Leuconostoc mesenteroides producing broad-spectrum antimicrobial peptides and application thereof

Abstract

The present invention relates to the field of animal breeding, and specifically discloses an antimicrobial peptide and its preparation and application in animal feed additives. The antimicrobial peptide of the present invention is derived from Leuconostoc mesenteroides. The antimicrobial peptide produced by the strain has a significant inhibitory effect on a variety of Gram-positive bacteria, Gram-negative bacteria and fungi, and is resistant to high temperatures and acid and alkali. The antimicrobial peptide produced by the present invention can be widely used in the animal husbandry industry and the feed industry, can significantly inhibit the growth and reproduction of bacteria, has no chemical residues, no toxic side effects, no risk of environmental pollution, and has broad application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular is a Leuconostoc mesenteroides producing broad-spectrum antimicrobial peptides and application thereof. Background Art

[0002] With the continuous improvement of the quality of life and the global economic integration, food safety has become a global challenge and an important global public health issue. Animal food safety has become the focus of worldwide attention, among which the problem of antibiotic residues is one of the important factors affecting the safety of dairy and meat products. In recent years, due to the excessive use of antibiotics in the animal production process, the animal body has been disordered, the intestinal microecological balance has been destroyed, and the animal body's own resistance has decreased. At the same time, it has also led to a large amount of antibiotic residues in animal products and the environment, which has increased the drug resistance of pathogenic bacteria and endangered human health. At present, antibiotics are facing the situation of being eliminated or banned in the feed industry. As early as 1986, Switzerland began to restrict the use of some antibiotics as feed additives, and the European Union completely banned the use of antibiotics as feed additives in feed in 2006. my country also completely banned the addition of antibiotics to feed in 2020. As a result, the breeding industry and the feed industry are more seriously affected. Therefore, it is of great significance to develop safe and efficient new feed additives to replace traditional antibiotics.

[0003] Antimicrobial peptides (AMPs) are small molecule polypeptides with biological activity induced in organisms. They have a molecular weight of about 2000 to 7000 and are composed of 20 to 60 amino acid residues. They are an important part of the body's natural immune defense system. The mechanism of action of antimicrobial peptides is different from that of antibiotics. Antibiotics usually kill bacteria by acting on specific targets of bacteria, while most antimicrobial peptides kill bacteria by physical adsorption and rapid penetration and destruction of bacterial membranes. Antimicrobial peptides can also act on microbial biosynthesis processes, such as cell wall synthesis, DNA, protein, and protein folding. Compared with antibiotics, antimicrobial peptides have a broader spectrum of antibacterial ability. In addition, since antimicrobial peptides are easily hydrolyzed by proteases and are not easy to remain in animals, they are not easy to develop drug resistance. Antimicrobial peptides have high biological activity, are green and residue-free, and are not easy to produce drug-resistant pathogens. They are more suitable feed additives in animal production. Antimicrobial peptides are mostly extracted from plants, insects and other materials. Due to the limited extraction raw materials, complex extraction processes and high costs, it is difficult to form industrialization. In recent years, research on the production of antimicrobial peptides by microorganisms has begun to rise due to its obvious advantages such as low cost, non-toxicity, and short cycle. Obtaining highly active antimicrobial peptides through microbial fermentation is a production technology with important prospects. In addition, studies have reported that broad-spectrum antimicrobial peptides derived from lactic acid bacteria have been widely used in food fermentation and preservation. However, there are few reports on their application in animal feed additives. Summary of the invention

[0004] The present invention proposes a novel antibacterial animal feed additive and its preparation method and application. The present invention solves the problems of bacterial resistance and resistance transmission caused by feed antibiotics in animal breeding, and further enriches the types and uses of natural antibacterial substances and feed additives. In order to achieve the above purpose, the present invention adopts the following technical solutions:

[0005] The present invention provides a strain of Leuconostoc mesenteroides that can produce antibacterial peptides with broad-spectrum antibacterial activity. The Leuconostoc mesenteroides is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20231423 and a deposit date of August 10, 2023.

