A DNA / PVA double network hydrogel microneedle and its preparation method
By preparing DNA/PVA double-network hydrogel microneedles, the problems of low drug loading and weak sustained-release ability of existing soluble microneedles were solved, and efficient drug delivery and timely release were achieved, with high drug loading capacity and good skin compatibility.
Patent Information
- Application Number
- CN202311154930.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-08
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2043-09-08
AI Technical Summary
Existing soluble microneedles have low drug loading, weak controlled sustained-release ability, and heavy subcutaneous metabolic burden, making it difficult to achieve efficient delivery and timely release of biomacromolecule drugs.
DNA/PVA double network hydrogel microneedles were designed. By preparing DNA/PVA double network hydrogel microneedles, DNA was used to form a three-dimensional gel network and entangled with PVA to form a double network structure, which improved the mechanical strength and drug loading capacity, and the integrity of the microneedles was ensured through vacuum extraction of bubbles and drying process.
It achieves high drug loading and controllable sustained release, reduces the subcutaneous metabolic burden, is easy to operate and has good skin compatibility, making it suitable for mass production.
Smart Images
Figure BDA0004438184310000061 
Figure HDA0004438184320000011 
Figure HDA0004438184320000012
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomedical materials, and in particular relates to a DNA / PVA double-network hydrogel microneedle and a preparation method thereof. Background Art
[0002] Biomacromolecules, such as proteins, peptides, and nucleic acids, play a crucial role in the prevention and treatment of major diseases and have become one of the most promising yet highly competitive areas of drug development in the 21st century. However, due to their limited structural stability, lesion targeting, and barrier permeability, they are typically administered clinically via high-dose injections, resulting in low in vivo bioavailability and even adverse reactions. Consequently, developing new technologies and methods, researching efficient delivery systems, and optimizing drug formulations to achieve efficient delivery and timely release of biomacromolecules are current research hotspots.
[0003] In recent years, microneedle drug delivery technology, particularly transdermal drug delivery based on soluble microneedles, has become an emerging method for delivering biomacromolecules. Subcutaneous drug delivery, delivered through the skin by drug-carrying microneedles, allows the drug to penetrate the skin barrier and be absorbed locally or enter the systemic circulation. It is also painless, minimally invasive, safe, and convenient, offering significant advantages for drugs that require local or frequent administration. However, existing soluble microneedles are mainly composed of polymer materials. Due to their own characteristics, there are still problems that need to be solved, such as low drug loading, weak controllable sustained release ability, and heavy subcutaneous metabolic burden (Lijing Zhang, Ranran Guo, Siqi Wang, Xiaotong Yang, Guixia Ling, PengZhang. Fabrication, evaluation and applications of dissolving microneedles. Int. J. Pharmaceut. 2021, 604, 120749.; Xiang Chen, Li Wang, Haojie Yu, Chengjiang Li, Jingyi Feng, Fazal Haq, Amin Khan, Rizwan Ullah Khan. Preparation, properties and challenges of the microneedles-based insulin delivery system. J. Control. Release 2018, 288, 173–188.). Summary of the Invention
[0004] This application takes nucleic acid aptamer drugs as the research object, designs new soluble microneedles to achieve efficient drug release, and carries out the design and construction of soluble microneedles with DNA-based hydrogels as the main body. It is expected to solve the problems of existing soluble microneedles in drug loading, controlled sustained release, biological metabolism, etc., and has a positive role in promoting research in fields such as soluble microneedle materials and new methods of nucleic acid drug delivery.
[0005] Therefore, the object of the present invention is to provide a novel method for preparing DNA / PVA double network hydrogel microneedles and the microneedles prepared therefrom.
[0006] The preparation method of the DNA / PVA double network hydrogel microneedle provided by the present invention comprises the following steps:
[0007] (1) Preparation of PVA solution: Using double-distilled water as solvent, add 2 g of PVA powder to 20 mL of double-distilled water, stir at 50-80°C, stir for 3 h, and let stand for 1 h to obtain a transparent solution with a concentration of 10% (w / v);
[0008] (2) DNA oligonucleotide dilution step: Centrifuge the primer tube (1000 rpm to 3000 rpm) for several minutes to allow the DNA to aggregate at the bottom of the tube. After adding an appropriate amount of double-distilled water, cover the tube, heat in a water bath, and vortex to mix thoroughly to fully dissolve the DNA, so that the DNA concentration is 3 mM.
