A chitosanase mutant with improved catalytic activity and its application
By performing site-directed mutation of Bacillus subtilis chitosanase BsCsn46A, the E203A mutant was formed, which solved the problem of low catalytic activity of chitosanase and achieved efficient production of chitosansan.
Patent Information
- Application Number
- CN202310871726.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-17
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2043-07-17
AI Technical Summary
The existing chitosanase has low catalytic activity, which limits the large-scale production and application of chitosans.
By performing site-directed mutation of Bacillus subtilis chitosanase BsCsn46A, the 203rd glutamate mutated into a small volume of alanine, forming the chitosanase mutant E203A, improving its catalytic activity.
The catalytic activity of chitosanase mutant E203A has been significantly improved, with a catalytic efficiency of 1.17 times, and is suitable for efficient production of chitosaccharides.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of enzyme engineering, and particularly relates to a chitosanase mutant with improved catalytic activity and application thereof. Background Art
[0002] Chitosanase is a class of glycoside hydrolases with high catalytic activity towards chitosan, converting high-molecular-weight chitosan into low-molecular-weight functional chitosan oligosaccharides. Chitosanases are primarily distributed in the GH8, GH46, GH75, and GH80 families, with the GH46 family chitosanase being the most intensively studied. Its overall structure consists of an N-terminal small domain and a C-terminal large domain, connected by a long, curved α-helix, forming an asymmetric dumbbell shape. The active center contains two catalytic residues, Asp and Glu; one amino acid residue acts as a nucleophile, and the other as a generalized acid / base.
[0003] Chitosan is a macromolecular polymer obtained by extensive deacetylation of chitin. Its primary component is D-glucosamine (GlcN), an alkaline polysaccharide linked by β-1,4-glycosidic bonds. Chitosan exhibits excellent antibacterial properties, biocompatibility, film-forming properties, and biodegradability, and is primarily used in food packaging, as an active antimicrobial agent, and in chemical applications such as water treatment. Chitosan is widely found in chitin-producing animals such as shrimp and crabs, as well as algae and macrofungi such as mushrooms. It is abundant and widely available, making it the second-largest polymer compound after cellulose. However, its high molecular weight and poor solubility limit its applications. Chitosan hydrolysis can produce chitooligosaccharides (DP 2-10) or glucosamine. Chitooligosaccharides are the only known oligosaccharides that are alkaline and positively charged. Research reports indicate that chitosan oligosaccharides have all the functions of chitosan oligosaccharides, and have many advantages such as easy absorption and good water solubility. They have anti-tumor, anti-inflammatory, antibacterial, immunity-enhancing and lactic acid bacteria growth-promoting functions. Therefore, they have broader application prospects in the fields of medicine, food, agriculture, cosmetics, etc.
[0004] The production methods of chitosan oligosaccharides include physical degradation, chemical degradation, and enzymatic hydrolysis. Physical methods mainly include methods such as ultrasonic treatment, microwave degradation, and ultraviolet irradiation. The yield is low, which greatly limits the large-scale production of chitosan oligosaccharides. Chemical degradation has severe chemical reactions, poor product selectivity, difficulty in separation and purification, and the production of toxic gases. Enzymatic hydrolysis has the characteristics of high selectivity, high activity, and high efficiency, and has a mild reaction, a high yield of chitosan oligosaccharides, obvious cost advantages, and little environmental pollution. Therefore, protein engineering of chitosanase and optimization of enzyme catalytic efficiency are current research hotspots. Currently, the catalytic activity of existing chitosanase is low, so obtaining chitosanase with high catalytic activity is of great value in the industrial production of chitosan oligosaccharides. Summary of the Invention
[0005] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a chitosanase mutant with improved catalytic activity and application thereof.
[0006] The invention modifies the Bacillus subtilis chitosanase BsCsn46A molecule, analyzes substrate channel sites, and performs site-directed mutagenesis on site 203, wherein the site 203 is mutated into a tryptophan W with a large R group or into an alanine A with a small R group, so as to obtain a chitosanase mutant with improved catalytic efficiency.
[0007] The amino acid sequence of the Bacillus subtilis chitosanase BsCsn46A of the present invention is shown in SEQ ID NO: 1, and the encoded nucleotide sequence is shown in SEQ ID NO: 2.
[0008] The chitosanase mutant of the invention is obtained by performing site-directed mutation on the 203rd position of the amino acid sequence of Bacillus subtilis chitosanase BsCsn46A, wherein glutamic acid is mutated into alanine with a small R group, and the mutant is marked as E203A.