[0006] The Leuconostoc mesenteroides of the present invention is isolated from homemade kimchi and named MCW02. The bacterium is Gram-positive and grows in MRS solid culture medium. The colonies are small opaque white round colonies with smooth surfaces, neat edges and a colony diameter of 1 to 2 mm.

[0007] The above-mentioned Leuconostoc mesenteroides MCW02 can produce a broad-spectrum antimicrobial peptide MCW02-AMP, wherein the amino acid sequence of the antimicrobial peptide is: LHRLCGSPSIPLSFNLAVVLPRRNT.

[0008] The antimicrobial peptides in the metabolites of the strain MCW02 of the present invention have good thermal stability, and the antibacterial activity remains almost unchanged when treated at 25-100° C. for 1 hour. The strain has strong acid-base stability, and the antibacterial activity remains almost unchanged between pH 4 and 9, and the antibacterial activity decreases between pH 2 and 4 and between pH 10 and 12, but still has antibacterial activity.

[0009] The antimicrobial peptides in the metabolites of the strain MCW02 have a strong antibacterial effect, and its fermentation broth can not only inhibit Gram-positive bacteria, but also has a strong inhibitory effect on a variety of Gram-negative bacteria: it has a strong inhibitory effect on bacteria such as Staphylococcus aureus, Escherichia coli, Salmonella, Klebsiella pneumoniae, Bacillus cereus, and Pseudomonas aeruginosa; it can also effectively inhibit filamentous fungi such as Penicillium, Trichoderma, Aspergillus niger, and Aspergillus oryzae. At the same time, the antimicrobial peptides produced by the present invention have a broad-spectrum antibacterial activity that is not limited to the above pathogenic bacteria species.

[0010] Beneficial Effects

[0011] The broad-spectrum antimicrobial peptide produced by the strain MCW02 of the present invention can be used to solve the problems of bacterial resistance and resistance transmission caused by feed antibiotics in animal breeding, and further enrich the types of natural antimicrobial substances and feed additives. The present invention verifies the antibacterial effect of the broad-spectrum antimicrobial peptide produced by the strain MCW02 as a functional antimicrobial feed additive by the plate inhibition zone method.

[0012] The present invention uses strain MCW02 to produce broad-spectrum antimicrobial peptides, which can achieve antibacterial effects in conventional compound feeds without adding antibiotics. This not only avoids increasing feed costs, but also solves the problem of drug residues. Globally, the use of antibiotics has been restricted, resulting in challenges in feed formulation. Therefore, strengthening scientific and technological innovation in animal husbandry and improving production efficiency and quality are important tasks at present. The broad-spectrum antimicrobial peptides of the present invention have a broad market demand, and it is predicted that the broad-spectrum antimicrobial peptides of the present invention are expected to become the best alternative to antibiotics in future breeding.

[0013] The invention uses Leuconostoc mesenteroides to produce broad-spectrum antimicrobial peptides, which has a short production cycle, low cost, is not limited by raw materials, and can be industrially produced on a large scale. Therefore, it has obvious advantages over antimicrobial peptides derived from animals and plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Gel electrophoresis of PCR amplification products, from left to right are Marker, MCW02, and MCW02.

[0015] Figure 2 The phylogenetic tree of strain MCW02 was constructed based on the 16S rDNA gene sequence.

[0016] Figure 3 Results of thermal stability test of antimicrobial peptides from the fermentation broth of Leuconostoc mesenteroides MCW02.

[0017] Figure 4 Results of the acid-base stability test of antimicrobial peptides from the fermentation broth of Leuconostoc mesenteroides MCW02. DETAILED DESCRIPTION

[0018] The present invention is described below by specific embodiments. The following embodiments are only illustrative contents and do not limit the scope of the present invention. The technical means involved in the present invention are methods well known to those skilled in the art. Without departing from the essence and scope of the present invention, various changes or adjustments can be made to the material composition and dosage in the embodiments, and these changes or adjustments are also included in the protection scope of the present invention.

[0019] Example 1 Screening and identification of strain MCW02

[0020] Take samples from homemade kimchi (sour cabbage). Crush 15g of kimchi aseptically and mix in physiological saline. Take the supernatant and streak it on an MRS solid plate. Incubate at 37℃ for 36-48h. Observe in time.

