector. The method adopted is a DNA adsorption column equilibrium treatment, which specifically includes: (1) Add 200μL of CBS buffer to the adsorption column for standby use. (2) According to the growth of the bacterial liquid, take 2-4mL of the bacterial liquid that has been shaken overnight, centrifuge at 8000g for 1min and discard the supernatant. (3) Add 250μL of Soultion I, use a vortex instrument to fully suspend the bacteria to form a uniform mixed solution. (4) Add 250μL of Soultion II treated at 37℃, and immediately gently and fully turn it upside down and mix it 4-6 times to fully lyse the bacteria until a transparent protein-like solution is formed. When the lid is opened, there is obvious sticky thread, indicating that there is a plasmid. This process should not exceed 5min. (5) Add 350 μL Soultion III, gently and thoroughly invert up and down 8-10 times, leave at room temperature for 3 minutes, centrifuge at 12000g for 5-10 minutes, and at the same time, centrifuge the adsorption column with CBS buffer added in the above step (1) at 12000g for 1 minute. (6) Aspirate the supernatant into the equilibrated DNA adsorption column, centrifuge at 6000g for 1 minute at room temperature, and discard the waste liquid. (7) Return the DNA adsorption column to the 2 mL collection tube, add 500 μL W1 Soultion, centrifuge at 12000g for 1 minute, and discard the waste liquid. (8) Return the DNA adsorption column to the 2 mL collection tube, add 500 μL Wash Soultion, centrifuge at 12000g for 1 minute, and discard the waste liquid. Repeat this step once. (9) Return the DNA adsorption column to the 2 mL collection tube, centrifuge at 12000g for 1 minute, and completely remove the Wash Solution. (10) Place the DNA adsorption column in a clean 1.5 mL centrifuge tube, dry at room temperature, add 70 μL of Elution Buffer, incubate at 37°C for 5 min, and centrifuge at 12,000 g for 1 min to elute the plasmid. The eluate can be aspirated back into the DNA adsorption column and the process can be repeated once. The liquid is the solution containing the target plasmid and is stored in a -20°C refrigerator.

[0053] Example 2: Transformation of Agrobacterium

[0054] Take a tube of prepared Agrobacterium competent state from a -80℃ refrigerator and insert it into ice. After it slowly melts into liquid, add 1-2μL of the expression vector prepared in Example 1, gently blow up and mix with a sterile gun tip, and place on ice for 30min. After 30 minutes, put the centrifuge tube into liquid nitrogen for quick freezing for 3min, and then quickly transfer it to a 37℃ water bath prepared in advance for water bath for 5min. Take it out and put it on ice for 2min, add 500mL of YEP liquid culture medium, and restore the culture at 180g in a -28℃ shaker for 3h. After cultivation, pour the YEP solid culture medium containing the corresponding antibiotics prepared in advance into the clean bench, apply it evenly with a sterile blue gun tip, seal it after the clean bench is blown dry, and invert it in a 28℃ constant temperature incubator for 2-3 days. Pick a single clone on the plate, shake the bacteria and verify the bacterial solution by PCR, and save the bacterial solution for future use.

