Penicillium glabrum HA5-32 and its application in the extraction of Hericium erinaceus polysaccharide
By using the HA5-32 strain of Penicillium photosporidium to perform microbial fermentation, the degree of growth in ceramus ceramus was controlled, and the problem of low polysaccharide extraction rate in the prior art was solved, and the effect of significantly improving the polysaccharide extraction rate was achieved.
Patent Information
- Application Number
- CN202311043673.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-18
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2043-08-18
AI Technical Summary
In the prior art, the yield rate of polysaccharides extracted from erectus cereus is low, and there are problems such as long extraction time, many times, and low efficiency and yield.
Microbial fermentation was performed by using Penicillium photosporidium HA5-32 strain. By controlling the growth degree of the strain, a variety of hydrolytic enzymes were generated to hydrolyze the cell wall of cephala vinegar without decomposing soluble polysaccharides, thereby improving the polysaccharide extraction rate.
The extraction rate of ceruleus polysaccharides was significantly improved, and the extraction rate was increased by 48.7% compared with the conventional method of fermentation pretreatment of Penicillium photosporidium HA5-32.
Smart Images

Figure CN117070372B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microbial fermentation, and particularly to Penicillium glabrum HA5-32 and its application in the extraction of polysaccharides from Hericium erinaceus Background Art
[0002] Hericium erinaceus is a fungus of the genus Hericium in the family Hydnaceae, which can produce fleshy fruiting bodies. Its shape is head-shaped or obovate, resembling a monkey's head, so it is named "Hericium erinaceus" or "Hericium caput-medusae". Hericium erinaceus is rich in nutritional components and belongs to both edible and medicinal fungi. In traditional Chinese medicine, it has the effects of benefiting the five internal organs and promoting digestion, and is mainly used to treat indigestion, neurasthenia, physical weakness, etc. The Chinese people have a history of more than three thousand years of consuming Hericium erinaceus. In ancient times, it was a precious food. In recent years, due to the gradual maturity of artificial cultivation techniques, the supply of Hericium erinaceus in the market has increased, and it has become an ordinary dish on people's tables.
[0003] Hericium erinaceus contains a variety of nutritional or active ingredients, including polysaccharides, oligosaccharides, polypeptides, nucleotides, sterols, fatty acids, erinacin, hericenone, etc., and has the effects of protecting the liver and stomach, lowering blood sugar, protecting nerves, enhancing human immunity, anti-cancer, antioxidant, etc. Among the active ingredients contained in Hericium erinaceus, the most concerned is the soluble polysaccharide. Its potential immunomodulatory, anti-tumor, anti-aging, and lipid-lowering effects make Hericium erinaceus one of the most promising food and medicine edible mushroom resources with health care functions at present.
[0004] At present, there are many research reports on the extraction methods of Hericium erinaceus polysaccharides. The common method is the hot water extraction and ethanol precipitation method (abbreviated as "water extraction and alcohol precipitation method"). The conventional hot water extraction method has the advantages of simple operation and low cost, but has the disadvantages of long extraction time, multiple extraction times, low extraction efficiency and yield.
[0005] In recent years, enzymatic hydrolysis technology has been widely used in the extraction of natural active substances. It has the advantages of mild conditions, little damage to the structure of active ingredients, and can significantly improve the extraction yield of products. Among the enzymatic hydrolysis-assisted extraction methods, the most commonly used is cellulase, followed by pectinase and protease, or multiple enzymes are used simultaneously. The cell wall of plants or edible fungi consists of substances such as cellulose, hemicellulose, lignin, and pectin. Therefore, the use of a single enzyme has very limited effect on improving the extraction yield of products. Many studies use multiple enzymes (complex enzymes) simultaneously. If the amount of enzyme used is large, it will undoubtedly increase the extraction cost.
[0006] Natural substances in nature are decomposed and decayed by microorganisms. These microorganisms can produce various enzymes during growth that decompose plant or edible (medicinal) mushroom tissues, including cellulase, hemicellulase, ligninase, pectinase, protease, etc. However, relying on the action of microorganisms to improve the yield of polysaccharide extraction from Hericium erinaceus has not been effectively applied yet. Summary of the Invention
[0007] Currently, the yield of extracting polysaccharide substances from Hericium erinaceus is low. To solve this technical problem, the present invention provides a Penicillium glabrum HA5-32 and its application in the extraction of Hericium erinaceus polysaccharide.
[0008] One of the purposes of the present invention is to provide a new microbial strain, Penicillium glabrum HA5-32. By inoculating this strain into Hericium erinaceus for microbial fermentation, the extraction yield of polysaccharide in Hericium erinaceus can be greatly improved.
[0009] Another purpose of the present invention is to provide a method for the application of Penicillium glabrum HA5-32 in the extraction of Hericium erinaceus polysaccharide, that is, controlling the growth degree of Penicillium glabrum HA5-32 to achieve enzymatic hydrolysis of the cell wall of Hericium erinaceus without decomposing soluble polysaccharides, thereby promoting the dissolution of Hericium erinaceus polysaccharide and ultimately improving the extraction yield.
[0010] The specific technical solution of the present invention is as follows:
[0011] On the one hand, the present invention provides a Penicillium glabrum HA5-32, and its preservation number is GDMCC No: 63392.
[0012] The strain HA5 was isolated from the microbial enrichment culture of Hericium erinaceus powder in the present invention. After ultraviolet mutagenesis, the strain HA5-32, namely Penicillium glabrum HA5-32, was screened. This strain is preserved in the Guangdong Provincial Microbial Culture Collection Center, with the preservation number GDMCC No: 63392, the preservation date being April 24, 2023, and the address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Guangdong Province; Zip code 510070. The present invention provides a new microbial strain, Penicillium glabrum HA5-32. By inoculating this strain into Hericium erinaceus for microbial fermentation, the extraction yield of polysaccharide in Hericium erinaceus can be greatly improved.
[0013] Among them, the nucleotide sequence of the ribosomal DNA internal transcribed spacer of the Penicillium glabrum HA5-32 is as shown in SEQ ID NO.1.
[0014] On the other hand, the present invention provides the application of the above-mentioned Penicillium glabrum HA5-32 in the extraction of polysaccharides from Hericium erinaceus.
