Method for detecting mulberry brown spot based on mitochondrial cob gene

Abstract

The application discloses a method for detecting mulberry brown spot based on a mitochondrion cob gene. Specifically, the method comprises a mitochondrion cob gene of Neophloeospora maculans and application of the mitochondrion cob gene in detection of mulberry brown spot and / or Neophloeospora maculans, a primer group for detecting Neophloeospora maculans, a kit, a method and application thereof. The primer group for specifically detecting Neophloeospora maculans can be combined with a conservative region of a target gene in a specific manner, and the PCR reaction has high selectivity, can be sensitively detected when a small amount of pathogenic bacteria exists, and increases the accuracy and sensitivity of detection. The method is rapid and simple, is suitable for detection under laboratory and field conditions, helps to early detect diseases, and timely takes corresponding prevention and control measures, and reduces the influence of diseases on the yield and quality of mulberry.

Description

Technical Field

[0001] This invention belongs to the field of molecular detection technology. More specifically, it relates to a method for detecting mulberry brown spot disease based on the mitochondrial cob gene. Background Technology

[0002] Mulberry brown spot, also known as mulberry leaf spot disease, is a serious disease of mulberry trees caused by a fungus. The main pathogen is *Neophloeospora maculans*, a fungus belonging to the phylum Ascomycota. This fungus is particularly active in warm and humid climates and prefers to parasitize mulberry leaves, forming brown spots with typical symptoms, thereby reducing chlorophyll synthesis and photosynthetic efficiency. Mulberry brown spot is widely distributed in mulberry-growing areas, damaging leaf growth and development, and severely affecting leaf yield and quality.

[0003] Early and accurate identification and detection of the pathogen causing mulberry brown spot disease is crucial for developing effective control strategies. However, traditional pathogen detection techniques, such as mycelial culture and microscopic examination, are time-consuming, cumbersome, and have low sensitivity, requiring a high level of expertise from the personnel conducting the tests. Therefore, it is necessary to develop an easy-to-implement, rapid, accurate, and sensitive detection technique for mulberry brown spot disease.

[0004] Molecular detection and diagnosis offer advantages in specificity and sensitivity, enabling more accurate and reliable early detection. Mitochondrial genes are highly conserved and are potential targets for molecular detection; however, there are currently no reported molecular detection techniques specifically targeting fragments of the mitochondrial genes of the mulberry brown spot pathogen. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the defects and deficiencies of the existing technology and to provide a method for detecting mulberry brown spot disease based on the mitochondrial cob gene of the pathogen, N. maculans, which causes brown spot disease in mulberry trees.

[0006] The first objective of this invention is to provide the mitochondrial cob gene of *N. maculans*, the pathogen of mulberry brown spot disease, and its application in the detection of mulberry brown spot disease and / or *N. maculans*.

[0007] A second objective of this invention is to provide a detection reagent for the mitochondrial cob gene of *Sphaerocarpus spp.* in the detection of mulberry brown spot disease and / or *Sphaerocarpus spp.*

[0008] A third objective of this invention is to provide the application of the mitochondrial cob gene of *Sphaerocera mulberryensis* or its detection reagent in the preparation of a kit for detecting brown spot disease of mulberry and / or *Sphaerocera mulberryensis*.

[0009] The fourth objective of this invention is to provide a primer set for detecting mulberry brown spot disease and / or mulberry new brown spot spores.

[0010] The fifth objective of this invention is to provide a detection kit for mulberry brown spot disease and / or mulberry new brown spot spores.

[0011] The sixth objective of this invention is to provide a method for detecting mulberry brown spot disease and / or mulberry new brown spot scab.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution:

[0013] This invention uses high-throughput sequencing to assemble and annotate the mitochondrial sequencing results of N. maculans, the pathogen of mulberry brown spot disease. After database comparison, the mitochondrial cob gene of N. maculans is screened, which can achieve specific detection of mulberry brown spot disease. Its gene sequence is shown in SEQ ID NO.1.

[0014] Therefore, this invention applies to protect the mitochondrial cob gene of *Sargentodoxa cuneata*, with the nucleotide sequence shown in SEQ ID NO.1.

[0015] This invention designs a pair of specific primers targeting the mitochondrial cob gene of *Sphaerocarpus spp.*, comprising an upstream primer HBcobF and a downstream primer HBcobR. The nucleotide sequence of the upstream primer HBcobF is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer HBcobR is shown in SEQ ID NO.3. This invention utilizes these primers to detect *Sphaerocarpus spp.*, the pathogen of mulberry brown spot disease. The results show that the primers can specifically amplify the target fragment of a specific size, exhibiting good specificity and sensitivity.

