Molecular marker primers, kits and applications for the identification of Hevea brasiliensis Yunyan 3089

Through the molecular marker primers and kit of Rubber Tree Cloud 3089, DNA amplification and sequencing results are used to distinguish rubber tree varieties, solving the problem of inaccurate identification in the existing technology, achieving efficient and accurate variety identification and distinction, and supporting the accuracy of rubber tree breeding and intellectual property protection.

CN117144033BActive Publication Date: 2025-08-01YUNNAN INST OF TROPICAL CROPS
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310663934.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-01
Publication Date
2025-08-01
Estimated Expiration
2043-06-01

AI Technical Summary

Technical Problem

In the prior art, the trait test of rubber tree varieties is susceptible to environmental and human factors, resulting in inaccurate identification and impurity or errors in varieties, affecting the healthy development of the rubber industry.

Method used

Provide molecular marker primers and kits for Rubber Tree Yunyan 3089, use upstream and downstream primers to perform DNA amplification, and distinguish varieties through sequencing results to achieve accurate identification, including the distinction between Yunyan 3089 and other rubber tree varieties.

Benefits of technology

Accurate identification of rubber tree varieties is achieved, and the results are not affected by environmental and human factors, which improves the identification efficiency and accuracy, and supports the accuracy of rubber tree breeding and intellectual property protection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117144033B_ABST
    Figure CN117144033B_ABST
Patent Text Reader

Abstract

The present invention discloses a molecular marker primer, a kit and an application for the identification of Hevea brasiliensis Yunyan 3089. The molecular marker primer comprises an upstream primer and a downstream primer. The upstream primer is as shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer is as shown in SEQ ID NO: 2 in the sequence listing. The kit comprises the above-mentioned molecular marker primer. The application includes: using the molecular marker primer for the identification of Hevea brasiliensis Yunyan 3089. The sequencing results of the markers are used to distinguish varieties. For example, if there are differences, substitutions, insertions, deletions, duplications, etc. of one or more bases between different sequences, the identification of Yunyan 3089 can be achieved, and Hevea brasiliensis PR107, Yunyan 3003, Yunyan 774, Yunyan 772, Recken 516 and RRIC52 can be distinguished, and the varieties of Hevea brasiliensis can be accurately identified.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to the fields of molecular biology and genetic breeding, and particularly relates to a molecular marker primer, a kit and an application for the identification of Hevea brasiliensis Yunyan 3089. Background Art

[0002] Hevea brasiliensis is a typical perennial tropical rainforest tree species, originally native to countries such as Brazil, Venezuela, and Guyana in the Amazon River Basin of South America, and later introduced into China. It is now mainly planted in Hainan, Yunnan, Guangdong and other places in China. Natural rubber is obtained by coagulating and drying the latex flowing out during the tapping of Hevea brasiliensis. In recent years, the demand for natural rubber in China has been continuously increasing, and the supply-demand gap has been continuously widening. According to data from the Industrial Information Network, in 2021, the output of natural rubber in China was 85.1 tons, the demand was 594.9 tons, and the self-sufficiency rate was only 14.30%.

[0003] Under the current international situation, supply security faces many challenges, and domestic production needs to play a "ballast" role in the long term. Natural rubber has unique excellent properties in the fields of weaponry, aircraft tires, high-elastic shock absorption, and high-altitude detection. The future development prospect of the natural rubber tree industry is broad.

[0004] Currently, the direct object of the identification, authorization and breeding of Hevea brasiliensis varieties is traits, and trait testing is still the industry standard for the specific testing of many plant varieties. However, the performance of traits is easily affected by environmental and human factors, and it takes several years to accurately identify. There are phenomena of "same name but different species" and "same species but different names" in the germplasm resources of Hevea brasiliensis, important breeding materials, and varieties popularized and applied in production, which is not conducive to the variety breeding, authorization, rapid promotion and intellectual property protection of Hevea brasiliensis. Especially in actual production, the uncertainty of Hevea brasiliensis varieties will seriously limit the healthy and sustainable development of the rubber industry, and the impurity or even error of Hevea brasiliensis seedling varieties will seriously affect the economic interests of rubber farmers.

[0005] Disclosure Content

[0006] In order to solve the problem of inaccurate identification of Hevea brasiliensis Yunyan 3089, the embodiments of the present disclosure provide a molecular marker primer, a kit and an application for the identification of Hevea brasiliensis Yunyan 3089. The technical solutions are as follows:

[0007] On the one hand, the present disclosure provides a molecular marker primer for the identification of Hevea brasiliensis Yunyan 3089. The molecular marker primer includes an upstream primer and a downstream primer. The upstream primer is as shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer is as shown in SEQ ID NO: 2 in the sequence listing.