[0015] The present invention provides a new microbial strain, Penicillium glabrum HA5-32, which is purposefully isolated and screened for its ability to hydrolyze the cell wall of Hericium erinaceus and obtained through mutagenesis. Penicillium glabrum HA5-32 can produce various enzymes that decompose the cell wall of Hericium erinaceus during its growth, including cellulase, hemicellulase, pectinase, protease, etc. Therefore, on the premise of screening a dominant strain for the extraction of polysaccharides from Hericium erinaceus, directly fermenting Hericium erinaceus pretreated with this strain, as long as the growth degree is well controlled to achieve the hydrolysis of the cell wall of Hericium erinaceus by the produced enzymes but without decomposing the soluble polysaccharides, the dissolution of polysaccharides from Hericium erinaceus can be promoted, and the extraction yield can be increased.
[0016] Specifically, the present invention also provides a method for the above application, including the following steps:
[0017] (1) Add the spore solution of Penicillium glabrum HA5-32 to Hericium erinaceus powder, mix well and then ferment to obtain a Hericium erinaceus fermentation product;
[0018] (2) Add deionized water to the Hericium erinaceus fermentation product, stir well, then carry out heat preservation treatment and ultrasonic treatment, and after filtration and concentration, obtain a water extract concentrate of Hericium erinaceus;
[0019] (3) Add ethanol to the water extract concentrate of Hericium erinaceus to obtain a precipitate, and the precipitate is washed and dried to obtain Hericium erinaceus polysaccharides.
[0020] Through the above steps (1) to (3), the extraction yield of polysaccharides during the ultrasonic water extraction of Hericium erinaceus can be significantly improved. In step (1), Penicillium glabrum HA5-32 grows moderately in Hericium erinaceus powder added with sucrose and produces various hydrolytic enzymes; then, in step (2), the fermented Hericium erinaceus powder is added with water and subjected to heat preservation treatment, and substances such as cellulose in the cell wall are partially hydrolyzed, which helps the bound polysaccharides in Hericium erinaceus to dissolve during ultrasonic water extraction, thereby significantly improving the extraction yield of polysaccharides. Specifically:
[0021] In step (1), after inoculating the spore solution of Penicillium glabrum HA5-32 into Hericium erinaceus powder, ferment to make the growth of Penicillium glabrum HA5-32 just reach the appropriate degree for enzyme production.
[0022] In step (2), after adding deionized water to the Hericium erinaceus fermentation product, carry out heat preservation treatment and ultrasonic treatment to reach the degree of just hydrolyzing substances such as cellulose in the cell wall of Hericium erinaceus but without decomposing the soluble polysaccharides.
[0023] As a preference of the above technical solution of the present invention, in step (1), the temperature of the fermentation is 28 - 32 °C and the time is 48 - 60 h.
[0024] After inoculating Hericium erinaceus powder with Penicillium glabrum HA5-32 spore liquid and fermenting at 28-32 °C for 48-60 h, the growth of Penicillium glabrum HA5-32 can just reach the appropriate degree for enzyme production.
[0025] As a preference for the above technical solution of the present invention, in step (2), the added volume of deionized water is 20-30 mL / g based on the mass of Hericium erinaceus powder before fermentation; the temperature of the heat preservation treatment is 32-36 °C and the time is 3-5 h.
[0026] After adding deionized water to the Hericium erinaceus fermented product and keeping it warm at 32-36 °C for 3-5 h, it can just reach the degree of hydrolyzing substances such as cellulose in the cell wall of Hericium erinaceus but not decomposing soluble polysaccharides.
[0027] As a preference for the above technical solution of the present invention, in step (1), the concentration of the Penicillium glabrum HA5-32 spore liquid is 1×10 7 ~2×10 7 CFU / mL.
[0028] As a preference for the above technical solution of the present invention, based on the mass of Hericium erinaceus powder, in step (1), the added volume of the Penicillium glabrum HA5-32 spore liquid is 4-6 mL / g.
[0029] As a preference for the above technical solution of the present invention, the preparation method of the Penicillium glabrum HA5-32 spore liquid is: inoculating Penicillium glabrum HA5-32 spores on a potato dextrose agar plate medium, culturing at a constant temperature of 28-30 °C for 60-72 h to obtain a culture, and then adding a sterile sucrose aqueous solution to the culture and stirring to suspend the spores to obtain a spore liquid.
[0030] As a preference for the above technical solution of the present invention, in step (2), the temperature of the ultrasonic treatment is 75-85 °C, the power is 160-200 W, and the time is 60-90 min.
[0031] After adding deionized water to the Hericium erinaceus fermented product for heat preservation treatment and then performing ultrasonic treatment, it is helpful to extract polysaccharides from the fermented product that has just reached the degree of hydrolyzing substances such as cellulose in the cell wall of Hericium erinaceus but not decomposing soluble polysaccharides.
[0032] As a preference for the above technical solution of the present invention, in step (2), the concentration conditions are: concentrating under reduced pressure to 1 / 25-1 / 20 of the original volume.
[0033] As a preference of the above technical solution of the present invention, step (3) is: adding anhydrous ethanol with a volume 4 - 5 times that of the Hericium erinaceus aqueous extract concentrate to make the ethanol volume fraction of the system 80% - 83.3%, then standing still at 0 - 4°C for 16 - 20 h to obtain a precipitate, and then washing the precipitate with anhydrous ethanol and vacuum drying to constant weight to obtain Hericium erinaceus polysaccharide.
[0034] Compared with the prior art, the present invention has the following technical effects:
[0035] The present invention provides a new microbial strain Penicillium glabrum HA5 - 32, which is purposefully isolated and screened for its ability to hydrolyze the cell wall of Hericium erinaceus and obtained through mutagenesis, and is applied to improve the extraction yield of Hericium erinaceus polysaccharide with remarkable effects.
[0036] The present invention also provides an application method of Penicillium glabrum HA5 - 32 in the extraction of Hericium erinaceus polysaccharide. By Penicillium glabrum HA5 - 32 in Hericium erinaceus powder added with sucrose, optimizing the fermentation conditions to make it grow moderately and produce various hydrolases, achieving enzymatic hydrolysis of the cell wall of Hericium erinaceus without decomposing soluble polysaccharides, and finally improving the polysaccharide extraction yield. Using this method, compared with the conventional ultrasonic extraction method without fermentation pretreatment with Penicillium glabrum HA5 - 32, the polysaccharide extraction yield in Hericium erinaceus can be increased by 48.7%. Description of the Drawings
[0037] Figure 1 The standard curve for determining polysaccharide by the phenol - sulfuric acid method with glucose as the standard.