[0021] Take the plate with colonies and select the gradient plate with obvious single colonies, select colonies with different colony morphology, and streak them twice on the MRS solid medium plate, then invert it and culture it at 37℃ for 36-48h. Repeat the above steps until a purified single colony is obtained.

[0022] A single colony was picked and placed in MRS liquid culture medium, cultured at 37°C for 24 hours, and the supernatant was collected by centrifugation. After excluding interference from organic acids, hydrogen peroxide and other substances, Staphylococcus aureus and Escherichia coli were used as indicator bacteria, respectively, and the solid agar punch antibacterial method was used to screen out the strains producing antibacterial substances.

[0023] The strains producing antibacterial substances were Gram-positive; the catalase test was negative. When grown in MRS solid medium, the colonies were small, opaque, milky white, round colonies with neat edges. These characteristics are the same as those of typical lactic acid bacteria colonies. Five strains with an inhibition zone diameter of more than 15 mm were selected and named MCW01, MCW02, MCW03, MCW04, and MCW05. These five strains were identified by the glucan production test (Table 1) and the carbohydrate fermentation test (Table 2).

[0024] The method of the glucan production test is as follows: select colonies from the MRS solid medium, streak them on the glucan production medium, and then culture them at 30°C for 24 to 72 hours. Observe whether a water drop-shaped, sticky bacterial lawn is generated around the colonies. If it is generated, it indicates a positive reaction, that is, glucan is produced; if it is not generated, it indicates a negative reaction.

[0025] The results of the glucan production test showed that the two strains were able to produce glucan using sucrose. Among the Leuconostoc genus, only Leuconostoc mesenteroides was able to produce glucan using sucrose, forming a viscous bacterial lawn on the culture medium, while other species did not have this feature. Based on this characteristic, the two strains MCW02 and MCW04 were further tested for carbohydrate fermentation.

[0026] The method of carbohydrate fermentation test is as follows: the activated culture is inoculated into the fermentation medium containing different carbohydrates, and then cultured at 30°C for 24 to 72 hours. If the culture medium turns yellow, it means that the carbohydrates are metabolized to produce acid, which is judged as a positive reaction; otherwise, it is judged as a negative reaction.

[0027] The results of the carbohydrate fermentation test showed that only strain MCW02 could utilize galactose, maltose and ribose. Therefore, after Gram staining, catalase test, glucan production test and carbohydrate fermentation test, strain MCW02 was preliminarily determined to be Leuconostoc mesenteroides.

[0028] Table 1 Glucan production test identification results

[0029] strains MCW01 MCW02 MCW03 MCW04 MCW05 Dextran production - + - + -

[0030] Note: + represents the formation of a viscous bacterial moss; - represents the absence of a viscous bacterial moss.

[0031] Table 2 Carbohydrate fermentation biochemical identification results

[0032] carbohydrate MCW02 LBC04 Salicylans + + Galactose + + Ribose + - maltose + + fructose + + sucrose + + Cellobiose + + Sorbitol - -

[0033] Note: + represents the production of acid using carbohydrates, and a yellow color indicates a positive reaction; - represents a negative reaction.

[0034] In order to identify strain MCW02 more accurately and effectively, in addition to traditional physiological and biochemical identification methods, 16S rDNA sequence analysis technology in molecular biology was also used for identification.

[0035] The strain MCW02 was inoculated in MRS liquid medium and cultured at 37°C for 24 hours. The bacteria were collected by centrifugation at 12000r / min for 1 minute. Total DNA was extracted from the bacteria according to the instructions of the DNA extraction kit. PCR amplification was performed using the 16S rDNA gene primer sequences 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-TACGGCTACCTTGTTACGACTT-3'). 5uL of PCR product was subjected to 1% agarose gel electrophoresis. The electrophoresis results are shown in Figure 1 .

[0036] The PCR product was recovered using the Invitrogen PCR product purification and recovery kit, and the 16S rRNA full sequence was sequenced by Guangdong Meige Gene Technology Co., Ltd. The 16S rDNA sequence of strain MCW02 is 1443 bp in total, and the sequencing result is shown in SEQ ID NO.1.