[0008] On the other hand, the present disclosure provides a kit for the identification of Hevea brasiliensis Yunyan 3089, and the kit includes the above-mentioned molecular marker primer.

[0009] In another aspect, the present disclosure provides an application of molecular marker primers for identifying Hevea brasiliensis Yunyan 3089. The application includes: using the molecular marker primers to identify Hevea brasiliensis Yunyan 3089. The molecular marker primers include an upstream primer and a downstream primer. The upstream primer is as shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer is as shown in SEQ ID NO: 2 in the sequence listing.

[0010] Furthermore, the application further includes: the molecular marker primers can distinguish Hevea brasiliensis PR107, Yunyan 3003, Yunyan 774, Yunyan 772, Rekan 516, and RRIC52.

[0011] The beneficial effects brought by the technical solutions provided in the embodiments of the present disclosure are as follows: The embodiments of the present invention provide molecular marker primers, kits, and applications for identifying Hevea brasiliensis Yunyan 3089. The molecular marker primers distinguish varieties through the sequencing results of amplification products. For example, there are differences, substitutions, insertions, deletions, duplications, etc. in one or more bases between different sequences, so as to realize the identification of Hevea brasiliensis Yunyan 3089, and can distinguish Hevea brasiliensis PR107, Yunyan 3003, Yunyan 774, Yunyan 772, Rekan 516, and RRIC52. Moreover, the identification results are not affected by the environment and other human factors, and thus accurately identify the varieties of Hevea brasiliensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present disclosure. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0013] Figure 1 It is a sequence comparison diagram named a - g provided in Embodiment 3 of the present disclosure. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0014] To make the purpose, technical solutions, and advantages of the present disclosure clearer, the following will further describe the embodiments of the present disclosure in detail.

[0015] Embodiment 1

[0016] The present disclosure provides molecular marker primers for the identification of Hevea brasiliensis Yunyan 3089. The primers include an upstream primer and a downstream primer. The upstream primer is as shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer is as shown in SEQ ID NO: 2 in the sequence listing. Specifically, the sequence of the upstream primer is: TTTATGATTCTAACATGTGTGCGGC, and the sequence of the downstream primer is: AGGTGATATGATTCATATAGATTCTCCCA.

[0017] Example 2

[0018] The present disclosure provides a kit for the identification of Hevea brasiliensis Yunyan 3089, and the kit includes the molecular marker primers provided in Example 1.

[0019] Example 3

[0020] The present disclosure provides an application of the molecular marker primers for the identification of Hevea brasiliensis Yunyan 3089. The application includes: using the molecular marker primers provided in Example 1 to identify Hevea brasiliensis Yunyan 3089.

[0021] Furthermore, the application also includes: these molecular marker primers can distinguish Hevea brasiliensis PR107, Yunyan 3003, Yunyan 774, Yunyan 772, Rekan 516, and RRIC52.

[0022] Specifically, 42 Hevea brasiliensis varieties are used as samples to be tested, and the variety names are shown in Table 1.

[0023] Table 1 shows the variety names of the samples to be tested

[0024]

[0025]

[0026] Extract the DNA of the above 42 samples to be tested. In implementation, a new plant genomic DNA extraction kit produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. is used to extract the DNA of the samples to be tested. The specific operation is carried out according to the instructions of the new plant genomic DNA extraction kit.

[0027] Forty-two samples to be tested were amplified using the labeled primers provided in Example 1 of the present invention. Specifically, the amplification system included: 50 ng of DNA of the sample to be tested, 0.5 μL of 10 mM dNTP (deoxy-ribonucleoside triphosphate), 0.5 μL of the upstream primer, 0.5 μL of the downstream primer, 2.5 μL of Tap Buffer, 0.2 μL of Taq enzyme, and ddH2O was added to make the amplification system up to 20 μL. The amplification program included: 95°C for 3 min; (95°C for 30 sec, 60°C for 30 sec) × 30 cycles; 72°C for 6 min. The amplified products were subjected to second-generation high-throughput sequencing to obtain sequencing data. The sequencing data was aligned to the rubber tree reference genome (NCBI: PRJNA587314) using the Bowtie2 software to obtain the sequencing results of each sample to be tested.

[0028] The sequencing results were analyzed using Microsoft Office Excel software, and there were 7 different sequence types in total. The 7 different sequence types were named a, b, c, d, e, f, and g respectively, as shown in Table 2.