[0016] Therefore, this invention applies for protection of a primer set for detecting mulberry brown spot disease and / or mulberry new brown spot spores, the primers comprising an upstream primer HBcobF and a downstream primer HBcobR, the nucleotide sequence of the upstream primer HBcobF being shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer HBcobR being shown in SEQ ID NO.3.

[0017] In addition, the following applications should all be within the scope of protection of this invention:

[0018] Application of the mitochondrial cob gene of *N. maculans* in the detection of brown spot disease in mulberry trees and / or *N. maculans*.

[0019] Application of a detection reagent for the mitochondrial cob gene of *Sphaerocera mulberryensis* in the detection of brown spot disease of mulberry and / or *Sphaerocera mulberryensis*.

[0020] Application of the mitochondrial cob gene of *Sphaerocera mulberryensis* or its detection reagent in the preparation of a kit for detecting brown spot disease of mulberry and / or *Sphaerocera mulberryensis*.

[0021] As one possible implementation, the reagent is a specific primer targeting the mitochondrial cob gene of *Sphaerocarpus spp.*.

[0022] Preferably, the specific primers include an upstream primer HBcobF and a downstream primer HBcobR; the nucleotide sequence of the upstream primer HBcobF is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer HBcobR is shown in SEQ ID NO.3.

[0023] The present invention also claims protection for a detection kit for mulberry brown spot disease and / or *Mulberry new brown spot* scab, said kit containing a detection reagent for the mitochondrial cob gene of *Mulberry new brown spot* scab.

[0024] As one possible implementation, the detection reagent includes the primer set of claim 7.

[0025] Preferably, the specific primers include an upstream primer HBcobF and a downstream primer HBcobR; the nucleotide sequence of the upstream primer HBcobF is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer HBcobR is shown in SEQ ID NO.3.

[0026] More preferably, the detection kit also includes reagents required for PCR amplification.

[0027] This invention also claims protection for a method for detecting mulberry brown spot disease and / or *Mulberry noroformis*. Specifically, the method uses a genetic sample of the test sample as a template and performs the detection using the aforementioned kit. Specifically, the genetic sample includes total DNA.

[0028] As one possible implementation, when the detection kit is a PCR detection kit, the sample is first subjected to a PCR amplification reaction. Then, the product is subjected to gel electrophoresis. If an amplification band of 386 bp appears, the sample to be tested is determined to be a positive sample for mulberry brown spot disease or contains *Mulberry new brown spot* spores.

[0029] Preferably, the PCR amplification reaction system is as follows: 12.5 μL of 2×GS Taq PCR Mix, 1 μL each of 10 pmol / μL upstream and downstream primers, 2 μL of DNA template, and 8.5 μL of ddH2O.

[0030] Preferably, the PCR amplification reaction conditions are: 95℃ for 3 min; 94℃ for 25 s, 57℃ for 25 s, 72℃ for 15 s, 34 cycles; 72℃ for 5 min.

[0031] The present invention has the following beneficial effects:

[0032] This invention first provides a mitochondrial cob gene that can be used for specific detection of mulberry brown spot disease. This gene has important application value and significance for the molecular diagnostic detection of mulberry brown spot disease.

[0033] This invention designs a pair of primers with good specificity and sensitivity targeting the mitochondrial cob gene of *Sphaerocera mulberryensis*, which can specifically bind to the conserved region of the target gene and can be used to detect mulberry brown spot disease plants infected with *Sphaerocera mulberryensis*.

[0034] Compared with traditional pathogen detection methods, the technical solution of this invention has many advantages. First, this technology is based on specific fragments of the pathogen's mitochondrial gene; the high conservation of the mitochondrial gene increases the accuracy and reliability of the detection. Second, the PCR primers designed in this invention are highly selective, allowing for sensitive detection even in the presence of small amounts of pathogens, thus improving detection sensitivity. Furthermore, the method of this invention is rapid and simple, suitable for pathogen detection under both laboratory and field conditions, helping to identify diseases early and implement timely control measures, reducing the impact of diseases on mulberry yield and quality. The technical solution of this invention can be widely applied to the early warning and control of mulberry brown spot disease, which is of great significance for promoting the sustainable development of the mulberry industry. Attached Figure Description

[0035] Figure 1 This is a field image of brown spot disease in mulberry trees.

[0036] Figure 2 This is a diagram showing the growth morphology of the pathogen causing brown spot disease of mulberry trees on PDA medium.