[0037] SEQ ID NO.1:

[0038] CCCAGTCATCTGTCCTGCCTTAGACGGCTCCTTCCTAAAAGGTTAGGCCACCGGC

[0039] TTTGGGCATTACAAACTCCCATGGTGTGACGGGCGGTGTGTACAAGACCCGGGAACG

[0040] TATTCACCGCGGCGTGCTGATCCGCGATTACTAGCGATTCCGACTTCATGTAGTCGAGT

[0041] TGCAGACTACAATCCGAACTGAGACGTACTTTAAGAGATTAGCTCACCCTCGCGGGTT

[0042] GGCAACTCGTTGTATACGCCATTGTAGCACGTGTGTAGCCCAGGTCATAAGGGGCATG

[0043] ATGATCTGACGTCGTCCCCGCCTTCCTCCGGTTTGTCACCGGCAGTCTCGCTAGAGTG

[0044] CCCATCTGAATGCTGGCAACTAACAATAAGGGTTGCGCTCGTTGCGGGACTTAACCCA

[0045] ACATCTCACGACACGAGCTGACGACGACCATGCACCACCTGTCACTTTGTCTCCGAA

[0046] GAGAACACTTCTATCTCTAAAAGCTTCAAAGGATGTCAAGACCTGGTAAGGTTCTTCG

[0047] CGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGTCCCCGTCAATTCCTTT

[0048] GAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAACACTTAATGCGTTAGCTTCGGC

[0049] ACTAAGAGGCGGAAACCTCCTAACACCTAGTGTTCATCGTTTACGGTGTGGACTACCA

[0050] GGGTATCTAATCCTGTTTGCTACCCACACTTTCGAGCCTCAACGTCAGTTGCAGTCCA

[0051] GTAAGCCGCCTTCGCCACTGGTGTTCTTCCATATATCTACGCATTCCACCGCTACACAT

[0052] GGAGTTCCACTTACCTCTACTGCACTCAAGTTAACCAGTTTCCAATGCCATTCCGGAG

[0053] TTGAGCTCCGGGCTTTCACATCAGACTTAATAAACCGTCTGCGCTCGCTTTACGCCCA

[0054] ATAAATCCGGATAACGCTCGGGACATACGTATTACCGCGGCTGCTGGCACGTATTTAGC

[0055] CGTCCCTTTCTGGTATGGTACCGTCAAACTAAAATCATTTCCTATTCTAGCTGTTCTTCC

[0056] CATACAACAGTGCTTTACGACCCGAAAGCCTTCATCACACACGCGGCGTTGCTCCATC

[0057] AGGCTTTCGCCCATTGTGGAAGATTCCCTACTGCAGCCTCCCGTAGGAGTTTGGGCCG

[0058] TGTCTCAGTCCCAATGTGGCCGATCAGTCTCTCAACTCGGCTATGCATCATTGTCTTGG

[0059] TAGGCCTTTACCCCACCAACTAACTAATGCACCGCGGATCCATCTCTAGGTGACGCCG

[0060] AAGCGCCTTTTAACTTTGTGTCATGCGACACTAAGTTTTATTCGGTATTAGCATCTGTTT

[0061] CCAAATGTTATCCCCAGCCTTGAGGCAGGTTGTCCACGTGTTACTCACCCGTTCGCCA

[0062] CTCACTTGAAAGTGCAAGCACCTTTCGCTGTGCGTTCGACTTGCAT

[0063] The 16S rDNA sequence of strain MCW02 was compared using BLAST in NCBI (https: / / www.ncbi.nlm.nih.gov / ). Based on the above physiological and biochemical identification and 16S rDNA homology comparison results, the strain can be classified as Leuconostoc mesenteroides. The phylogenetic tree is constructed as shown in Figure 2 .