[0009] The amino acid sequence of the chitosanase mutant E203A is SEQ ID NO: 3, and the nucleotide sequence of the chitosanase mutant is SEQ ID NO: 4.
[0010] The present invention also provides a recombinant vector carrying the gene encoding the chitosanase mutant and a recombinant bacterium transformed / transfected with the recombinant vector; the host bacteria of the recombinant bacteria is Escherichia coli BL21 (DE3).
[0011] The present invention further provides the use of the chitosanase mutant in catalyzing the hydrolysis of chitosan to produce chitooligosaccharides. Specifically, the catalytic activity of the mutant of the present invention is significantly improved during the catalytic hydrolysis of chitosan.
[0012] Furthermore, the chitosanase mutant has an optimum temperature of 60° C. and an optimum pH of 6.2 in catalyzing chitosan reaction.
[0013] The chitosanase mutant provided by the present invention has significantly improved catalytic activity compared with the wild chitosanase BsCsn46A, and the chitosanase mutant has broad application prospects in hydrolyzing chitosan oligosaccharides. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 is the enzyme activity of the wild type and mutants, wherein the wild-type is Bacillus subtilis chitosanase BsCsn46A;
[0015] Figure 2 pH stability of enzyme activity;
[0016] Figure 3 Temperature stability of enzyme activity;
[0017] Figure 4 This is the protein structure diagram of the chitosan mutant E203A. Implementation Method
[0018] The present invention is further described in detail below with reference to the following embodiments: These embodiments are only used to illustrate the present invention and are not used to limit the scope of the invention.
[0019] 1. Determination of mutation sites
[0020] The amino acid sequence of BsCsn46A, shown in SEQ ID NO:1, was submitted to SWISS-MODEL to construct the enzyme's three-dimensional structure. The resulting chitosanase structure was analyzed using substrate channel analysis to identify amino acid sites that could affect the enzyme's catalytic activity. Site 203, located in the substrate channel, was identified as a potential site affecting catalytic activity. Site 203 was mutated to either a bulky R group (W) or a small R group (A). Primers were designed, and the mutant chitosanase gene was obtained using PCR.
[0021] The amino acid sequence of the wild-type chitosanase BsCsn46A is shown in SEQ ID NO: 1, and the nucleotide sequence is shown in SEQ ID NO: 2;
[0022] The amino acid sequence of the chitosanase mutant E203A is shown in SEQ ID NO: 3, and the nucleotide sequence is shown in SEQ ID NO: 4;
[0023] The amino acid sequence of the chitosanase mutant E203W is shown in SEQ ID NO: 5, and the nucleotide sequence is shown in SEQ ID NO: 6.
[0024] Table 1. Primer sequences
[0025] Primer name Primer usage Primer (5'–3') bscsf BsCsn46A CGGTAATTTTGTAATCCCTTAAAGCTTGCGGCC bscsf BsCsn46A GGCCGCAAGCTTTTAAGGGATTACAAAATTACCG E203WF E203W CAATCATGACACCCGTGACTGGTGGAGAGAATCAGTTGCC E203WR E203W GGCAACTGATTCTCTCCACCAGTCACGGGTGTCATGATTG E203AF E203A CATGACACCCGTGACGCTTGGAGAGAATCAGTTG E203AR E203A CAACTGATTCTCTCCAAGCGTCACGGGTGTCATG
[0026] Table 2. Inverse PCR system:
[0027] Reagent name Volume (μL) template 2 PCR Buffer 5 dNTPs (10 mM) 1 Upstream / downstream primers (100 mM) 0.3 each PfuDNA polymerase 1.5 <![CDATA[ddH2O]]> 40 Total volume 50
[0028] Reverse PCR amplification conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 50 s, annealing at 65°C for 30 s, and extension at 68°C for 12.5 min, 12 cycles; and insulation at 4°C.
[0029] 2. Construction of expression vector
[0030] The target gene amplified by PCR was cloned into the expression vector pET-28a to construct a recombinant plasmid. To 20 μL of the PCR reaction mixture, add 1 μL of DpnI restriction enzyme and incubate in a 37°C water bath to digest the template plasmid. Transfer 10 μL of the digested product directly to E. coli DH5α competent cells. Recombinant cells carrying the mutant plasmid were sent to Shanghai Bioengineering Co., Ltd. for sequencing. Correctly sequenced mutant plasmids were transformed into E. coli BL21.
