Use of shikonin or its derivative in preparation of medicine for treating coronavirus infection

Abstract

The application discloses application of shikonin or a derivative thereof in preparation of a medicine for treating coronavirus infection, and the mutant strains include a delta mutant strain and an omicron mutant strain of human coronavirus SARS-CoV-2. The application further discloses a medicine combination and application thereof, and the medicine combination comprises two or more than two kinds of shikonin or derivatives thereof. The shikonin or the derivative thereof has obvious in-vitro inhibitory effect on main proteases of the coronavirus, and shows broad-spectrum antiviral effect.

Description

[0001] This application claims priority to Chinese patent application 2022104191996 with the filing date of 2022 / 04 / 20. This application incorporates the entire text of the above-mentioned Chinese patent application. TECHNICAL FIELD

[0002] The present application belongs to the field of medicine, and relates to the use of shikonin or its derivative in the preparation of a medicament for treating a disease caused by infection of a coronavirus and / or an influenza virus or a mutant strain thereof. BACKGROUND

[0003] Coronaviruses are a class of viruses with envelope, whose genome is a linear single-stranded RNA, mainly encoding structural proteins related to virus packaging and non-structural proteins responsible for transcription. Papain protease and main protease cleave the polypeptide ppla and pplab into 16 independent non-structural proteins nsp1-16, and then complete the transcription and replication process of the viral genome (Wu et al. 2020. Nature, 579:265-269). The main protease contains 11 enzyme cleavage sites, which plays a crucial role in the replication and transcription process of the coronavirus life cycle, and is one of the ideal targets for the development of new broad-spectrum anti-coronavirus drugs. So far, about 16 different strains of coronaviruses that can infect a variety of mammals and birds have been found, of which 7 coronaviruses are known to infect humans, including HCoV-229E, HCoV-NL63, HCoV-OC43, HCoV-HKU1, SARS-CoV, MERS-CoV, and SARS-CoV-2. Coronaviruses mainly cause respiratory infections in humans, such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS).

[0004] Currently, broad-spectrum antiviral drugs are often used in clinical practice, such as the anti-Ebola virus drug remdesivir, the anti-HIV drug lopinavir-ritonavir, the drug hydroxychloroquine for treating malaria and autoimmune diseases, and the antiviral drug interferon type I. These drugs exhibit good anti-coronavirus activity in vitro, but often do not have value for human in vivo application. On the one hand, they may cause side effects of immune suppression, and on the other hand, the concentration required for the drug to take effect often exceeds the upper limit of serum drug concentration. Currently, there is no specific treatment drug for coronavirus pneumonia, and the development of new drugs has the characteristics of long cycle and complex process, which needs to follow strict scientific and medical rules.

[0005] Lithospermum erythrorhizon Sieb. et Zucc. is a traditional Chinese medicinal material. Its effective components are mainly distributed in the roots, which are natural products of naphthoquinone shikonin and its derivatives produced by metabolism. The roots of L. erythrorhizon have high multiple biological activities, pharmacological effects, good clinical efficacy, and high utilization value, which have attracted the attention and concern of researchers at home and abroad. The main components of L. erythrorhizon are shikonin, the main component of Arnebia euchroma Johnst is alkannin, which is the enantiomeric isomer of shikonin (Zhou W, Jiang H G, Peng Y, et al. Comparative study on enantiomeric excess of main akannin / shikonin derivatives isolated from the roots of three endemic oraginaceae plants in China[J]. Biomed Chromatogr, 2011, 25(10): 1067-1075.), and isovaleryl shikonin extracted from Arebia guttata Bunge (Sun Y T, Li T T, Han W, et al. Isolation and extraction of isovaleryl shikonin from Arebia guttata Bunge[J]. Journal of Jilin Normal University: Natural Science Edition, 2019, 40(2): 86-88.), and other natural derivatives of shikonin such as acetyl shikonin, deoxy shikonin, isobutyryl shikonin, β-acetoxy isovaleryl shikonin, and β, β-dimethyl acryl shikonin (Mao Y, Cai X C, Gulibaihetimu Y Y, et al. Simultaneous determination of six naphthoquinone components in Arnebia euchroma by one measurement multi-estimation method[J]. Chinese Herbal Drugs, 2019, 50(17): 4170-4175.). L. erythrorhizon was first used as a natural dye, and was used as a food colorant and a cosmetic. Modern pharmacological and clinical studies have found that it has anti-inflammatory, wound healing, anti-tumor, antibacterial, liver protection, and immune regulation effects, and is used in the treatment of acute and chronic hepatitis and cirrhosis. Shikonin is a highly specific inhibitor of pyruvate kinase M2, which can be used to inhibit the production of tumor necrosis factor and the activation of the nuclear factor κB pathway. The related patent application is JP2837715B2. In addition, shikonin can also induce apoptosis of cancer cells by inducing oxidative stress response, inhibiting topoisomerase activity, mitochondrial function, and cell skeleton formation signaling pathways, and can be used as a source of new anti-cancer drugs. It is a natural anti-tumor drug with great potential after podophyllotoxin and paclitaxel.(BOULOS JC, RAHAMA M, HEGAZY MEF, et al. Shikonin derivatives for cancer prevention and therapy [J]. Cancer Lett, 2019, 459: 248-267. Li B, Yuan Z, Jiang J, et al. Anti-tumor activity of Shikonin against afatinib resistant non-small cell lung cancer via negative regulation of PI3K / Akt signaling pathway [J]. Biosci Rep. 2018, 38(6):BSR20181693).