[0064] Example 2 Determination of antimicrobial activity of bacterial fermentation broth

[0065] Leuconostoc mesenteroides MCW02 was inoculated in MRS liquid culture medium and cultured at 37°C for 24 hours. The supernatant was extracted by centrifugation at 12000r / min for 5 minutes for antibacterial activity determination. Staphylococcus aureus, Escherichia coli, Salmonella, Klebsiella pneumoniae, Bacillus cereus, Pseudomonas aeruginosa and filamentous fungi such as Penicillium, Trichoderma, Aspergillus niger and Aspergillus oryzae were used as indicator bacteria. The punching antibacterial method was used to evaluate the antibacterial effect of antibacterial agents on indicator bacteria. The bacteria were inoculated in LB agar solid culture medium, and holes were evenly punched with a puncher at 2 cm away from the colony. Then 100 μL of the prepared fermentation broth was added to each hole, and sterile water was used as a control. After culturing at 37°C for 24 hours, the diameter of the inhibition zone was observed and measured. After the mold was inoculated in PDA medium and cultured for 1 to 2 days, a hole was punched 2 cm away from the colony, and 100 μL of the prepared fermentation liquid was added to each hole, and sterile water was used as a control. After culturing at 28°C for 72 hours, the diameter of the inhibition zone was observed and measured. As shown in Table 3, the fermentation supernatant of Leuconostoc mesenteroides MCW02 showed good antibacterial effects on 10 bacterial indicator bacteria, indicating that it has a relatively broad spectrum of antibacterial activity.

[0066] Table 3 Antibacterial activity results of Leuconostoc mesenteroides MCW02 fermentation broth

[0067] Serial number Indicator bacteria Diameter of inhibition zone (mm) 1 Staphylococcus aureus 25.1±0.9 2 Escherichia coli 22.3±0.7 3 salmonella 22.6±0.8 4 Klebsiella pneumoniae 15.8±0.5 5 Bacillus cereus 19.8±0.4 6 Pseudomonas aeruginosa 18.2±0.6 7 Penicillium 15.1±0.4 8 Trichoderma 14.6±0.6 9 Aspergillus niger 15.4±0.7 10 Aspergillus oryzae 13.8±0.5

[0068] Example 3 Determination of antimicrobial peptides

[0069] The antimicrobial peptides were determined using the internationally recognized "protease sensitivity method". After the fermentation broth obtained in Example 2 was centrifuged at 12000r / min for 10min, the bacteria were removed and the supernatant was retained. The pH value of the fermentation supernatant was adjusted to about 7.5 to eliminate the influence of organic acids or organic bases produced by the strain during the fermentation process on the antibacterial effect. Proteinase K, trypsin, pepsin, papain, and protease E were prepared into 10mg / mL solutions, 1mL was taken in a centrifuge tube, and 1mL of the treated fermentation supernatant was added to make the final concentration of the enzyme 5mg / mL. At the same time, 1mL of double distilled water was added to 1mL of the fermentation broth as a control group, incubated at 37℃ for 4h, and boiled in a boiling water bath at 100℃ for 5min after the incubation, and then the diameter of the inhibition zone was determined by agar diffusion method, and compared with the blank control to observe the changes in antibacterial activity. The results are shown in Table 4. The antibacterial substance is not very sensitive to protease E and papain, but is particularly sensitive to pepsin, proteinase K, and trypsin, and the activity is almost completely lost. Based on the comprehensive analysis of the above test results, it was determined that the antibacterial substance was an antimicrobial peptide.

[0070] Table 4 Effects of different protease treatments on antimicrobial substances

[0071]

[0072]

[0073] Note: Compared with the control group, * indicates P < 0.05, ** indicates P < 0.01.

[0074] Example 4 Antibacterial activity of strain fermentation broth treated with different methods

[0075] (1) Effect of different temperatures on the antibacterial effect of antimicrobial peptides in the fermentation broth of strain MCW02

[0076] The antimicrobial peptides in the fermentation broth of strain MCW02 were placed at 0, 25, 50, 75 and 100°C for 1 hour. Staphylococcus aureus was used as the indicator strain, and the antibacterial activity of the antimicrobial peptide fermentation broth was determined by the plate punching method. 80 μL of the antimicrobial peptide fermentation broth treated at different temperatures was added to each well. The results are shown in Figure 3 As shown in the figure, the antibacterial activity of the antimicrobial peptide fermentation broth after being treated at 0, 25, 50, 75 and 100℃ for 1h decreased with the increase of temperature, but it still had antibacterial activity after high temperature treatment. This shows that the antimicrobial peptide fermentation broth has good thermal stability.