[0037] Figure 3This is the PCR detection and identification result of *N. maculans*, the pathogen of mulberry brown spot disease, using specific primers. Lane M: Takara DL 2000 Marker; Lane 1: Total DNA of *N. maculans*, the pathogen of mulberry brown spot disease; Lane 2: Blank control (ddH2O); Lane 3: *Fusarium solani* DNA; Lane 4: *Fusarium oxysporum* DNA; Lane 5: *Fusarium equiseti* DNA; Lane 6: *Colletotrichum siamense* DNA; Lane 7: *C. gloeosporioides* DNA; Lane 8: *Alternaria compacta* DNA; Lane 9: *A. solani* DNA; Lane 10: *Gonatophragmium mori* DNA.

[0038] Figure 4 This assay was performed to determine the total DNA concentration of *N. maculans*, the pathogen causing brown spot disease of mulberry trees; M: Takara DL2000 Marker; lane 1: 4.5 ng / μL; lane 2: 4.5 × 10⁻⁶. -1 ng / μL; Lane 3: 4.5 × 10 -2 ng / μL; lane 4 is 4.5×10 -3 ng / μL; lane 5 is 4.5×10 -4 ng / μL; Lane 6: 4.5 × 10 -5 ng / μL; Lane 7: 4.5 × 10 -6 ng / μL; Lane 8: 4.5 × 10 -7 ng / μL; lane 9 is 4.5×10 -8 ng / μL; lane 10 is 4.5×10 -9 ng / μL.

[0039] Figure 5These are the PCR test results of field samples of mulberry brown spot disease from different regions: M: Takara DL2000 Marker; Lane 1 is the pathogen of mulberry brown spot disease, N. maculans; Lane 2 is a healthy mulberry leaf sample; Lanes 3-6 are brown spot disease samples of "Qiang Sang No. 1" from Hanyin County, Ankang City, Shaanxi Province; Lanes 7-9 are brown spot disease samples of "Qiang Sang No. 1" from Shiquan County, Ankang City, Shaanxi Province; Lanes 10-12 are brown spot disease samples of "Da 10" from Shiquan County, Ankang City, Shaanxi Province; Lanes 13-15 are brown spot disease samples of "Chang Guo Sang" from Shiquan County, Ankang City, Shaanxi Province; Lanes 16-18 are brown spot disease samples of "Qiang Sang No. 1" from Yongren County, Yunnan Province; Lanes 19-21 are brown spot disease samples of "Qiang Sang No. 1" from Yongren County, Yunnan Province; and Lanes 22-24 are brown spot disease samples of "Nong Sang 14" from Yongren County, Yunnan Province. Detailed Implementation

[0040] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0041] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0042] Example 1: Design of specific primers for N. maculans, the pathogen of mulberry brown spot disease.

[0043] 1. Primer design

[0044] This invention first completed the treatment of mulberry brown spot disease (its field disease diagram is shown in Figure 1). Figure 1 (As shown) The pathogen N. maculans (its growth morphology on PDA medium is as shown) Figure 2 High-throughput sequencing of mitochondria (as shown) was performed, and the sequencing results were assembled and the genes annotated. After database comparison, the mitochondrial cob gene of *N. maculans*, the pathogen of mulberry brown spot disease, was screened, and its nucleotide sequence is shown in SEQ ID NO.1. Furthermore, detection primers were designed specifically for the mitochondrial cob gene fragment of *N. maculans*, and the primer nucleotide sequences are shown in Table 1. After multiple selections and optimizations, a pair of specific primers HBcobF / HBcobR with excellent specificity and sensitivity were finally obtained, and their nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0045] Table 1. Primer sequences for specific detection of N. maculans, the pathogen of mulberry brown spot disease.

[0046]

[0047] The nucleotide sequence of the mitochondrial cob gene of the pathogen N. maculans, which causes brown spot disease of mulberry trees, is shown below (SEQ ID NO. 1):

[0048] CAGGTAACCCTTTAGGTGTTTCAGGTAATTACGACAGATTACCTTTTGCACCATACTTTATATTTAAGGATTTAATAACTATATTTTTATTTATTGTGGTTTTATCAGTATTTGTATTCTTTATGCCTAATGTATTA GGAGATAGTGAAAATTACGTTATGGCGAACCCAATGCAAACACCACCTGCTATAGTGCCTGAGTGATATTTATTACCTTTCTACGCTATATTAAGATCTATACCTAATAAATTATTAGGGGTTATTGCTATGTTTTCT GCTATATTAATTATACTAACTATGCCATTTACAGATTTAGGTAGGAGTAGAGGATTACAATTCAGACCTTTAAGTAAAATAGCATTTTATATTTTTGTTGCTAACTTTTTGATATTAATGCAACTTGGGGCTAAACAC GTTGAGTCTCCATTCATAGAATTTGGACAACTATGTACAATAATATACTTTGGGCACTTTTTAATTATAGTGCCTTTTATAAGTTTAATGGAGGATATTTTATTAAGAGGACATTTAAGTAGAGTAAAGATTAAATAA