[0006] In summary, although shikonin and its derivatives have a long history of use as drugs, our team has reported the in vitro broad-spectrum antiviral activity of shikonin (Structure-based discovery and structural basis of a novel broad-spectrum natural product against main protease of coronavirus), but the inhibitory effect of shikonin and akninin and its derivatives in true viruses has not been reported. Pfizer has developed a specific drug Paxlovid targeting the main protease target, which has been approved for marketing by the FDA and NMPA, and has shown good efficacy, but the ritonavir in Paxlovid can cause liver damage, and the market is in urgent need of specific small molecule drugs with less side effects. Shikonin and its derivatives come from natural products, have lower side effects, and have great potential for the treatment of COVID-19. SUMMARY

[0007] In view of the deficiencies of the prior art and actual needs, the application provides application of a shikonin derivative in preparation of a medicine for treating coronavirus infection. The shikonin derivative including β, β-dimethyl acryl shikonin, iso-valeryl shikonin, β-hydroxy iso-valeryl shikonin, acetyl shikonin, β, β-dimethyl acryl acaknin, deoxy shikonin, acetyl acaknin and shikonin red is found for the first time to have obvious in-vitro inhibitory effect on the main protease of coronavirus, and has obvious inhibitory effect on the delta and omicron mutant strains of new coronavirus. The main protease (Mpro) of coronavirus can cut the polynucleotide protein coded by the virus into independent subunits, and undertakes indispensable functions in the process of virus transcription and replication, and is a key protein for starting all other life activities after the virus invades host cells, so that the shikonin derivative shows broad-spectrum antiviral effect and can be applied to treat coronavirus infection.

[0008] To achieve the above-mentioned purpose, the application adopts the following technical solutions:

[0009] The first aspect of the application provides application of shikonin or a derivative thereof in preparation of a medicine for treating diseases caused by influenza virus and / or coronavirus or mutant strains thereof.

[0010] In some preferred embodiments, the influenza virus includes human influenza virus, type A influenza virus, type B influenza virus and type C influenza virus.

[0011] Preferably, the coronavirus is human coronavirus, which is selected from one or more of HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV and SARS-CoV-2.

[0012] More preferably, the mutant strain includes the delta mutant strain and the omicron mutant strain of human coronavirus SARS-CoV-2.

[0013] In some preferred embodiments, the shikonin or the derivative thereof is β, β-dimethyl acryl shikonin, iso-valeryl shikonin, β-hydroxy iso-valeryl shikonin, acetyl shikonin, β, β-dimethyl acryl acaknin, deoxy shikonin, acetyl acaknin and shikonin red.

[0014] Preferably, the shikonin or the derivative thereof is β, β-dimethyl acryl acaknin.

[0015] Shikonin derivatives were first used as a natural dye, and were used as food colorants and cosmetics. Modern pharmacological and clinical studies have found that they have anti-inflammatory, wound healing, anti-tumor, antibacterial, liver protection and immune regulation effects, and are clinically used for the treatment of acute and chronic hepatitis and cirrhosis. In the present application, β, β-dimethylacryl shikonin (β, β-dimethylacryl shikonin) has a molecular formula of C 21 H 22 O6, and a structure as shown in formula I; Isovaleryl shikonin has a molecular formula of C 21 H 24 O6, and a structure as shown in formula II; β-hydaroxyisovaleryl shikonin has a molecular formula of C 21 H 24 O7, and a structure as shown in formula III; Alkanin has a molecular formula of C 16 H 16 O5, and a structure as shown in formula IV; Acetyl shikonin has a molecular formula of C 18 H 18 O6, and a structure as shown in formula V; β, β-dimethylacryl alkanin has a molecular formula of C 21 H 22 O6, and a structure as shown in formula VI.

[0016]

[0017]

[0018] The second aspect of the present application provides a pharmaceutical combination comprising two or more of shikonin or its derivatives.

[0019] In some preferred embodiments, the derivative is β, β-dimethylacryl shikonin, isovaleryl shikonin, β-hydaroxyisovaleryl shikonin, alkanin and acetyl shikonin, β, β-dimethylacryl alkanin, deoxyshikonin, acetyl alkanin, and shikonin red, and the pharmaceutical combination comprises β, β-dimethylacryl alkanin, shikonin red, or β, β-dimethylacryl alkanin, shikonin red and alkanin.