[0038] Figure 2 The standard curve for determining glucose by the DNS method in Example 2 of the present invention.
[0039] Figure 3 The colony morphology photo of Penicillium glabrum HA5 - 32 cultured on PDA at 28°C for 3 d in Example 3 of the present invention. Detailed Embodiments
[0040] The present invention will be further described below in conjunction with the embodiments and the drawings. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are usually only some embodiments of the present invention, rather than all embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art without creative efforts based on the embodiments of the present invention shall fall within the scope of protection of the present invention.
[0041] In the embodiments and comparative examples of the present invention, the Hericium erinaceus used is the fruiting body of the fungus Hericium erinaceus belonging to the genus Hericium in the family Hydnaceae; the Hericium erinaceus powder is the fine powder obtained by drying Hericium erinaceus at 85 °C and then pulverizing it through a 40-mesh sieve.
[0042] In the embodiments and comparative examples of the present invention, the content of Hericium erinaceus polysaccharide was determined by the phenol-sulfuric acid method. The specific method was as follows: The test sample solution was appropriately diluted with deionized water (estimating that the concentration of polysaccharide in the sample was within the range of the standard curve determination); the solid Hericium erinaceus polysaccharide extract was formulated into a sample solution with a concentration of 0.1 mg / mL with deionized water as the test sample. Pipette 1 mL of the sample solution into a 10-mL stoppered tube, add 1 mL of a 5% aqueous phenol solution by volume, shake well, and then quickly add 5 mL of concentrated sulfuric acid (mass concentration 98%), shake well, place in a boiling water bath and heat for 15 min, and cool to room temperature. Using the same treatment with 1 mL of deionized water as the blank control as the reference, measure the absorbance (A 490 ) at a wavelength of 490 nm. Measure the A 490 of glucose samples with different concentrations in the same way, 490 plot the glucose concentration - A Figure 1 standard curve. As 2 shown, the regression equation y = 0.0124x + 0.0057 (R
[0043] = 0.9990) was obtained, and the content of polysaccharide in the Hericium erinaceus polysaccharide sample was calculated from the regression equation.
[0044]
[0045] Isolation and screening of microbial strains for fermented Hericium erinaceus in Example 1
[0046] The microbial strains for fermented Hericium erinaceus were obtained by isolation and screening according to the following steps:
[0047] (1) Add 5 g of Hericium erinaceus powder to a 250-mL Erlenmeyer flask, then add 20 mL of sterile normal saline to moisten it, and incubate at 28 °C for 72 h. Dilute the enriched culture full of molds with sterile normal saline by 1×10 -5 , 1×10 -6 , 1×10 -7 , 1×10 -8After 2 times, 0.1 mL of the dilution was respectively applied to a potato dextrose agar plate medium (PDA), and cultured at 28°C for 60 h. During this period, mold colonies with different colors and morphologies were picked and transferred to fresh PDA plate medium, and cultured at 28°C for 72 h to obtain 9 pure culture strains. The numbers of each strain are shown in Table 1. Among them, the PDA plate medium is a finished potato dextrose agar medium (Qingdao Haibo Biotechnology Co., Ltd.), prepared with tap water at a concentration of 46 g / L, with a natural pH, in a triangular flask, tied with 8 layers of gauze, sterilized at 121°C by high-pressure steam for 20 min, and poured into a sterile culture dish with a diameter of 9 cm before solidification, 20 mL per dish;
[0048] (2) Add 10 mL of sterile sucrose aqueous solution to each of the fresh plate cultures of the nine strains, stir with an inoculating loop to suspend the spores, transfer the spore solution to a sterile test tube, and adjust the spore concentration with sterile sucrose aqueous solution so that the spore concentration of the spore solution of the different strains is between 1 × 10 7 ~2×10 7 The concentration of the sterile sucrose aqueous solution was 25 g / L, and the high-pressure steam was sterilized at 115°C for 20 min.
[0049] (3) Add 2 g of Hericium erinaceus powder to 9 100 mL Erlenmeyer flasks sterilized by dry heat at 160° C. for 2 h, and then add 8 mL of each mold spore solution prepared in step (2) (the volume dosage is 4 mL / g based on the mass of Hericium erinaceus powder) to each flask. After stirring evenly, seal the flask with 8 layers of gauze and culture at 30° C. for 54 h to obtain Hericium erinaceus fermentation product.
[0050] (4) In step (3), 40 mL of deionized water (solid-liquid ratio of 1 g:20 mL) was added to all the Hericium erinaceus powder fermented by each strain, stirred evenly, kept warm in a 32°C water bath for 5 h, and then transferred to an ultrasonic cleaner at 75°C for 90 min at 160 W. After the ultrasonic water extraction, the mixture was filtered with a hot Buchner funnel, 1 mL of the filtrate was taken into a 10 mL centrifuge tube, and 5 mL of anhydrous ethanol (the ethanol volume fraction of the solution was 83.3%) was added. After sufficient shaking, the mixture was allowed to stand at 0°C for 16 h, and then centrifuged at 4°C and 8000 r / min for 5 min, the supernatant was discarded, 5 mL of deionized water was added for dissolution, and the soluble polysaccharide content in the aqueous solution was determined by the phenol-sulfuric acid method.
[0051] According to the above steps (3) and (4), 8 mL of sterile sucrose solution (concentration 25 g / L) was added to 2 g of Hericium erinaceus powder to serve as a blank fermentation control without inoculation of mold; according to the above step (4), 2 g of Hericium erinaceus was added to 40 mL of deionized water to directly extract polysaccharides to serve as a non-fermented extraction control. The polysaccharide extraction yields of Hericium erinaceus fermented with different strains and the control are shown in Table 1.