[0009] (3) Preparation of DNA / PVA double network hydrogel solution: Mix the solutions of step (1) and step (2), add 50×TAE / Mg(MgAc2), 3M KCl, and H2O, mix well, and centrifuge to obtain a solution for preparing microneedle tips (denoted as Solution 1, S1). Dilute the solution of step (1) to 4% to 6% to obtain a solution for preparing a microneedle backing layer (denoted as Solution 2, S2).
[0010] (4) Preparation steps of DNA / PVA double network hydrogel microneedles: including pouring the microneedle solution prepared in step (3) into the PDMS microneedle mold, placing the mold in a vacuum-sealed tank, and performing a vacuum operation with a vacuum degree of -0.089, 1 to 3 vacuuming times, and a vacuuming time of 30s to 1min each time. Remove the bubbles generated by vacuuming and absorb the excess S1, and recycle it. Place the mold in a 30°C oven and dry it for 30min, then take out the mold and add S2, place the mold in a vacuum-sealed tank, and perform a vacuum operation with a vacuum degree of -0.089, 2 to 3 vacuuming times, and a vacuuming time of 30s to 1min each time, remove the bubbles generated by vacuuming and add S2 until it is flush with the mold surface, and place the mold in a 30°C oven and dry it for 3 to 5h. Demolding, and the DNA / PVA double network hydrogel microneedle of the present application is obtained.
[0011] Preferably, in step (1), the stirring temperature is 70°C.
[0012] Preferably, in step (2), the centrifugal speed is 2000-2500 r / min, and the centrifugal time is 2 min.
[0013] Preferably, in step (2), the water bath heating temperature is 60°C.
[0014] Preferably, in step (3), the concentration of PVA in S1 and S2 is 4%.
[0015] Preferably, in step (4), the vacuuming step S1 is performed 3 times, and the vacuuming time is 1 minute each time.
[0016] Preferably, in step (4), the vacuuming in S2 is performed twice, and the vacuuming time is 1 minute each time.
[0017] Preferably, in step (4), the second drying time is 4 hours.
[0018] It should be noted that when preparing S1, the final concentration of DNA after mixing the solution is 0.6 mM. If the DNA concentration is too low, it will not be conducive to the formation of hydrogel and the double network structure of hydrogel and PVA, and will not play a role in improving the mechanical strength; if the DNA concentration is too high, the formed hydrogel will be too viscous and difficult to mix evenly with the PVA solution, and the liquid will not be able to smoothly fill the mold cavity during the vacuum operation.
[0019] It should also be noted that in the preparation method of this application, 3M transparent dressing is used for demolding instead of tweezers. When tweezers are used for demolding, the needle tip can easily bend or break when the microneedle is removed from the corner of the mold, and the small patch size is not conducive to picking up and placing. Using transparent 3M dressing to apply microneedles allows the microneedles to be pulled out in a vertical direction, maintaining the integrity of the microneedle tip, without affecting the observation of the microneedle under a microscope, and making it convenient and easy to pick up, place, and perform transdermal operations.
[0020] Beneficial Effects: Compared with existing technologies, this invention offers the following significant advantages: the double-network hydrogel microneedles prepared in this invention have a high drug loading capacity. The double network formation increases the mechanical strength of the microneedles, reduces the PVA concentration to 4%, and achieves simplified metabolism in the body while ensuring skin penetration. The formation of the DNA hydrogel gives the microneedles a strong sustained-release effect. The manufacturing process is simple, amenable to mass production, and has good skin compatibility. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 It is a diagram showing the design of the DNA gel network constituent chains and the gelation mechanism of the present invention.
[0022] Figure 2 It is a schematic diagram of the double-network hydrogel structure formed by the present invention.
[0023] Figure 3 This is the design of TNF-α aptamer + G quadruplex, where a is the design of G1, b, c and d are schematic diagrams of G2, G3 and G4 respectively inserting TNF-α aptamers at different positions based on G1.
[0024] Figure 4 This is the design principle of the DNA / PVA double network hydrogel microneedle of the present invention.
[0025] Figure 5 Schematic diagram of the mold size used in preparing microneedles of the present invention.
[0026] Figure 6 This is a diagram of the drying, molding and demolding of the DNA / PVA double network hydrogel microneedles with a 4% PVA concentration provided by an embodiment of the present invention.