[0020] Preferably, the pharmaceutical combination further comprises any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.

[0021] The third aspect of the present application provides a use of the pharmaceutical combination according to the second aspect of the present application in the preparation of a medicament for treating a disease caused by an influenza virus and / or a coronavirus or a mutant strain thereof.

[0022] In some preferred embodiments, the dosage form of the medicament comprises any one of a suspension, a granule, a capsule, a powder, a tablet, an emulsion, a solution, a dripping pill, an injection, a suppository, an enema, an aerosol, a patch or a drop.

[0023] Preferably, the mutant strain comprises a Delta mutant strain and an Omicron mutant strain of human coronavirus SARS-CoV-2.

[0024] On the basis of common general knowledge in the art, the above-mentioned preferred conditions can be combined in any manner, thereby obtaining preferred embodiments of the present application.

[0025] The reagents and raw materials used in the present application are commercially available.

[0026] The positive progress effect of the present application is that:

[0027] There is no disclosure in the prior art of the use of shikonin and its derivatives in the preparation of a medicament for treating coronavirus infection. The present application provides a use of shikonin or a derivative thereof in the preparation of a medicament for treating a disease caused by a coronavirus and / or an influenza virus or a mutant strain thereof. It is first verified that shikonin derivatives, including β,β-dimethylacryl shikonin, isovaleryl shikonin, β-hydroxyisovaleryl shikonin, acetyl shikonin, β,β-dimethylacryl acaknin, deoxyshikonin, acetyl acaknin, and shikonin red, have obvious in vitro inhibitory effects on the main protease of a coronavirus, and exhibit broad-spectrum antiviral effects. Thereafter, structure optimization based on shikonin reduces the non-specific cytotoxicity of shikonin and improves the selectivity and targeting of shikonin, and it is extremely possible to market a broad-spectrum medicament for treating a coronavirus.

[0028] The present application provides a theoretical basis for the use of shikonin derivatives in the treatment of a coronavirus, and provides a reference for the rapid development of a medicament for treating a coronavirus. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 Rapid protein liquid chromatogram of SARS-CoV-2 main protease;

[0030] Figure 2 Rapid protein liquid chromatogram of SARS-CoV main protease;

[0031] Figure 3 Rapid protein liquid chromatogram of MERS-CoV main protease;

[0032] Figure 4Rapid Protein Liquid Chromatogram for HCoV-229E Main Protease;

[0033] Figure 5 Rapid Protein Liquid Chromatogram for HCoV-HKU1 Main Protease;

[0034] Figure 6 Rapid Protein Liquid Chromatogram for HCoV-NL63 Main Protease;

[0035] Figure 7 SDS-PAGE Electropherogram for SARS-CoV-2 Main Protease;

[0036] Figure 8 SDS-PAGE Electropherogram for SARS-CoV Main Protease;

[0037] Figure 9 SDS-PAGE Electropherogram for MERS-CoV Main Protease;

[0038] Figure 10 SDS-PAGE Electropherogram for HCoV-229E Main Protease;

[0039] Figure 11 SDS-PAGE Electropherogram for HCoV-HKU1 Main Protease;

[0040] Figure 12 SDS-PAGE Electropherogram for HCoV-NL63 Main Protease;

[0041] Figures 13A-13F Results for β,β-dimethylacryloyl ormosin to inhibit coronavirus main protease;

[0042] Figures 14A-14F Results for isovaleryloromosin to inhibit coronavirus main protease;

[0043] Figures 15A-15F Results for β-hydroxyisovaleryloromosin to inhibit coronavirus main protease;

[0044] Figures 16A-16F Results for acetyl ormosin to inhibit coronavirus main protease;

[0045] Figures 17A-17F Results for acetyl ormosin to inhibit coronavirus main protease;

[0046] Figures 18A-18F Results for β,β-dimethylacryloyl acetyl ormosin to inhibit coronavirus main protease;

[0047] Figures 19A-19F Results for deoxyoromosin to inhibit coronavirus main protease;

[0048] Figures 20A-20F Results of inhibition of coronavirus main protease by acetylacannin;

[0049] Figures 21A-21F Results of inhibition of coronavirus main protease by alizarin;

[0050] Figures 22A-22C Inhibition results of compound on SARS-CoV-2 WT, Delta, Omicron true virus. DETAILED DESCRIPTION

[0051] Example 1 Preparation of SARS-CoV-2 virus main protease

[0052] This example provides a SARS-CoV-2 main protease expression plasmid, which clones the gene of SARS-CoV-2 main protease into a pET28a vector to construct an expression plasmid, and the work is entrusted to Nanjing Kingsrui Biological Technology Co., Ltd. The gene sequence encoding SARS-CoV-2 main protease is shown as SEQ ID NO. 1, and the size of the protein is 27 kDa.