[0029] Table 2 shows the different sequences obtained by sequencing after amplification of 42 samples to be tested with the molecular marker primers

[0030]

[0031]

[0032] The 7 different sequence types were aligned using the software DNASTAR lasergene 11, and the alignment results are as Figure 1 shown. Among them, there were differences at 7 base sites in the 7 different sequences. Specifically, the differences in the sequences included: A / G at the 3rd base position, C / T at the 25th base position, T / C at the 43rd base position, T / C at the 66th base position, T / C at the 67th base position, C / T at the 81st base position and sequence g lacked one base, and T / G at the 142nd base position. Figure 1

[0033] Among the 42 samples to be tested provided in this example, 7 samples to be tested could be effectively distinguished using the primer pair provided in this example. The different sequence combinations of the 7 samples to be tested are shown in Table 3.

[0034] Table 3 shows the different sequence combinations of the 7 samples to be tested that were distinguished

[0035] Serial number Name of the sample to be tested Sequence combination 1 PR107 a 2 Yunyan 3003 c 3 Yunyan 774 acg 4 Yunyan 772 ag 5 Reken 516 f 6 Yunyan 3089 cdf 7 RRIC52 ef

[0036] ​As can be seen from Table 3, the above 7 samples to be tested have different sequence combination modes. It can be seen that the primers provided in the first embodiment of the present invention can amplify the sequence of Yunyan 3089, and the sequence combination mode is cdf. Also, according to the different sequence combinations, the differentiation of PR107, Yunyan 3003, Yunyan 774, Yunyan 772, Rekan 516 and RRIC52 can be realized.

[0037] Accuracy Analysis of Molecular Marker Primers for Rubber Trees

[0038] Three reproducibility experiments were used for accuracy analysis. In this embodiment, three independent experiments were conducted by different personnel, different batches of reagents and different laboratories, so as to simulate the identification of rubber trees in different batches. A high reproducibility rate means that the identification results of different laboratories can be accurately compared with each other.

[0039] Reproducibility experiments were carried out on 7 rubber tree samples to be tested. The 7 samples to be tested are specifically: Yunyan 3089, PR107, Yunyan 3003, Yunyan 774, Yunyan 772, Rekan 516 and RRIC52. Each sample to be tested was repeated three times, and the sequence combination of each result was recorded. The specific results are shown in Table 4.

[0040] Table 4 shows the results of three repeated experiments

[0041]

[0042] As can be seen from Table 4, the sequence combinations of the 3 repeated experiments are the same. Thus, it can be known that the accuracy rate of the molecular marker primer identification provided in the embodiment of the present invention is 100%. It can be seen that the variety identification conclusions between different laboratories or different batches in the same laboratory in the embodiment of the present invention have high consistency, so there is no need to adopt parallel experiments to reduce experimental errors, which provides great convenience for the variety identification of rubber trees.

[0043] The embodiment of the present invention provides molecular marker primers, kits and applications for the identification of rubber tree Yunyan 3089. The sequencing results of the markers are used to distinguish varieties. For example, there are differences, substitutions, insertions, deletions, duplications, etc. of one or more bases between different sequences, so as to realize the identification of Yunyan 3089. Rubber tree Yunyan 3089 is an important breeding material, and at the same time, it can distinguish rubber trees PR107, Yunyan 3003, Yunyan 774, Yunyan 772, Rekan 516 and RRIC52, and the identification results are not affected by the environment and other human factors, so as to accurately identify rubber tree varieties.

[0044] The above are only optional embodiments of the present disclosure, and are not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. A molecular marker primer for the identification of Hevea brasiliensis Yunyan 3089, characterized in that, The molecular marker primers include an upstream primer and a downstream primer. The upstream primer is as shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer is as shown in SEQ ID NO: 2 in the sequence listing.

2. A kit for identifying Hevea brasiliensis Yunyan 3089, characterized in that, The kit includes the molecular marker primers as described in claim 1.

3. Application of molecular marker primers for identifying Hevea brasiliensis Yunyan 3089, characterized in that, The application includes: using the molecular marker primers to identify Hevea brasiliensis Yunyan 3089. The molecular marker primers include an upstream primer and a downstream primer. The upstream primer is as shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer is as shown in SEQ ID NO: 2 in the sequence listing.

4. The application according to claim 3, wherein The application further includes: the molecular marker primers can also distinguish between: Hevea brasiliensis PR107, Yunyan 3003, Yunyan 774, Yunyan 772, Rekan 516 and RRIC52.

Citation Information

Patent Citations

  • Standard DNA fingerprint library for rubber tree species as well as construction method and special primers of standard DNA fingerprint library

    CN111808983A

  • Method for identification of variety of hevea brasiliensis and kit for identification of variety of hevea brasiliensis

    JP2010161951A