[0027] Figure 7 This is an overall morphology diagram and a local magnified diagram of the 4% PVA double-network hydrogel microneedle provided in an embodiment of the present invention.
[0028] Figure 8 This is a 3D reconstruction of the 4% PVA double-network hydrogel microneedle provided in an embodiment of the present invention.
[0029] Figure 9 This is a skin methylene blue staining image of the skin transdermal results of the 4% PVA double-network hydrogel microneedle provided in an embodiment of the present invention.
[0030] Figure 10 This is the observation result of 5% PVA microneedle.
[0031] Figure 11 This is the observation result of 6% PVA microneedle.
[0032] Figure 12a This is the G1 gel formation diagram.
[0033] Figure 12b This is the G2 gel diagram.
[0034] Figure 12c This is the G3 gel formation diagram.
[0035] Figure 12d This is the G4 glue diagram. DETAILED DESCRIPTION
[0036] The technical solution of the present invention is further described below in conjunction with the accompanying drawings. The following examples are only used to further illustrate the present application and should not be understood as limiting the present application.
[0037] Example 1: Principle of hydrogel formation by G1-G4 design
[0038] Design TNF-α aptamer + G quadruplex, the specific sequence is as follows, such as Figure 3 The sequence diagram shown is shown in FIG. G1 is the basic design, and the TGGTGGATGGCGCAGTCGGCGACAA sequence in the sequence diagrams of G2-G4 is the TNF-α aptamer sequence. The difference between the three is that the aptamer sequence is inserted at different positions.
[0039] G1:ACTTCAGGCCTGAAGTTGGGGGGGG;
[0040] G2: TGGTGGATGGCGCAGTCGGCGACAATACTTCAGGCCTGAAGTTTTTTTTTTTTTTTTTTTTGGGGGGGG;
[0041] G3:ACTTCAGGTTTTGGTGGATGGCGCAGTCGGCGACAATTTCCTGAAGTTTTTTTTTTTTTTTTTTTTGGGGGGGG;
[0042] G4:ACTTCAGGCCTGAAGTTTTGGTGGATGGCGCAGTCGGCGACAATGGGGGGGG.
[0043] Design of DNA gel network for self-assembly of anti-TNF-α aptamers based on base complementary pairing and G-quadruplex structure: A palindromic sequence is added to the 5' end of the anti-TNF-α aptamer sequence, and a polyguanine sequence (Poly(G)) is added to the 3' end. The palindromic sequence is used to introduce crosslinking site 1, and Poly(G) is used to introduce crosslinking site 2. The design of the DNA gel network chain and the gel formation mechanism are as follows: Figure 1 As shown. Palindromic sequences can bind to each other by means of self-complementary pairing. Poly (G) sequences can be + (0.1M) in the presence of G-quadruplexes. + Finally, each DNA single strand has two cross-linking sites, thus forming a three-dimensional gel network.
[0044] Example 2: Preparation of DNA / PVA double network hydrogel microneedles
[0045] In order to form a DNA / PVA double network structure, PVA, one of G1-G4, and TAE / Mg (MgAc2) were mixed evenly, and then K+ was added, thereby forming a three-dimensional gel network structure and entangled with PVA to form a double network hydrogel structure (such as Figure 2The preparation method of DNA / PVA double network hydrogel microneedles of the present invention is shown in the flow chart. Figure 4 The principle or general process is as follows: a sequence containing a TNF-α aptamer is designed, potassium ions are added, and the DNA self-assembles into a hydrogel. PVA is also added as a support material to enhance the hydrogel's strength, giving the microneedles sufficient mechanical strength to penetrate the skin.
[0046] 1. Preparation of PVA solution
[0047] Using double-distilled water as the solvent, add 2 g of PVA powder (purchased from Sigma-Aldrich, molecular weight 89,000-98,000, hydration degree 99+%) to 20 mL of double-distilled water, stir at 70°C, stir for 3 h and let stand for 1 h to obtain a transparent solution with a concentration of 10% (w / v).
[0048] 2. Dilution of DNA oligonucleotides
[0049] The above G1, G2, G3 and G4 nucleotides were synthesized. After experiments, G1, G2, G3 and G4 were able to form hydrogels and were successfully prepared into double network hydrogels (see Figure 12a-12d The hydrogel formation diagrams of G1 to G4 are shown respectively), among which G4 has the best hydrogel formation effect, so the G4 sequence was used to prepare hydrogels and microneedles in subsequent experiments.