[0053] SEQ ID NO: 1 (5'-3'):

[0054] ggatccagcggctttcgtaaaatggcatttccgagcggtaaagtggaaggttgtatggttcaggtgacctgtggcaccaccaccctgaatggcctgtggctggatgatgtggtgtattgtccgcgtcatgttatttgtacctcagaagatatgctgaatccgaattatgaggacctgctgattcgtaaatctaatcataattttctggttcaggcaggcaatgttcagctgcgcgtgattggtcatagtatgcagaattgtgtgctgaaactgaaagtggataccgcaaatccgaaaaccccgaaatataaatttgttcgcattcagccgggccagacctttagcgtgctggcatgttataatggctctccgagcggcgtgtatcagtgtgcaatgcgcccgaattttaccattaaaggtagttttctgaatggctcttgtggtagcgtgggctttaatattgattatgattgtgtgagcttttgttatatgcatcacatggaactgccgaccggcgttcatgcaggtaccgatctggaaggcaatttttatggtccgtttgttgatcgccagaccgcacaggcagcaggtaccgataccaccattaccgttaatgttctggcatggctgtatgcagcagttattaatggcgatcgttggtttctgaatcgctttaccaccaccctgaatgattttaatctggttgcaatgaaatataattatgaaccgctgacccaggatcatgttgatattctgggcccgctgtcagcacagaccggtattgcagttctggatatgtgtgcaagcctgaaagaactgcttcaaaatggcatgaatggtcgtaccattctgggtagcgcactgctggaagatgaatttaccccgtttgatgtggtgcgccagtgtagcggcgtgacctttcagtaa ctcgag (underlined portion is the enzyme cleavage site).

[0055] Example 2 Preparation of SARS-CoV main protease

[0056] This example provides a SARS-CoV main protease expression plasmid. The gene of SARS-CoV main protease was cloned into pET28a vector to construct an expression plasmid. The work was commissioned to Nanjing Kingsway Biotech Co., Ltd. The gene sequence encoding SARS-CoV main protease is shown as SEQ ID NO. 2. The size of the protein is 34 kDa.

[0057] SEQ ID NO. 2 (5'-3'):

[0058] ggatcctcactgagcggctttcgtaaaatggcctttccgtcaggcaaagtggaaggttgtatggttcaggtgacctgtggtaccaccaccttaaatggcctgtggttagatgataccgtgtattgtccgcgtcatgtgatttgtaccgcagaagatatgctgaatccgaattatgaggacctgctgattcgcaaaagtaatcatagctttttagttcaggccggcaatgttcagttacgtgttattggtcattcgatgcagaattgtctgctgcgcttaaaagtggatacctctaatccgaaaaccccgaaatataaatttgttcgtattcagccgggccagaccttttcagtgttagcctgttataatggctctccgagcggcgtgtatcagtgtgccatgcgcccgaatcataccattaaaggtagttttctgaatggctcttgtggtagcgtgggctttaatattgattatgattgtgtgagcttttgttatatgcatcacatggaactgccgaccggcgtccacgccggtaccgatctggaaggcaaattttatggcccgtttgttgatcgccagaccgcacaggcagcaggcaccgataccaccattaccttaaatgttttagcctggctgtatgcagccgtgattaatggcgatcgttggtttctgaatcgctttaccaccaccctgaatgattttaatttagttgccatgaaatataattatgaaccgttaacccaggatcatgttgatattctgggtccactcagtgcacagaccggtattgcagtgctggatatgtgtgcagcactgaaagaactgttacagaatggcatgaatggtcgcaccattctgggctcaaccattctggaagatgaatttaccccgtttgatgtggtgcgccagtgtagcggcgtgaccgaaggttaa ctcgag (underlined part is the enzyme cutting site).

[0059] Example 3 Preparation of MERS-CoV viral main protease

[0060] This example provides a MERS-CoV main protease expression plasmid, the gene of MERS-CoV main protease is cloned into pET28a vector to construct an expression plasmid, and this work is entrusted to Nanjing Kings River Biotechnology Co., Ltd. to complete. The gene sequence encoding MERS-CoV main protease is shown as SEQ ID NO. 3, and the size of the protein is 33 kDa.