[0052] Table 1 Polysaccharide extraction yields of Hericium erinaceus fermented by different strains and the control
[0053] Serial number Strain number and control Yield of polysaccharide extraction (%) Improvement rate (%) 1 HA1 9.31 11.6 2 HA2 8.33 -0.12 3 HA3 9.70 16.3 4 HA4 9.06 8.63 5 HA5 10.3 23.5 6 HA6 8.49 1.80 7 HA7 8.82 5.76 8 HA8 9.46 13.4 9 HA9 8.37 0.36 10 Blank fermentation control 8.55 2.52 11 Unfermented control 8.34 /
[0054] As can be seen from the data in Table 1, for the blank fermentation control with sterile sucrose aqueous solution added but no mold inoculated, since almost no mold grew, the polysaccharide extraction yield had no significant difference from that of the unfermented control; after fermentation of Hericium erinaceus by most strains, the polysaccharide extraction yield did not increase significantly; after fermentation of Hericium erinaceus by strain HA5, the polysaccharide extraction yield was 10.3%, which was 23.5% higher than 8.34% of the unfermented control. Therefore, the present invention selected strain HA5 as the microbial strain for fermenting Hericium erinaceus to conduct subsequent mutagenesis breeding to further improve the polysaccharide extraction yield.
[0055] Example 2 Mutagenesis breeding of the microbial strain for fermenting Hericium erinaceus
[0056] Mutagenesis breeding was carried out on strain HA5 to screen for strains with better fermentation performance. The specific method was as follows:
[0057] (1) Preparation of spore suspension: Strain HA5 was activated and cultured on a PDA plate medium at 30 °C for 48 h, 5 mL of sterile normal saline was added, and the spores were suspended by stirring with an inoculation loop. 1 mL of the spore suspension was transferred to a triangular flask containing 50 mL of sterile normal saline (with 20 - 30 glass beads added), and shaken at room temperature for 15 min. The spore suspension was filtered to remove the mycelium (a small mass of fluffy absorbent cotton was plugged at the bottom of the triangular funnel), the spores in the spore suspension were counted using a hemocytometer under a microscope, and appropriately diluted with sterile normal saline to adjust the spore concentration to 1.32×10 7 spores / mL;
[0058] (2) Mutagenesis: Under red light illumination, 1.5 mL of the above spore suspension and a sterile paper clip were respectively placed in 6 petri dishes with a diameter of 6 cm. The petri dishes were respectively placed on a magnetic stirrer, and irradiated at a distance of 30 cm from a 15 W ultraviolet lamp preheated for 30 min for 1, 2, 3, 4, 5, and 6 min respectively. 0.5 mL of the spore suspension after the above irradiation treatment was taken, appropriately diluted, and 0.1 mL was respectively pipetted and spread on the PDA plate medium. Using the same operation, the spore suspension without ultraviolet irradiation was diluted and spread on the plate as a control to calculate the lethality rate. The inoculated PDA plates were wrapped with black cloth and inverted and cultured at 28 °C for 48 h, the colonies on the plates were counted, and the lethality rate was calculated;
[0059] (3) Screening: Colonies on PDA plates with a lethality rate above 90% were picked and transferred to fresh PDA plate media, and cultured at 28 °C for 72 h to obtain 50 strains. In the fresh plate cultures of each strain, 10 mL of sterile normal saline was added respectively, and the spores were suspended by stirring with an inoculation loop to obtain the spore suspensions of each strain. 2.5 mL of the spore suspension of each strain was inoculated into 50 mL of enzyme-producing medium, and cultured with shaking at 30 °C and 200 r / min for 72 h. The fermentation broth was filtered by Buchner funnel, and the filtrate (i.e., crude enzyme solution) was collected, and the cellulase activity of the crude enzyme solution of each strain was measured. Ten strains with significantly increased enzyme production activity compared to the original strain HA5 were selected. Then, according to the method of Example 1, the spore suspensions of these strains were used to inoculate Hericium erinaceus powder for fermentation, and the polysaccharides were extracted by water extraction and alcohol precipitation. The polysaccharide extraction yields of Hericium erinaceus fermented by mutant strains and the control are shown in Table 2;
[0060] Among them, the composition of the enzyme-producing medium is: wheat bran 50 g / L, (NH4)2SO4 6 g / L, peptone 4 g / L, KH2PO4 2 g / L, MgSO4·7H2O 1 g / L, CaCl2 0.5 g / L, the solvent is tap water, and the pH is 6.0. 50 mL of the enzyme-producing medium was filled in a 250 mL triangular flask, sealed with 8 layers of gauze, and sterilized at 121 °C under high pressure steam for 20 min.
[0061] Table 2 Polysaccharide extraction yields of Hericium erinaceus fermented by mutant strains and the control
[0062]
[0063] It can be seen from the data in Table 2 that among the 10 selected strains, the strain numbered HA5-32 has a cellulase activity of 45.2 U / mL in fermentation, which is 38.2% higher than that of the wild strain HA5 (32.7 U / mL). After fermenting Hericium erinaceus with this strain, the polysaccharide extraction yield is 12.2%, which is 18.5% higher than that of the wild strain HA5 (10.3%), and 46.3% higher than that of the unfermented control (8.34%). Therefore, the present invention selects the HA5-32 strain as the microbial strain for fermenting Hericium erinaceus, and optimizes the extraction conditions to improve the polysaccharide extraction yield.
[0064] Among them, the method for measuring cellulase activity is: 1.5 mL of 10 g / L sodium carboxymethylcellulose solution (pH 6.0, prepared with 0.2 mol / L phosphate buffer) and 0.5 mL of crude enzyme solution were respectively added to a 10 mL graduated test tube, incubated in a water bath at 50 °C for 30 min, then 3 mL of DNS reagent was added, boiled for 5 min, cooled with running water, and made up to 10 mL with deionized water and stirred evenly; the crude enzyme solution inactivated by boiling at 100 °C for 10 min was treated in the same way as the reference, and the absorbance (A 540 ) was measured at a wavelength of 540 nm with a spectrophotometer. From the glucose standard curve (such asFigure 2 Calculate the glucose concentration in the sample as shown, and then calculate the cellulase activity (U / mL). Definition of cellulase activity: Under the conditions of pH 6.0 and 50 °C, the amount of enzyme required to hydrolyze sodium carboxymethyl cellulose to produce 1 μmol of glucose per minute is 1 enzyme activity unit (U).
[0065] The formula for calculating cellulase activity is: U = (CV1) / (TV2). Where, C is the glucose concentration (μmol / mL) calculated from the standard curve; V1 is the volume of the enzyme reaction system, which is 2 mL; T is the reaction time, which is 30 min; V2 is the volume of the crude enzyme solution, which is 0.5 mL.