[0055] Example 3: Flower soaking and screening of transgenic seedlings

[0056] Here, the pollen tube channel pouring method is specifically used to transfect Arabidopsis. After the positive clones identified in Example 2 are placed on ice to melt, 100 μL are taken and inoculated into 5 mL of YEP liquid culture medium containing the corresponding antibiotics, and cultured overnight at 28°C in a shaking incubator. After 2 days, pour all 5 mL of turbid bacterial solution into 250 mL of YEP liquid culture medium containing the corresponding antibiotics, shake at 28°C, culture at 180g for 5-10h. During the culture process, pay attention to check in time until the OD value of Agrobacterium reaches between 1.0-1.2. Pour the bacterial solution into a sterilized 250 mL centrifuge bottle, centrifuge at 4°C, 4000g for 10 minutes, discard the supernatant, and obtain a resuspended Agrobacterium. Prepare 200mL of Arabidopsis thaliana Agrobacterium buffer in advance (wherein, Arabidopsis thaliana Agrobacterium buffer is prepared as follows: take 100mL as the total system, weigh 0.237g of MS powder and 5g of sucrose and dissolve them in 80mL of deionized water, and make up to 100mL after fully dissolving), take an appropriate amount of Arabidopsis thaliana Agrobacterium buffer and pour it into the bottle to resuspend Agrobacterium, so that the OD value is between 0.8-1.0, and obtain Arabidopsis thaliana Agrobacterium primary liquid. Add Silwet-77 to the Arabidopsis thaliana Agrobacterium primary liquid at a ratio of 40μL / 100mL to obtain Arabidopsis thaliana Agrobacterium infection liquid. Select blooming Arabidopsis plants and cut off the fruit clips that have grown by self-pollination in advance. Soak the inflorescence in the above-mentioned Arabidopsis thaliana Agrobacterium infection liquid for 1min. After the infection is completed, put the Arabidopsis in two black trays containing plastic wrap and treat it in the dark for 24h. Then move to the artificial climate chamber for normal culture. Dip again after one or two weeks to improve the transformation success rate. Continue to culture until the seeds are harvested. The seeds harvested after dipping are the T1 generation. After drying, they are spotted on MS medium containing 50 mg / L hygromycin. Cultivate in the artificial climate chamber and observe the growth of the seedlings after about 14 days. The plants containing the transgenic plants germinate and grow significantly faster.

[0057] The seedlings were transplanted into nutrient soil and cultured in an artificial climate chamber for about two months, and then harvested as T2 generation. The T2 generation seeds were sown on MS medium containing 50 mg / L hygromycin, and the strains that grew normally on the medium and had no phenotypic separation were the positive transgenic seedlings screened.

[0058] Verification Example 1

[0059] The positive transgenic seedlings screened were identified by PCR, and homozygous mutants in the mutant plants with successful knockout were obtained. The homozygous mutants were sequenced, and the sequencing results were as follows: Figure 1 Here, the specific operation of obtaining homozygous mutants based on PCR identification can be performed in a manner that can be routinely used by those skilled in the art, and will not be described in detail here.

[0060] pass Figure 1 It can be seen that the method of the present invention obtains Arabidopsis mutant plants, specifically, Figure 1 As shown in SEQ ID No:14, the length of the gene fragment missing in the Arabidopsis mutant plant is 177 bp. Specifically, the sequence of the gene fragment missing in the Arabidopsis mutant plant is shown in SEQ ID No:14.

[0061] CGGCATCTTTTTGGAACCTGGAAAGGAGTCTTTCATCCGCAAACACTTCAGCTTATTGAGAAAGAACTTGGCTTTAATGCTAAAAGTGATGGTTCAGCAGCTGTTGTATCCACAGCCAGAGCTGAGCCGCAATCTCAGCGCCCACCACATAGCATCCATGTGAATCCCAAGTATCTA(SEQ ID No:14)

[0062] Verification Example 2

[0063] The seeds of the positive transgenic seedlings obtained in Example 3 were sown on MS medium. After 12 days of light culture, the two leaves of the seedlings were fully opened, and then the substrate luciferin (Peikin Elmer, USA) was sprayed and dark-treated for 10 minutes. Then, a fluorescence imager (Tianneng 5200, Tianneng Company, Shanghai) was used to capture the fluorescence for 30 seconds. The high fluorescence control Arabidopsis Col-LUC (as a positive control) and the low fluorescence control Arabidopsis ros1-7 (as a negative control) were set respectively. The results are shown in Figure 2. Figure 2 As shown, the fluorescence of the positive transgenic seedlings after the specific gene fragment was knocked out in the present invention was significantly reduced.

[0064] Verification Example 3

[0065] Fluorescence quantitative PCR was used to verify whether the transgene was silenced. Real-time fluorescence quantitative PCR amplification used the CFX96 real-time PCR (Bio-RAD) system, and the kit used iQ SYBR Green Supermix (Bio-Rad). Arabidopsis ACTIN2 was used as the internal reference gene, and each pair of primers on the template was repeated three times, and each gene amplification reaction was recorded as an experimental result. The primers used included SEQ ID No: 10, SEQ ID No: 11, SEQ ID No: 12, and SEQ ID No: 13.