[0061] SEQ ID NO. 3 (5'-3'):

[0062] ggatccagcggcttagtgaaaatgagtcatccgagcggcgatgtggaagcctgcatggtgcaggtgacgtgcggtagtatgacattaaatggtctgtggctggataataccgtttggtgtcctcgtcatgttatgtgtccagccgatcaactgagcgatccgaattatgatgccctgctgatctcaatgacaaatcatagctttagcgttcagaaacatatcggcgctccggccaatctgcgcgttgtgggtcatgccatgcagggcaccttactgaaactgaccgtggatgttgccaatccaagtacaccagcctatacctttacgaccgtgaaaccaggcgccgcattttcagttctggcctgctataatggtcgcccgaccggtacatttacggttgtgatgcgtcctaattatacgattaaaggctcttttctgtgcggttcttgcggctcagtgggctatacaaaagaaggtagcgttatcaatttttgctatatgcatcagatggaactggcgaatggtacacataccggtagtgcctttgatggcaccatgtatggcgcatttatggataaacaggttcatcaggtgcagctgacggataaatattgctcagttaatgtggttgcttggctgtatgccgcgattctgaatggctgcgcttggtttgttaaacctaatcgcacgagcgttgtgtcttttaatgaatgggccttagcaaatcagtttacggaatttgttggcacacagagtgttgatatgttagccgtgaaaacgggtgttgccatcgaacagttactgtatgctatccagcagctgtatacgggttttcagggcaaacagattctgggtagtaccatgttagaagatgaatttaccccggaagatgttaatatgcagatcatgggcgtggtgatgcagtaa ctcgag (underlined portion is the enzyme cleavage site).

[0063] Example 4 Preparation of HCOV-299E virus main protease

[0064] This example provides an HCOV-229E main protease expression plasmid. The gene of HCOV-229E main protease was cloned into pET28a vector to construct an expression plasmid. This work was commissioned to Nanjing Kingsri Biotechnology Co., Ltd. The gene sequence encoding HCOV-229E main protease is shown as SEQ ID NO. 4. The size of the protein is 33 kDa.

[0065] SEQ ID NO. 4 (5'-3'):

[0066] ggatccgctggtttgcgcaaaatggcacaaccatctggctttgtggagaaatgtgttgtccgtgtctgctatggaaacactgtgttgaatgggttgtggcttggtgatattgtttattgcccacgtcatgttatcgcatctaacacaacttctgctatagattatgatcacgaatatagtattatgcggttgcataatttttctataatatctggtacagcatttcttggtgttgtaggtgctactatgcatggagtaactcttaaaattaaggtttcacagactaacatgcacacacctagacattcttttagaacactaaaatctggtgaaggttttaacatcttagcatgctatgatggttgtgctcaaggtgtttttggtgtgaacatgagaactaattggactatccgtggttcatttattaatggtgcgtgtggttcccctggctacaatcttaaaaatggcgaggtggaatttgtttatatgcatcaaattgaactcggaagtggtagccatgtaggttctagctttgatggtgttatgtatggtggttttgaagaccaacctaatcttcaagttgaatctgcaaaccagatgttaacagttaatgtggttgcatttctttatgctgctatattgaatggttgcacatggtggcttaaaggtgaaaaattgtttgtggagcattataatgagtgggcacaggctaatggtttcacagctatgaatggtgaagacgctttttccattcttgctgctaaaactggtgtctgtgtggaaagattacttcatgctattcaagttttgaataatggctttggtggtaaacaaattttgggttattctagtctcaatgatgagttcagtattaatgaagttgtcaaacaaatgtttggtgttaacctgcaataa ctcgag (underlined part is the enzyme cutting site).

[0067] Example 5 Preparation of HCOV-HKU1 viral main protease

[0068] This example provides an HCOV-HKU1 main protease expression plasmid. The gene of HCOV-HKU1 main protease was cloned into pET28a vector to construct an expression plasmid. This work was commissioned to Nanjing Kingsway Biotech Co., Ltd. The gene sequence encoding HCOV-HKU1 main protease is shown as SEQ ID NO. 5. The size of the protein is 33 kDa.

[0069] SEQ ID NO. 5 (5'-3'):

[0070] ggatcctcaggtattgtaaagatggtatctcctacgtcaaaaattgaaccttgtattgttagtgttacttatggtagtatgactttgaatggtttatggttagatgacaaagtttattgtcctcgtcatgttatatgttcatcctctaatatgaacgaacctgattattctgccttattgtgtagagttactctaggtgattttactataatgtctggtcggatgagtttaacagttgtgtcttaccagatgcagggctgtcaacttgttttgacagtctctttacaaaatccttacactccaaaatatacttttggtaatgttaaacctggtgaaacttttactgttttagctgcgtataatggccgaccacaaggggcatttcatgttactatgcgtagtagttatactattaaaggttcttttttgtgtgggtcatgtggatctgttggttatgtattaacaggtgatagtgttaagtttgtatatatgcatcaattagagctcagtactggttgtcacactggcactgattttactggtaatttttatggtccatatagagatgctcaagttgtacagttgccagttaaggactacgtccagactgttaatgttattgcttggctctatgcagctatacttaataattgtgcttggtttgtacaaaatgatgtttgttctactgaagattttaatgtttgggctatggcaaatggttttagccaagtaaaagcagatcttgtcttagatgctttggcttcaatgacaggtgtttctattgaaactttattggctgctattaagcgtctatatatgggatttcaaggtcgtcaaatactaggaagttgtacttttgaagatgaattggcaccttctgacgtttatcaacaattggctggtgttaaattgcaataa ctcgag (underlined part is the enzyme cutting site).