[0066] Among them, the drawing of the glucose standard curve: In 7 10-mL graduated test tubes, add 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 mL of a standard glucose aqueous solution with a concentration of 5 μmol / mL respectively, then add 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, 0.8 mL of 0.2 mol / L phosphate buffer solution with pH 6.0 to each, and then add 3.0 mL of DNS solution to each. The mixed solution is boiled in a boiling water bath for 5 min, cooled with running water, and then made up to 10 mL with deionized water, stirred evenly, and the color-developing solution in the test tube without glucose is used as the reference, and the absorbance A is measured with a spectrophotometer. 540 Using the glucose concentration as the abscissa and A 540 as the ordinate to draw the standard curve, as shown in Figure 2 shown, the regression equation is y = 0.25246x + 0.01487 (R 2 = 0.9995).
[0067] Among them, the preparation method of DNS reagent is: Add 6.3 g of 3,5-dinitrosalicylic acid and 262 mL of 2 mol / L NaOH aqueous solution to 500 mL of a hot aqueous solution containing 182 g of sodium tartrate, then add 5 g of redistilled phenol and 5 g of sodium sulfite, stir to dissolve, cool and make up to 1 L with deionized water, store in a brown bottle, and use after 7 days.
[0068] Example 3 Classification and Identification of Strain HA5-32
[0069] The strain HA5-32 was streaked on a PDA plate medium and cultured at 28 °C. Initially, the mycelium was white, the colony was flat, the texture was floccose to granular, there were a large number of conidia on the surface, grayish-green, without exudate; the reverse side was light yellowish-brown, without soluble pigment; the stipe wall was smooth, and the top was enlarged; the penicillus was single-verticillate, occasionally with basal-like branches; the phialides were flask-shaped, 8-16 per whorl, sized 8.0-11 μm × 2.5-3.0 μm; the conidia were spherical or nearly spherical, 2.5-3.5 μm in diameter, with a smooth or nearly smooth wall; among them, the colony morphology photo of Penicillium glabrum HA5-32 cultured on PDA at 28 °C for 3 days is shown in Figure 3 . Among them, the composition and preparation method of the PDA plate medium were the same as those in Example 1.
[0070] The nucleotide sequence of the ribosomal DNA internal transcribed spacer (rDNA-ITS) of the strain HA5-32 was shown as SEQ ID NO.1. This sequence was subjected to BLAST alignment on NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov), and had a homology greater than 99.8% with the rDNA-ITS sequences of the known typical strains Penicillium glabrum CBS125543 and Penicillium bussumense CBS138160. Based on the colony morphological characteristics of the strain HA5-32, it more conforms to the morphological characteristics of Penicillium glabrum (smooth-spored penicillium). Therefore, the biological classification position of the strain HA5-32 can be determined (refer to Mycobank, http: / / www.mycobank.org): Fungi, Ascomycota, Eurotiomycetes, Eurotiales, Aspergillaceae, Penicillium, Penicillium glabrum.
[0071] The rDNA-ITS nucleotide sequence of the strain HA5-32 was shown as SEQ ID NO.1. The rDNA-ITS nucleotide sequence of the strain HA5-32 was as follows:
[0072] CCACCCGTGTTTATTGTACCTTGTTGCTTCGGTGCGCCCGCCTCACGGCCGCCGGGGGG
[0073] CTTCTGCCCCCGGGTCCGCGCGCACCGGAGACACTATTGAACTCTGTCTGAAGATTGCA
[0074] GTCTGAGCATAAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATC
[0075] GATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATC
[0076] GAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGT
[0077] CATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCCCCCGGGGACGGGTCCG
[0078] AAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCT
[0079] GTAGGCCCGGCCGGCGCCAGCCGACAACCAATCATCCTTTTTTCAGGTTGACCTCGGAT
[0080] CAGGTAGGGATACCCGCTGAACTTAAGCATATCATAAAGACGCAGTATGAAGTCAGGTG
[0081] GGATTACC。
[0082] In summary, strain HA5 was isolated from the microbial enrichment culture of Hericium erinaceus powder. After ultraviolet mutagenesis, strain HA5-32, namely Penicillium glabrum HA5-32, was screened. This strain was deposited in the Guangdong Microbial Culture Collection Center, with the deposit number GDMCC No: 63392, the deposit date of April 24, 2023, and the address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Guangdong Province; Postcode 510070.
[0083] Example 4 Application of Penicillium glabrum HA5-32 in the Extraction of Hericium erinaceus Polysaccharide
[0084] Penicillium glabrum HA5-32 is applied to the extraction of polysaccharide from Hericium erinaceus, and the operation is carried out according to the following steps:
[0085] (1) The spores of the Penicillium glabrum HA5-32 colonies on the PDA plate stored at 4 °C were inoculated onto a fresh PDA plate medium and incubated at a constant temperature of 28 °C for 66 h. 10 mL of sterile sucrose aqueous solution was added to the petri dish, and the spores were suspended by stirring with an inoculation loop. The spore suspension was transferred to a sterile test tube, and the spore concentration was adjusted to 1.55×10 7 CFU / mL with sterile sucrose aqueous solution to obtain the Penicillium glabrum HA5-32 spore suspension. The composition and preparation method of the PDA plate medium were the same as those in Example 1; the concentration of the sterile sucrose aqueous solution was 20 g / L, and it was sterilized at 115 °C for 20 min by high-pressure steam;
[0086] (2) 10 g of Hericium erinaceus powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 50 mL of the Penicillium glabrum HA5-32 spore suspension prepared in step (1) (the volume dosage was 5 mL / g based on the mass of Hericium erinaceus powder) was added and stirred evenly. The Erlenmeyer flask was sealed with 8 layers of gauze and cultured at 30 °C for 54 h to obtain the Hericium erinaceus fermented product;
[0087] (3) All of the Hericium erinaceus fermented product from step (2) was transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g:25 mL), and after stirring evenly, it was kept warm in a water bath at 34 °C for 4 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 80 °C and ultrasonically extracted at 180 W for 75 min. Immediately after that, it was filtered by Buchner funnel while it was hot. All of the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of Hericium erinaceus;
[0088] (4) To all of the concentrated aqueous extract of Hericium erinaceus obtained in step (3), 40 mL of absolute ethanol (4 times the volume of the concentrated extract, and the ethanol volume fraction in the system was 80%) was added. After standing at 2 °C for 18 h, it was centrifuged at 4 °C and 8000 r / min for 10 min. The supernatant was discarded, the precipitate was washed once with 20 mL of absolute ethanol (the volume dosage was 2 mL / g based on the mass of Hericium erinaceus powder), and centrifuged again. The precipitate was dried to a constant weight at 65 °C and -0.1 MPa under vacuum to obtain the Hericium erinaceus polysaccharide extract.