[0031] 3. Protein Purification
[0032] After culturing the induced mutants on a shaker, the cells were harvested and disrupted by sonication. The supernatant was purified by Ni-IDA affinity chromatography. The supernatant was loaded onto a Ni-IDA column, and unbound proteins were first thoroughly eluted with loading buffer. Proteins were then eluted with elution buffer (50 mM Tris-HCl, 0.5 mM NaCl, 0.1 M imidazole, pH 8.0). The eluted protein sample was collected and stored at -20°C. The protein content in the enzyme solution was determined using the Broadford assay.
[0033] 4. Enzyme Activity Assay
[0034] The enzyme activity was determined using the DNS method. 1475 μL of pH 6.2 phosphate buffer, 500 μL of 1% colloidal chitosan solution, and 18 μL of 100 mM Mn 2+ Finally, add 25 µL of purified chitosanase (protein content 25 μg / mL) and immediately incubate at 55°C for 5 minutes. Immediately after the incubation period, add 1.5 mL of DNS reagent and mix well to terminate the reaction. A sample without enzyme solution was used as a blank control. Incubate in a boiling water bath for 5 minutes, add water to 25 mL, and measure the absorbance at 520 nm. Under these conditions, one unit (U) of enzyme activity is defined as the amount of enzyme that catalyzes the production of 1 μM reducing sugar per minute.
[0035] 5. Enzyme properties
[0036] (1) Optimum pH
[0037] Chitosanase activity was measured at 50°C in phosphate buffer solutions with different pH values (pH=6.0, 6.2, 6.4, 6.6, 6.8, 7.0, 7.2). The highest activity value was taken as 100%.
[0038] (2) pH stability
[0039] Chitosanase was stored in phosphate buffer at pH 6.2 at 4°C for 2 h. The chitosanase activity measured at 0 h was taken as 100%, and the residual activity of chitosanase was measured after 2 h.
[0040] (3) Optimum temperature
[0041] Under the optimal pH conditions, the reaction system was placed at 40-75°C (40, 45, 50, 55, 60, 65, 70, 75) for 5 minutes, and the chitosanase activity was measured. The temperature at which the enzyme activity reached its peak was defined as 100%, and this temperature was the optimal temperature.
[0042] (4) Temperature stability
[0043] Chitosanase was stored at 55°C for 2 hours. The chitosanase activity measured at 0 hour was taken as 100%. The residual chitosanase activity was measured after 2 hours.
[0044] The enzymatic properties of Bacillus subtilis chitosanase BsCsn46A (WT) and its mutants (E203W, E203A) are shown in Table 3. The catalytic activity of the E203A mutant was significantly higher than that of the wild-type Bacillus subtilis chitosanase BsCsn46A.
[0045] Table 3. Enzyme properties
[0046]
[0047] From the above results, it can be seen that the catalytic activity of the chitosanase mutant E203A is 1.17 times higher than that of the wild type.
[0048] Simple changes or equivalent replacements of the technical solutions that can be obviously obtained by those skilled in the art within the technical scope disclosed in the present invention all fall within the protection scope of the present invention.
Claims
1. A chitosanase mutant, characterized in that: The chitosanase mutant is a mutant E203A in which the glutamic acid at position 203 of the amino acid sequence of chitosanase BsCsn46A from Bacillus subtilis is mutated to alanine, while the amino acid residues at other positions remain unchanged; the amino acid sequence of the chitosanase mutant is shown in SEQ ID NO:
3.
2. A gene, characterized in that Encoding the chitosanase mutant according to claim 1.
3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO:
4.
4. A recombinant vector, characterized in that The recombinant vector comprises the gene according to claim 2.
5. A recombinant bacterium, characterized in that The recombinant bacteria comprises the recombinant vector according to claim 4.
6. A use of the chitosanase mutant according to claim 1, characterized in that: The chitosanase mutant is used for enzymatic hydrolysis of chitosan.
7. The use of the chitosanase mutant according to claim 6, characterized in that: The chitosanase mutant has an optimum temperature of 60° C. and an optimum pH of 6.2 in the chitosan enzymatic hydrolysis reaction.
Citation Information
Patent Citations
Chitosanase mutant and application thereof
CN111041017A
Chitosanase mutant with high catalytic activity and temperature stability and application thereof
CN115873831A