[0071] Example 6 Preparation of HCOV-NL63 viral main protease

[0072] This example provides a HCOV-NL63 main protease expression plasmid, the gene of HCOV-NL63 main protease is cloned into pET28a vector to construct an expression plasmid, and this work is entrusted to Nanjing Kingsray Biotech Co., Ltd. The gene sequence encoding HCOV-NL63 main protease is shown as SEQ ID NO. 6, and the size of the protein is 33 kDa.

[0073] SEQ ID NO. 6 (5'-3'):

[0074] ggatcctctggtcttaagaagatggcacaaccatctggttgtgttgagagatgtgtggttcgcgtctgttatggtagtactgtgcttaatggagtttggttaggtgacactgttacttgtcctagacatgtcatagcaccatcaaccactgttcttattgattatgatcatgcatatagtactatgcgtttgcataatttttcagtgtctcataatggtgtcttcttgggagttgtcggtgttacaatgcatggttctgtgttgcgtattaaggtttcacaatctaatgtacatacacctaaacatgtttttaaaacgttgaaacctggtgattcttttaatattttagcatgttatgaaggtattgcatctggtgtttttggtgttaatttacgtacaaactttactattaaaggttcttttataaatggagcttgtggttctcctggttataatgttagaaatgatggtactgttgagttttgttatttacaccaaattgagttaggtagtggtgctcatgttggttctgattttactggtagtgtttatggtaattttgatgaccaacctagtttgcaagttgagagtgccaaccttatgctatcagataatgttgttgcctttttgtatgctgctttgttgaatggttgtaggtggtggttgtgttcaactagagttaatgttgatggttttaatgaatgggctatggctaatggttatacaagtgtttctagtgttgagtgctattctattttggcagcaaaaactggtgttagtgttgaacaattgttagcttccattcaacatcttcatgaaggttttggtggtaaaaacatacttggttattctagtttatgtgatgagttcacactagctgaagttgtgaagcagatgtatggtgttaacttgcaa ctcgag (underlined part is the enzyme cutting site).

[0075] Example 7 Purification of the main protease

[0076] This embodiment uses the main protease expression plasmids in Examples 1-6 to prepare the main proteases of each virus (SARS-CoV-2, SARS-CoV, MERS-CoV, HCoV-HKU1, HCoV-NL63 and HCoV-229E), including the following steps:

[0077] (1) Transform the main protease expression plasmids in Examples 1-6 into DH5a competent cells, respectively, and culture on LB plates containing 50 μg / mL antibiotic Kan + , select colonies, extract plasmids and screen positive monoclonals by enzyme digestion, and after verification, dry the extracted plasmids to obtain lyophilized powder of each virus main protease expression plasmid;

[0078] (2) Transformation of main protease expression plasmid

[0079] Centrifuge the lyophilized powder of each virus main protease expression plasmid in step (1) at 12000 rpm for 5 min, add 30 μL of deionized water, shake to dissolve, centrifuge at 12000 rpm for 10 min, take 2 μL of supernatant and mix with 100 μL of Escherichia coli BL21 Rosetta (DE3) competent strain, ice bath for 30 min, 42°C heat shock for 90 s, then ice bath for 2 min, then add 500 μL of LB liquid medium, culture at 37°C, 150 rpm on a shaker for 1 h, take 30 μL of culture liquid and spread on LB solid medium containing 50 μg / mL Kan + antibiotic, culture overnight in an incubator at a temperature of 37°C; select single colonies and add to LB liquid medium containing 50 μg / mL Kan + antibiotic, culture at 37°C, 200 rpm on a shaker for 8 h;

[0080] (3) Induced expression of main protease protein

[0081] Take 100 μL of culture liquid in step (2) into 100 mL of LB liquid medium containing 50 μg / mL Kan + antibiotic, culture overnight at 37°C, 200 rpm on a shaker; add all the overnight culture to 1000 mL of LB liquid medium containing 50 μg / mL Kan + antibiotic, culture at 37°C, 200 rpm on a shaker until the OD 600 is 0.6, add IPTG to a final concentration of 0.67 mM, induce at 30°C, 200 rpm for 5 h;