[0089] Example 5 Application of Penicillium glabrum HA5-32 in the extraction of Hericium erinaceus polysaccharide
[0090] The Penicillium glabrum HA5-32 was applied to the extraction of polysaccharide from Hericium erinaceus, and the operation was carried out according to the following steps:
[0091] (1) The spores of Penicillium glabrum HA5-32 preserved at 4 °C on a PDA plate colony were inoculated onto a fresh PDA plate medium and incubated at a constant temperature of 28 °C for 72 h. Add 10 mL of sterile sucrose aqueous solution to the petri dish, stir with an inoculation loop to suspend the spores, transfer the spore solution to a sterile test tube, and adjust the spore concentration to 1.85×10 7 CFU / mL with sterile sucrose aqueous solution to obtain the spore solution of Penicillium glabrum HA5-32. The composition and preparation method of the PDA plate medium are the same as in Example 1; the concentration of the sterile sucrose aqueous solution is 25 g / L, and it is sterilized by high-pressure steam at 115 °C for 20 min;
[0092] (2) 10 g of Hericium erinaceus powder was placed in a 250 mL Erlenmeyer flask sterilized by dry heat at 160 °C for 2 h, and 40 mL of the spore solution of Penicillium glabrum HA5-32 prepared in step (1) (the volume dosage is 4 mL / g based on the mass of Hericium erinaceus powder) was added and stirred evenly. The Erlenmeyer flask was tied with 8 layers of gauze and cultured at 32 °C for 48 h to obtain the Hericium erinaceus fermented product;
[0093] (3) All of the Hericium erinaceus fermented product from step (2) was transferred into a 500 mL beaker, 200 mL of deionized water was added (the solid-liquid ratio is 1 g:20 mL), and after stirring evenly, it was kept warm in a water bath at 32 °C for 5 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 75 °C and ultrasonically extracted at 160 W for 90 min. Immediately after that, it was filtered by suction through a Buchner funnel while it was hot, and all the filtrate was concentrated under reduced pressure to 10 mL (1 / 20 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of Hericium erinaceus;
[0094] (4) To all of the concentrated aqueous extract of Hericium erinaceus obtained in step (3), 40 mL of absolute ethanol (4 times the volume of the concentrated extract, and the ethanol volume fraction in the system is 80%) was added. After standing at 0 °C for 16 h, it was centrifuged at 4 °C and 8000 r / min for 10 min. The supernatant was discarded, the precipitate was washed once with 15 mL of absolute ethanol (the volume dosage is 1.5 mL / g based on the mass of Hericium erinaceus powder), centrifuged again, and the precipitate was vacuum dried at 65 °C and -0.1 MPa to constant weight to obtain the Hericium erinaceus polysaccharide extract.
[0095] Example 6 Application of Penicillium glabrum HA5-32 in the extraction of Hericium erinaceus polysaccharide
[0096] The application of Penicillium glabrum HA5-32 in the extraction of polysaccharides from Hericium erinaceus is carried out according to the following steps:
[0097] (1) Spores from the PDA plate colony of Penicillium glabrum HA5-32 stored at 4 °C were inoculated onto a fresh PDA plate medium and incubated at a constant temperature of 30 °C for 60 h. 10 mL of sterile sucrose aqueous solution was added to the petri dish, and the spores were suspended by stirring with an inoculation loop. The spore suspension was transferred to a sterile test tube, and the spore concentration was adjusted to 1.43×10 7 CFU / mL with sterile sucrose aqueous solution to obtain the spore suspension of Penicillium glabrum HA5-32. The composition and preparation method of the PDA plate medium were the same as in Example 1; the concentration of the sterile sucrose aqueous solution was 15 g / L, and it was sterilized by high-pressure steam at 115 °C for 20 min;
[0098] (2) 10 g of Hericium erinaceus powder was placed in a 250 mL Erlenmeyer flask that had been dry-heat sterilized at 160 °C for 2 h. 60 mL of the spore suspension of Penicillium glabrum HA5-32 prepared in step (1) (the volume dosage was 6 mL / g based on the mass of Hericium erinaceus powder) was added and stirred evenly. The Erlenmeyer flask was sealed with 8 layers of gauze and cultured at 28 °C for 60 h to obtain the Hericium erinaceus fermented product;
[0099] (3) All of the Hericium erinaceus fermented product from step (2) was transferred to a 500 mL beaker, 300 mL of deionized water was added (the material-liquid ratio was 1 g:30 mL), and after stirring evenly, it was kept warm in a water bath at 36 °C for 3 h. Then, the beaker was transferred to an ultrasonic cleaner with a water temperature of 85 °C, and ultrasonic extraction was carried out at 200 W for 60 min. Immediately after that, it was filtered by suction through a Buchner funnel while it was hot. All of the filtrate was concentrated under reduced pressure to 12 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated aqueous extract of Hericium erinaceus;
[0100] (4) To all of the concentrated aqueous extract of Hericium erinaceus obtained in step (3), 48 mL of absolute ethanol (4 times the volume of the concentrated extract, and the ethanol volume fraction in the system was 80%) was added. After standing at 4 °C for 20 h, it was centrifuged at 4 °C and 8000 r / min for 10 min. The supernatant was discarded, the precipitate was washed once with 20 mL of absolute ethanol (the volume dosage was 2 mL / g based on the mass of Hericium erinaceus powder), and centrifuged again. The precipitate was dried to a constant weight under vacuum at 65 °C and -0.1 MPa to obtain the Hericium erinaceus polysaccharide extract.