[0077] (2) Effects of different pH acid-base solutions on the antibacterial effect of antimicrobial peptides in the fermentation broth of strain MCW02

[0078] The antimicrobial peptide fermentation broth was mixed with an aqueous solution of pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 (pH was adjusted with NaOH and HCl) in equal amounts, and allowed to react at 37°C for 1 hour. Staphylococcus aureus was used as the indicator strain, and the antibacterial activity of the antimicrobial peptide fermentation broth was determined by the plate punching method. 80 μL of the antimicrobial peptide fermentation broth treated at different temperatures was added to each well. The results are shown in Table 1. Figure 4 As shown in the figure, the antibacterial activity of the antimicrobial peptide fermentation broth remained almost unchanged between pH 4 and 9, and decreased between pH 2 and 4 and between pH 10 and 12, but still had antibacterial activity. This indicates that the acid-base stability range of the antimicrobial peptide fermentation broth is relatively wide.

[0079] Example 5 Feed antiseptic test of MCW02 fermentation broth

[0080] The obtained antimicrobial peptides from the fermentation broth of strain MCW02 were used in an antibacterial and mold removal experiment during the storage process with commercially available pig pellet feed. (1) 5 kg of pig pellet feed was evenly sprayed and mixed with 80 mL of the antimicrobial peptides from the fermentation broth of strain MCW02, and the bags were sealed and stored at room temperature; (2) Samples were taken every 10 days, and four samples were taken throughout the process. Each time, 20 g of feed was taken, ground and mixed with 100 mL of sterilized water to prepare feed bacteria extract; (3) The feed bacteria extract and 100 μL of antimicrobial peptides from the fermentation broth of strain MCW02 were placed in a centrifuge tube, mixed evenly, and 20 μL was taken. Then, the above 20 μL of mixed solution was fully mixed with 80 μL of sterilized water in an ultra-clean workbench, and then the plate was plated on a solid LB culture medium and placed at 37°C for constant temperature culture for 12 hours. The next day, the bacterial colonies on the solid LB culture medium were counted. At the same time, a high-temperature sterilized PBS buffer was used as the control group. Each experiment was repeated three times, and the bacterial situation at different time points was analyzed.

[0081] The experimental results showed that compared with the group treated with 100uL sterilized PBS, the addition of antimicrobial peptides from the fermentation broth of strain MCW02 could significantly reduce the number of foreign bacteria in pig pellet feed during storage (Table 5).

[0082] Table 5 The results of the antibacterial and mildew-removal experiments of the antimicrobial peptides from the fermentation broth of the strain MCW02 on the storage process of pig pellet feed

[0083]

[0084]

[0085] Note: Compared with the PBS-treated group, ** indicates P < 0.01.

[0086] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, substitutions, modifications, combinations, simplifications, etc. that do not deviate from the spirit and principle of the present invention can be regarded as equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A strain of Leuconostoc mesenteroides producing broad-spectrum and highly effective antimicrobial peptides, characterized in that: The strain is Leuconostoc mesenteroides ( Leuconostoc mesenteroides )MCW02, deposited in the China Center for Type Culture Collection on August 10, 2023, with the deposit number: CCTCC NO:M 20231423.

2. Use of the Leuconostoc mesenteroides strain producing broad-spectrum and highly effective antimicrobial peptides as claimed in claim 1 in the preparation of a product for inhibiting the growth of Gram-positive bacteria, Gram-negative bacteria or fungi; The Gram-positive bacteria are Staphylococcus aureus or Bacillus cereus; the Gram-negative bacteria are Escherichia coli, Salmonella, Klebsiella pneumoniae or Pseudomonas aeruginosa; and the fungi are Penicillium, Trichoderma, Aspergillus niger or Aspergillus oryzae.

3. The use according to claim 2, characterized in that The product is the fermentation liquid of the Leuconostoc mesenteroides strain producing broad-spectrum and highly effective antimicrobial peptides or its supernatant.

4. The application of antimicrobial peptide MCW02-AMP in feed storage is characterized in that: The amino acid sequence of the antimicrobial peptide MCW02-AMP is LHRLCGSPSIPLSFNLAVVLPRRNT.

Images