[0050] Centrifuge the tube containing the nucleotides at 2000 rpm for several seconds to allow the DNA to aggregate at the bottom of the tube. Carefully open the tube cap to prevent primer powder from flying and causing DNA loss. Add an appropriate amount of double-distilled water, cap the tube, heat in a water bath, and vortex to fully dissolve the DNA. Adjust the concentration to obtain a 3 mM G4 solution.
[0051] 3. Preparation of DNA / PVA double network hydrogel microneedles with different PVA concentrations
[0052] DNA / PVA double network hydrogel microneedle materials with different PVA concentrations (4%, 5% and 6%) were prepared with the concentration of PVA solution as a variable to obtain the optimal PVA solution concentration for preparing microneedle materials.
[0053] 1. Mix 80 μL of 10% PVA, 40 μL of 3 mM G4 solution, 4 μL of 50× TAE / Mg(MgAc2), 10 μL of 3 M KCl, and 66 μL of H2O and centrifuge to obtain the solution for preparing the microneedle tips (denoted as Solution 1, S1). Dilute the 10% PVA to 4% to obtain the solution for preparing the microneedle backing layer (denoted as Solution 2, S2).
[0054] Pour S1 into a polydimethylsiloxane (PDMS) mold (schematic diagram as shown in Figure 5 As shown), after S1 is evenly dispersed, the mold is placed in a vacuum-sealed tank and vacuumed. The vacuum degree is -0.089, the vacuum is pumped 3 times, and the vacuum time is 1 min each time. The bubbles generated by vacuuming are removed and the excess S1 is sucked away, and the S1 solution is recycled to form an array of microneedle structures in each microgroove. The mold is placed in a 30°C oven and dried for 30 min, then the mold is taken out and S2 is added, the mold is placed in a vacuum-sealed tank and vacuumed. The vacuum degree is -0.089, the vacuum is pumped 2 times, and the vacuum time is 1 min each time, the bubbles generated by vacuuming are removed and S2 is added until it is flush with the mold surface, the mold is placed in a 30°C oven and dried for 4 h to obtain a DNA / PVA double-network hydrogel microneedle with a PVA concentration of 4%.
[0055] 100 μL of 10% PVA, 40 μL of 3 mM G4 solution, 4 μL of 50× TAE / Mg(MgAc2), 10 μL of 3 M KCl, and 46 μL of H2O were mixed and centrifuged to obtain a solution for preparing the microneedle tip (denoted as Solution 1, S1). 10% PVA was diluted to 5% to obtain a solution for preparing the microneedle backing layer (denoted as Solution 2, S2). DNA / PVA double-network hydrogel microneedles with a PVA concentration of 5% were obtained by the same procedure as above.
[0056] 120 μL of 10% PVA, 40 μL of 3mM G4 solution, 4 μL of 50×TAE / Mg(MgAc2), 10 μL of 3M KCl, and 26 μL of H2O were mixed and centrifuged to obtain a solution for preparing the microneedle tip (denoted as Solution 1, S1). 10% PVA was diluted to 6% to obtain a solution for preparing the microneedle backing layer (denoted as Solution 2, S2). DNA / PVA double-network hydrogel microneedles with a PVA concentration of 6% were obtained by the same procedure as above.
[0057] Example 3: Demolding of DNA / PVA double network hydrogel microneedles
[0058] After drying, the solidified 4% PVA concentration DNA / PVA double network hydrogel microneedles (such as Figure 6 As shown in a). 3M biofilm is pasted on the surface of the microneedle lining (i.e., the back of the microneedles, the side without microneedles). The function of this film is to make the microneedle array easy to peel off, without bending or breaking the microneedles during the peeling process, and to facilitate easy picking and placement. The microneedles are separated from the mold to obtain the final product (as shown in Figure 6 (as shown in b).