[0082] (4) Purification of main protease protein

[0083] After induction, centrifuge at 6000 rpm for 15 min, collect the precipitate, i.e., the bacterial body, weigh 4 g, resuspend in buffer 1 containing 100 mM Tris HCl (pH 7.5), 300 mM NaCl, 1 mM DTT, 10 mM imidazole at a ratio of buffer: bacterial weight = 10 mL: 1 g, high-pressure break the cells, centrifuge at 11000 rpm for 35 min, take the supernatant, discard the precipitate, and select a nickel column for protein purification. Before use, the nickel column is equilibrated with 20 times the column volume of buffer 2 containing 100 mM Tris HCl (pH 7.5), 300 mM NaCl, and 10 mM imidazole. Then, the supernatant obtained by centrifugation is passed through the column, and then 10 times the column volume of buffer 2 containing 0 mM, 50 mM, 100 mM, 150 mM, and 300 mM imidazole is used as an eluent for elution in sequence, and the eluent with different imidazole concentrations is collected. The eluent containing 150 mM and 300 mM imidazole contains the main protease. Then, the eluent with 150 mM and 300 mM imidazole is further purified on a Superdex 200 column (GE Healthcare) using buffer 3 containing 300 mM NaCl, 25 mM HEPES, 5 mM DTT, and 5% glycerol (fast protein liquid chromatography, FPLC). The results of the fast protein liquid chromatography are shown in FIG. 2, and the protein in the corresponding peak volume is collected and concentrated to 10 mg / mL using a 10 kDa molecular weight cutoff concentrator, thereby obtaining the main protease of each virus. The obtained protein is subjected to SDS-PAGE test, and the results are shown in FIG. 3. The protein size is consistent with the expected size, indicating that the main proteases of SARS-CoV-2, SARS-CoV, MERS-CoV, HCoV-HKU1, HCoV-NL63, and HCoV-229E are successfully prepared. Figures 1-6 Figures 7-12

[0084] Example 8 Inhibition results of compounds on SARS-CoV-2 WT, Delta, and Omicron real viruses

[0085] Cell plating:

[0086] VeroE6 cells were seeded into black 96-well flat-bottom plates at a cell density of 1.7-1.9 x 10 4 ​​The next day, the small molecules were dissolved in DMSO and serially diluted with three-fold dilutions over seven dilution steps (starting concentration of 2 mM, final concentration of 1 mM after incubation with virus), and the diluted small molecules were mixed with SARS-CoV-2 (80-100 FFU, focus forming units) in DMEM (Dulbecco's Modified Eagle Medium) containing 2% fetal bovine serum and incubated at 37°C for 1 hour. Then, 50 μl of the mixture was added to a 96-well plate seeded with VeroE6 cells and incubated at 37°C for 1 hour. The mixture with virus was discarded, and 100 μl of culture medium containing the corresponding drug concentration was added and incubated for 24 hours. The next day, 200 μl / well of 4% paraformaldehyde was added; the cells were fixed at room temperature for 1 hour. The fixing solution and culture medium were discarded, and the cells were covered with 4% paraformaldehyde and moved to a P3 laboratory. The fixing solution was discarded. The cells were washed with 200 μl / well of PBS three times. The cells were blocked and perforated with 1% BSA containing 0.2% Triton, 50 μl / well, at room temperature for 20-30 minutes, and washed with PBS three times.

[0087] Washing of the plate:

[0088] Primary antibody: 1% BSA diluted anti-SARS-N polyclonal antibody (Yiqiao God, 40143-T62), the primary antibody was diluted with BSA and glycerol three times, used at 1:2000, 50 μl / well, and incubated at 37°C for 1 hour. The primary antibody was discarded, and the plate was washed with PBST (0.1% Tween) three times, 150-200 μl / well, and the liquid was discarded. Secondary antibody: 1% BSA diluted Alexa Fluor 488 AffiniPure Donkey Anti-Rabbit IgG (H+L) (Jackson, 711-545-152, 1:500), 50 μl / well, incubated at 37°C for 1 hour on a shaker. Washing of the plate: The secondary antibody was discarded, and the plate was washed with PBST three times, 150-200 μl / well. The liquid was discarded.

[0089] DAPI staining:

[0090] DAPI (10 μg / ml) was diluted 5 times with PBS, 50 μl / well, at room temperature, protected from light, for 15 minutes. The plate was washed with PBS three times, and the last time was retained, covered with tin foil, and stored in the dark. The plate was scanned with an immunofluorescence scanner.

[0091] Table 1 below shows the results of the inhibition of the true virus by the compounds.

[0092] Table 1

[0093]

[0094] Figure 22A~C is the inhibitory effect of the compound on SARS-CoV-2 WT, Delta, Omicron true virus.

[0095] The original strain (WT), the Delta variant strain and the Omicron variant strain are derived from the Guangzhou Respiratory Disease National Key Laboratory of China.

[0096] Example 9 Inhibition of coronavirus main protease by shikonin or its derivatives

[0097] In this test example, the inhibitory effect of shikonin derivatives (β, β-dimethyl acryl shikonin, isovaleryl shikonin, β-hydroxy isovaleryl shikonin, acetyl shikonin, β, β-dimethyl acryl acetyl shikonin, deoxyshikonin, acetyl acetyl shikonin, alkanin) on SARS-CoV-2, SARS-CoV, MERS-CoV, HCoV-HKU1, HCoV-NL63 and HCoV-229E coronavirus main protease was tested by fluorescence resonance energy transfer (FRET) analysis.