[0066] LUC-QF: CGGAAAGACGATGACGGAAA (SEQ ID No: 10);

[0067] LUC-QR: CGGTACTTCGTCCACAAACA(SEQ ID No:11);

[0068] ACTIN2-QF:GATGATGCGCCAAGAGCTG (SEQ ID No: 12);

[0069] ACTIN2-QR:GCCTCATCACCTACGTAGGCAT (SEQ ID No: 13).

[0070] The results of fluorescence quantitative PCR are as follows Figure 3 As shown, through Figure 3 It can be seen that the transcription level of the knockout positive transgenic seedlings was significantly reduced compared with that of the Arabidopsis Col-LUC plants.

[0071] Verification Example 4

[0072] The seeds of the positive transgenic seedlings in Example 3 were disinfected with 8% sodium hypochlorite solution and then sown on MS culture medium. After two days of cold treatment at 4°C, they were placed in the intelligent light incubator GTOP-S00B of Zhejiang Top Yunnong Technology Co., Ltd. with 16h light (22°C) / 8h dark (20°C). After 12 days of cultivation, the seedlings of the positive transgenic seedlings prepared by the present invention were sent to Shanghai Lingen Technology Co., Ltd. for whole genome DNA methylation sequencing. The sequencing results were compared as follows Figure 5 As shown. Figure 5 It can be seen that compared with conventional Arabidopsis Col-0 plants, the DNA methylation level of the Arabidopsis mutant plants of the present invention is similar to that of the ROS1 gene mutant (ie, ROS1 function is lost in the background of Arabidopsis Col-0 plants), and has undergone tremendous changes.

[0073] Based on the above verification examples, it can be seen that after knocking out a specific gene, the mutant plant of the present invention showed changes in gene silencing and DNA methylation regulation levels.

[0074] Application Examples

[0075] Conventional Arabidopsis thaliana plant Col-0 and the Arabidopsis thaliana mutant plant obtained in the present invention were planted on MS culture medium and transplanted into nutrient soil after 14 days of culture. They were continued to grow under the same conditions until the plant bolting stage. The Arabidopsis thaliana mutant plant obtained in the present invention bolted significantly earlier (e.g. Figure 4 shown).

[0076] Therefore, the Arabidopsis mutant plant obtained by the present invention can shorten the growth period of the plant.

[0077] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0078] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0079] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A guide RNA for constructing a gene-deficient mutant plant of Arabidopsis thaliana, characterized in that: The guide RNA includes a pair of sequences shown as SEQ ID No: 1 and SEQ ID No:

2.

2. A method for preparing a mutant plant of Arabidopsis thaliana, characterized in that: The guide RNA as claimed in claim 1 is used to knock out the gene to be knocked out in the Arabidopsis plant.

3. The preparation method according to claim 2, characterized in that: The preparation method comprises: S100, designing primer pairs based on the guide RNA; S200, using plasmid pCBC-DT1T2 as a template, performing PCR amplification, purification, and restriction digestion using the primer pair described in step S100, and then connecting with a vector to obtain a recombinant plasmid; S300, transforming competent cells with the recombinant plasmid, and then screening and verifying to obtain an expression vector for knocking out the gene to be knocked out in Arabidopsis; S400, transforming the expression vector obtained in step S300 into Agrobacterium and soaking the flowers to obtain Arabidopsis mutant plants.

4. The preparation method according to claim 3, characterized in that: In step S100, the primer pair includes a first primer pair corresponding to the sequence shown in SEQ ID No: 1, and a second primer pair corresponding to the sequence shown in SEQ ID No: 2; The sequences of the first primer pair are shown in SEQ ID No: 3 and SEQ ID No: 4; The sequences of the second primer pair are shown in SEQ ID No:5 and SEQ ID No:

6.

5. The preparation method according to claim 3 or 4, characterized in that: The carrier used in step S200 is pHEC401.

6. The preparation method according to claim 3 or 4, characterized in that: In step S300, the verification process includes identifying and sequencing the screened colonies; and, The identification was performed using the sequence pair shown as SEQ ID No: 7 and SEQ ID No: 8; The sequencing used the sequence pair shown as SEQ ID No:7 and SEQ ID No:

9.

7. The preparation method according to any one of claims 2 to 4, characterized in that: The variety of the Arabidopsis thaliana plant having the gene to be knocked out is Col.

Images