[0059] The experimental results are summarized as follows:
[0060]
[0061] The DNA / PVA double network hydrogel microneedles with PVA concentrations of 4%, 5%, and 6% prepared in Example 2 were observed using a microscope. Figure 7 The results of the 4% DNA / PVA double network hydrogel microneedle observations are shown. Figure 10 The results of the 5% DNA / PVA double network hydrogel microneedle observation are shown. Figure 11 The results of the observation of 6% DNA / PVA double network hydrogel microneedles are shown. The results show that there are no microneedle defects caused by bubbles in the microneedles prepared in the three examples. The microneedles are highly uniform and the shapes of the microneedles are sharp and clear. Among them, the DNA / PVA double network hydrogel microneedles with a concentration of 4% PVA were observed by 3D reconstruction using a laser confocal microscope. It can be found that the microneedle tips are sharp and the overall shape is complete, which is a quadrangular pyramid (such as Figure 8 shown).
[0062] Use a universal testing machine to test the mechanical properties that each microneedle can withstand: Use a universal testing machine to test the mechanical properties that the above three microneedles can withstand. The testing method is compression testing, and the setting area is 1cm 2 The microneedles were tested at a speed of 300 μm / min. The test results showed that the strength of each needle could reach over 0.1N, indicating that the microneedles could penetrate the skin and meet the requirements of use.
[0063] Example 4 Microneedle Transdermal Experiment
[0064] Select 8-week-old C57BL mice, remove the neck of the mice (with breath), and use a rechargeable shaver to clean the hair on the back of the mice. To make the skin smoother for easier observation, apply depilatory cream evenly on the shaved area of the mice for 30 seconds, wipe it with a wet cotton ball several times, and wipe off the depilatory cream completely to avoid burning the mouse skin and causing skin lesions. Immediately cut the back skin (note that the skin area should not be too small to prevent affecting subsequent experiments), rinse it with tap water first, and then rinse it repeatedly with saline. Place the removed skin on a clean foam board to remove the subcutaneous fat layer and connective tissue (be careful to avoid skin damage) and set aside.
[0065] Use a force of about 10N to vertically press the microneedle onto the back skin of the mouse to be used. After pressing for 1 minute, remove the microneedle. Immediately cover the microneedle insertion site with 2% methylene blue solution. After 5 minutes, absorb the excess methylene blue solution and rinse with tap water. It can be observed that the microneedle has successfully penetrated, and a blue dot array (such as Figure 9 shown).
[0066] It will be easily understood by those skilled in the art that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A method for preparing DNA / PVA double network hydrogel microneedles, characterized by: The following steps are included: (1) Preparation of DNA / PVA double network hydrogel mother solution: PVA is added to a single-stranded DNA solution named G4 and mixed evenly, and KCl is added to hydrogelize the DNA to form a double network hydrogel mother solution; the concentration of KCl is 2-4M, the concentration of the single-stranded DNA is 3mM, the molecular weight of the PVA is 89,000-98,000, the hydration degree is 99+%, and the w / v concentration is 4%; (2) Preparation of DNA / PVA double network hydrogel microneedles: pouring the gel master solution prepared in step (1) into the array microneedle mold, applying negative pressure to vacuumize the gel master solution so that the cavity of the array microneedle mold is filled with the gel master solution, and then removing bubbles and excess gel master solution, drying and solidifying the mold, and demolding to obtain the DNA / PVA double network hydrogel microneedles; The nucleotide sequence of the single-stranded DNA named G4 is shown in SEQ ID NO:
4.
2. The preparation method according to claim 1, wherein: The concentration of KCl is 3M.
3. The preparation method according to claim 1, wherein: The PVA was purchased from Sigma-Aldrich.
4. The preparation method according to claim 1, wherein: The vacuum degree of the negative pressure vacuuming is -0.095 to -0.
08.
5. The preparation method according to claim 4, characterized in that: The vacuum degree of the negative pressure vacuuming is -0.
089.
6. The preparation method according to claim 1, wherein: The array microneedle mold is made of polydimethylsiloxane, the microneedle size is 600 μm in needle height, 300*300 μm in bottom diameter, 600 μm in needle tip distance, 15*15 in number array, the microneedle patch size is 11.7*11.7 mm, and the groove depth is 2 mm.
7. The preparation method according to claim 1, wherein: The curing and molding method is constant temperature drying.
8. The preparation method according to claim 1, wherein: The demoulding includes: after drying and curing, using a biofilm with good skin biocompatibility and good adhesion to adhere to the microneedles in the array microneedle mold, and demoulding through adhesion; the biofilm is a 3M transparent dressing with a size of 4.4*4.4 cm.
9. The DNA / PVA double-network hydrogel microneedle prepared according to the preparation method according to any one of claims 1 to 8.