[0098] The activity of shikonin derivatives against SARS-CoV-2, SARS-CoV, MERS-CoV, HCoV-HKU1, HCoV-NL63 and HCoV-229E main protease was measured by determining fluorescence, a donor group (EDANS) and a quenching group (DABCYL) were connected to the natural substrate of the main protease, when the enzyme was present, the substrate was cut by the main protease, the fluorescence group EDANS was free and could emit fluorescence at 490 nm under excitation light at 360 nm, when the enzyme was not present, the substrate could not be cut, and the fluorescence quenching group quenched the fluorescence group, so that no fluorescence could be detected.

[0099] Reaction process:

[0100] (1) Preparation of 200x compound solution:

[0101] Horizontal gradient dilution: each shikonin derivative stock solution (20 mM) was diluted with DMSO in a 3-fold dilution manner to obtain 200X compound at 9 concentration gradients (3 μL shikonin derivative stock solution + 6 μL DMSO), and the concentrations were:

[0102] 20 mM, 6.667 mM, 2.222 mM, 0.741 mM, 0.247 mM, 0.082 mM, 0.027 mM, 0.009 mM, 0.003 mM;

[0103] (2) 9 concentrations of 200x compound were diluted 20-fold to 10x compound (2 μL compound + 38 μL buffer) in buffer, and 2 μL of 10x compound was added to the final reaction system (20 μL) to dilute 10-fold to 1x compound, i.e. the final concentration of the compound was the concentration to be tested:

[0104] 100 μM, 33.333 μM, 11.111 μM, 3.704 μM, 1.235 μM, 0.412 μM, 0.137 μM, 0.046 μM, 0.015 μM;

[0105] The reaction system was:

[0106] Experimental group: main protease (1 μL) (200 nM) + 10x compound (2 μL) + buffer (15 μL), room temperature reaction for 30 min;

[0107] The buffer was 50 mM Tris (pH 7.3), 150 mM NaCl and 1 mM EDTA;

[0108] Blank control group (0%): buffer (18 μL), room temperature reaction for 30 min;

[0109] DMSO control group (100%): main protease (1 μL) + DMSO (2 μL) + buffer (15 μL), room temperature reaction for 30 min;

[0110] (3) Then add the FRET substrate to the reaction system, add 2 μL of main protease substrate to each well, centrifuge the 384-well plate, and react in the dark at room temperature for 20 min;

[0111] (4) Place the 384-well plate in the enzyme marker, select the Tune cartridge, FRET mode, and set the reading parameters: λexc / λem = 360 nm / 490 nm;

[0112] (5) Monitor the reaction for 60 min, and collect data every 10 min by linear regression;

[0113] (6) After reading, select the data when the enzyme activity reaches the highest value as the final processing data.

[0114] By using the dose response curve in the GraphPad Prism (v8.0) software, the initial velocity was plotted against various concentrations of the test inhibitors, and the IC50 of each baiyunoside derivative against each viral main protease was determined 50 , as shown in Table 2.

[0115] Table 2

[0116]

[0117] As shown in Table 1, β,β-dimethylacrylshikonin, isovalerylshikonin, β-hydroxyisovalerylshikonin, akalugin and acetylshikonin, β,β-dimethylacrylakalugin, deoxyshikonin, acetylakalugin, and purpurin all have obvious in vitro inhibitory effect on the main proteases of SARS-CoV-2, SARS-CoV, MERS-CoV, HCoV-HKU1, HCoV-NL63 and HCoV-229E, indicating that β,β-dimethylacrylshikonin, isovalerylshikonin, β-hydroxyisovalerylshikonin, akalugin and acetylshikonin, β,β-dimethylacrylakalugin, deoxyshikonin, acetylakalugin, and purpurin all have broad-spectrum antiviral effect.

[0118] In summary, the present application first discovers that shikonin derivatives β,β-dimethylacrylshikonin, isovalerylshikonin, β-hydroxyisovalerylshikonin, akalugin and acetylshikonin, β,β-dimethylacrylakalugin, deoxyshikonin, acetylakalugin, and purpurin all have broad-spectrum antiviral activity, and can be used as candidates for further development of antiviral drugs against one or more viruses in the future.

[0119] The applicant declares that the present application is illustrated by the above-mentioned embodiments, but the present application is not limited to the above-mentioned detailed methods, i.e. it does not mean that the present application must rely on the above-mentioned detailed methods to be implemented. It should be understood by those skilled in the art that any improvement of the present application, equivalent replacement of each raw material of the product of the present application, addition of auxiliary ingredients, selection of specific methods, etc. all fall within the protection scope and disclosure scope of the present application.

Claims

1. Use of a beta, beta-dimethylacryloyl acanin in the manufacture of a medicament against a mutant coronavirus; the mutant coronavirus being a Delta mutant or an Omicron mutant of the human coronavirus SARS-CoV-2.

Images