[0101] Comparative Example 1
[0102] The main difference from Example 4 was that: before water extraction and alcohol precipitation, no fermentation pretreatment with Penicillium glabrum HA5-32 was carried out, and the operation was carried out according to the following steps:
[0103] (1) 10 g of Hericium erinaceus powder was placed in a 500 mL beaker, and 250 mL of deionized water (the material-liquid ratio was 1 g:25 mL) was added. After stirring evenly, it was incubated in a water bath at 34 °C for 4 h. Then, the beaker was transferred to an ultrasonic cleaner with a water temperature of 80 °C, and ultrasonic extraction was carried out at 180 W for 75 min. Immediately after that, it was filtered by Buchner funnel while it was still hot. All the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated Hericium erinaceus water extract;
[0104] (2) To all of the concentrated Hericium erinaceus water extract obtained in step (1), 40 mL of absolute ethanol (4 times the volume of the concentrated extract, and the ethanol volume fraction in the system was 80%) was added. After standing at 2 °C for 18 h, it was centrifuged at 4 °C and 8000 r / min for 10 min. The supernatant was discarded, and the precipitate was washed once with 20 mL of absolute ethanol (the volume dosage was 2 mL / g based on the mass of Hericium erinaceus powder), and then centrifuged again. The precipitate was dried to a constant weight under vacuum at 65 °C and -0.1 MPa to obtain the Hericium erinaceus polysaccharide extract.
[0105] Comparative Example 2
[0106] The main difference from Example 4 was that: the fermentation temperature in step (2) was 25 °C. Other steps were the same as those in Example 4, and step (2) was operated as follows:
[0107] 10 g of Hericium erinaceus powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 50 mL of the Sporotrichum pulverulentum HA5-32 spore solution prepared in step (1) (the volume dosage was 5 mL / g based on the mass of Hericium erinaceus powder) was added, and it was stirred evenly. The Erlenmeyer flask was sealed with 8 layers of gauze and cultured at 25 °C for 54 h to obtain the Hericium erinaceus fermented product.
[0108] Comparative Example 3
[0109] The main difference from Example 4 was that: the fermentation temperature in step (2) was 35 °C. Other steps were the same as those in Example 4, and step (2) was operated as follows:
[0110] 10 g of Hericium erinaceus powder was placed in a 250 mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h. 50 mL of the Sporotrichum pulverulentum HA5-32 spore solution prepared in step (1) (the volume dosage was 5 mL / g based on the mass of Hericium erinaceus powder) was added, and it was stirred evenly. The Erlenmeyer flask was sealed with 8 layers of gauze and cultured at 35 °C for 54 h to obtain the Hericium erinaceus fermented product.
[0111] Comparative Example 4
[0112] The main difference from Example 4 is that the fermentation time in step (2) is 42 h. Other steps are the same as those in Example 4. Step (2) is operated as follows: 10 g of Hericium erinaceus powder is placed in a 250 mL Erlenmeyer flask that has been sterilized by dry heat at 160 °C for 2 h. Add 50 mL of the spore solution of Penicillium glabrum HA5-32 prepared in step (1) (the volume dosage is 5 mL / g based on the mass of Hericium erinaceus powder), and stir evenly. The Erlenmeyer flask is sealed with eight layers of gauze and cultured at 30 °C for 42 h to obtain the Hericium erinaceus fermented product.
[0113] Comparative Example 5
[0114] The main difference from Example 4 is that the fermentation time in step (2) is 66 h. Other steps are the same as those in Example 4. Step (2) is operated as follows: 10 g of Hericium erinaceus powder is placed in a 250 mL Erlenmeyer flask that has been sterilized by dry heat at 160 °C for 2 h. Add 50 mL of the spore solution of Penicillium glabrum HA5-32 prepared in step (1) (the volume dosage is 5 mL / g based on the mass of Hericium erinaceus powder), and stir evenly. The Erlenmeyer flask is sealed with eight layers of gauze and cultured at 30 °C for 66 h to obtain the Hericium erinaceus fermented product.
[0115] Comparative Example 6
[0116] The main difference from Example 4 is that the heat preservation temperature in step (3) is 28 °C. Other steps are the same as those in Example 4. Step (3) is operated as follows:
[0117] All of the Hericium erinaceus fermented product from step (2) is transferred into a 500 mL beaker, add 250 mL of deionized water (the material-liquid ratio is 1 g:25 mL), stir evenly, and then keep it warm in a water bath at 28 °C for 4 h. After that, the beaker is transferred into an ultrasonic cleaner with a water temperature of 80 °C, ultrasonic extraction is carried out at 180 W for 75 min, and then filtered by a Buchner funnel while it is hot. All of the filtrate is concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated Hericium erinaceus water extract.
[0118] Comparative Example 7
[0119] The main difference from Example 4 is that the heat preservation temperature in step (3) is 40 °C. Other steps are the same as those in Example 4. Step (3) is operated as follows:
[0120] All of the Hericium erinaceus fermented product from step (2) is transferred into a 500 mL beaker, add 250 mL of deionized water (the material-liquid ratio is 1 g:25 mL), stir evenly, and then keep it warm in a water bath at 40 °C for 4 h. After that, the beaker is transferred into an ultrasonic cleaner with a water temperature of 80 °C, ultrasonic extraction is carried out at 180 W for 75 min, and then filtered by a Buchner funnel while it is hot. All of the filtrate is concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated Hericium erinaceus water extract.
[0121] Comparative Example 8
[0122] The main difference from Example 4 is that: the heat preservation time in step (3) is 2 h. Other steps are the same as those in Example 4, and step (3) is operated according to the following steps:
[0123] All the Hericium erinaceus fermented products in step (2) were transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g:25 mL), and after stirring evenly, it was kept warm in a water bath at 34 °C for 2 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 80 °C, and ultrasonic extraction was carried out at 180 W for 75 min. Immediately after that, it was filtered by a Buchner funnel while it was hot, and all the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated Hericium erinaceus water extract.
[0124] Comparative Example 9
[0125] The main difference from Example 4 is that: the heat preservation time in step (3) is 6 h. Other steps are the same as those in Example 4, and step (3) is operated according to the following steps:
[0126] All the Hericium erinaceus fermented products in step (2) were transferred into a 500 mL beaker, 250 mL of deionized water was added (the material-liquid ratio was 1 g:25 mL), and after stirring evenly, it was kept warm in a water bath at 34 °C for 6 h. Then, the beaker was transferred into an ultrasonic cleaner with a water temperature of 80 °C, and ultrasonic extraction was carried out at 180 W for 75 min. Immediately after that, it was filtered by a Buchner funnel while it was hot, and all the filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60 °C and -0.1 MPa to obtain the concentrated Hericium erinaceus water extract.
[0127] Evaluation of fermentation results
[0128] The quality of the polysaccharide extract, the quality of Hericium erinaceus polysaccharide, the percentage content of Hericium erinaceus polysaccharide, and the extraction rate of Hericium erinaceus polysaccharide obtained from 10 g of Hericium erinaceus in Examples 4 to 6 and Comparative Examples 1 to 9 are shown in Table 3. Among them, the percentage content of Hericium erinaceus polysaccharide is the percentage of the quality of Hericium erinaceus polysaccharide in the quality of the obtained polysaccharide extract.
[0129] Table 3 Yields of extracting Hericium erinaceus polysaccharide in Examples 4 to 6 and Comparative Examples 1 to 9
[0130]
[0131] It can be seen from the data in Table 3 that:
[0132] ①Comparing Comparative Example 1 with Example 4, before conventional water extraction and alcohol precipitation, fermentation pretreatment with Penicillium glabrum HA5-32 was carried out, and the polysaccharide extraction rate was greatly improved, indicating the excellent effect of fermentation pretreatment with Penicillium glabrum HA5-32 before water extraction and alcohol precipitation on improving the polysaccharide extraction rate. Analyzing the reason, Penicillium glabrum HA5-32 can produce a variety of hydrolases to hydrolyze the cell wall of Hericium erinaceus, ultimately significantly increasing the polysaccharide extraction rate. The extraction rate of Example 4 with fermentation pretreatment of Penicillium glabrum HA5-32 was 12.8%, which was 48.7% higher than that of Comparative Example 1 without treatment.
[0133] ②Comparative analysis of Comparative Examples 2-5 and Example 4 shows that the fermentation temperature or time of Comparative Examples 2-5 is different from that of Example 4, and their polysaccharide extraction rates are reduced, indicating that when applying Penicillium glabrum HA5-32 to the polysaccharide extraction of Hericium erinaceus, after adding Penicillium glabrum HA5-32 spore liquid to Hericium erinaceus powder, fermenting at 28-32 °C for 48-60 h has a good effect on improving the polysaccharide extraction of Hericium erinaceus. Analyzing the reason, after adding Penicillium glabrum HA5-32 spore liquid to Hericium erinaceus powder and fermenting at 28-32 °C for 48-60 h, the growth of Penicillium glabrum HA5-32 can just reach the appropriate degree for enzyme production, and the polysaccharide extraction effect is better.
[0134] ③Comparative analysis of Comparative Examples 6-9 and Example 4 shows that the water extraction temperature or time of Comparative Examples 6-9 is different from that of Example 4, and their polysaccharide extraction rates are reduced, indicating that when applying Penicillium glabrum HA5-32 to the polysaccharide extraction of Hericium erinaceus, adding deionized water to the Hericium erinaceus fermentation product and keeping it at 32-36 °C for 3-5 h for water extraction has a good effect on improving the polysaccharide extraction of Hericium erinaceus. The reason may be that adding deionized water to the Hericium erinaceus fermentation product and keeping it at 32-36 °C for 3-5 h for water extraction can just hydrolyze substances such as cellulose in the cell wall of Hericium erinaceus but not decompose the soluble polysaccharides, so the polysaccharide extraction effect is better.
[0135] In the present invention, the raw materials and equipment used, unless otherwise specified, are all common raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.
[0136] The above are only the preferred embodiments of the present invention, and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent transformations made to the above embodiments according to the technical essence of the present invention still belong to the protection scope of the technical solution of the present invention.
Claims
1. A strain of Penicillium glabrum ( Penicillium glabrum Penicillium glabrum ), HA5-32, characterized in that: It is preserved in the Guangdong Microbial Culture Collection Center, with the preservation number of GDMCC No: 63392, the preservation date of April 24, 2023, and the preservation address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Guangdong Province.
2. Use of the Penicillium glabrum HA5-32 according to claim 1 in the extraction of Hericium erinaceus polysaccharide.
3. The use according to claim 2, characterized in that: The method of the application includes the following steps: (1) Add the spore liquid of Penicillium glabrum HA5-32 to the Hericium erinaceus powder, mix evenly and then ferment to obtain the Hericium erinaceus fermentation product; (2) Add deionized water to the Hericium erinaceus fermentation product, stir evenly and then carry out heat preservation treatment and ultrasonic treatment. After filtration and concentration, obtain the water extract concentrated solution of Hericium erinaceus; (3) Add ethanol to the water extract concentrated solution of Hericium erinaceus to obtain a precipitate. The precipitate is washed and dried to obtain Hericium erinaceus polysaccharide.
4. The use according to claim 3, characterized in that: Based on the mass of the Hericium erinaceus powder, in step (1), the addition amount of the Penicillium glabrum HA5-32 spore liquid is 4-6 mL / g, and the concentration of the Penicillium glabrum HA5-32 spore liquid is 1×10 7 ~2×10 7 CFU / mL.
5. The use according to claim 3, characterized in that: In step (1), the temperature of the fermentation is 28-32 °C, and the time of the fermentation is 48-60 h.
6. The use according to claim 3, characterized in that: Calculated by the mass of Hericium erinaceus powder, in step (2), the addition amount of the deionized water is 20-30 mL / g.
7. The use according to claim 3, characterized in that: In step (2), the temperature of the heat preservation treatment is 32-36 °C, and the time of the heat preservation treatment is 3-5 h.
8. The use according to claim 3, characterized in that: In step (2), the temperature of the ultrasonic treatment is 75-85 °C, the power is 160-200 W, and the time is 60-90 min.
9. The use according to claim 3, characterized in that: In step (2), it is concentrated to 1 / 25-1 / 20 of the original volume, and the concentration method is vacuum concentration.
Citation Information
Patent Citations
Penicillium pad EJ2-16 and application thereof in extraction of loquat leaf polysaccharide
CN115927009A
Rhizopus arrhizus DS6-14 and application thereof in extraction of codonopsis pilosula polysaccharide
CN116286387A