[0049] The nucleotide sequence of the specific primer HBcobF is shown below (SEQ ID NO.2):

[0050] CGACAGATTACCTTTTGCACC

[0051] The nucleotide sequence of the specific primer HBcobR is shown below (SEQ ID NO.3):

[0052] CAACGTGTTTAGCCCCAAGT

[0053] 2. Primer verification

[0054] (1) Establishing the PCR amplification system and procedure

[0055] The PCR amplification reaction system was as follows: 12.5 μL of 2×GS Taq PCR Mix, 1 μL each of 10 pmol / μL forward and reverse primers, 2 μL of DNA template, and 8.5 μL of ddH2O. The PCR reaction conditions were: 95℃ for 3 min; 94℃ for 25 s, 57℃ for 25 s, 72℃ for 15 s, for 34 cycles; and 72℃ for 5 min.

[0056] (2) PCR-specific amplification

[0057] Using total DNA from *N. maculans*, the pathogen of mulberry brown spot disease, as a template, and total DNA from eight other fungi (Table 2) as negative controls, and ddH2O as a blank control, PCR amplification was performed using the primer sets shown in Table 1. The PCR products from the above samples were then subjected to agarose gel electrophoresis. The PCR amplification results of the primer set HBcobF / HBcobR are shown below. Figure 3 As shown, only lane 1 amplified a single bright band, with the target fragment size being approximately 386 bp, between 300 and 400 bp. The other eight fungi and the blank control did not amplify fragments of similar size. This indicates that the primer set HBcobF / HBcobR specifically amplified *N. maculans* DNA (lane 1), but failed to amplify *Fusarium solani* DNA (lane 3), *Fusarium oxysporum* DNA (lane 4), *Fusarium equisetifolium* DNA (lane 5), *Anthracnose siamensis* DNA (lane 6), *Colletotrichum gloeosporioides* DNA (lane 7), *Alternaria solani* DNA (lane 8), *Alternaria niger* DNA (lane 9), and *Morchella esculenta* DNA (lane 10). This demonstrates that the primer set HBcobF / HBcobR can specifically detect *N. maculans*, the pathogen of mulberry brown spot disease.

[0058] Table 28 Negative Control Fungi

[0059]

[0060] All of the above fungi were isolated and preserved at the Asia-Pacific Sericulture Training Center.

[0061] Example 2: Determination of the sensitivity of the detection of N. maculans, the pathogen of mulberry brown spot disease.

[0062] Total DNA was extracted from the pathogen N. maculans, the pathogen of mulberry brown spot disease, and its concentration was determined. The total DNA template was then serially diluted tenfold to 4.5 ng / μL and 4.5 × 10⁻⁶ ng / μL. -1 ng / μL, 4.5×10 -2 ng / μL, 4.5×10 -3 ng / μL, 4.5×10 - 4 ng / μL, 4.5×10-5 ng / μL, 4.5×10 -6 ng / μL, 4.5×10 -7 ng / μL, 4.5×10 -8 ng / μL, 4.5×10 -9 The total DNA at the above concentrations was measured in ng / μL and used as a template. The results were then analyzed using the PCR method described in Example 1.

[0063] Depend on Figure 4 It can be seen that the primer has good sensitivity, at 4.5 ng / μL, 4.5 × 10 -1 ng / μL, 4.5×10 -2 ng / μL, 4.5×10 -3 ng / μL, 4.5×10 -4 ng / μL, 4.5×10 -5 Clear bands were amplified using total DNA of *N. maculans* (ng / μL) as a template. The band size was approximately 386 bp, and the detection limit was 4.5 × 10⁻⁶. -5 The genome of N. maculans, the pathogen of mulberry brown spot disease, at ng / μL.

[0064] Example 3: Determination of field samples of mulberry brown spot disease

[0065] To rapidly detect mulberry brown spot disease, lesions on mulberry leaves with brown spot disease were collected, and total DNA was extracted as a template for mulberry brown spot diseased plant samples. Healthy mulberry samples were used as negative controls, and the pathogen of mulberry brown spot disease, N. maculans, was used as a positive control. PCR amplification was performed according to the detection system in Example 1.

[0066] The result is Figure 5 As shown, the mulberry brown spot pathogen N. maculans can be detected in brown spot disease samples of "Qiang Sang No. 1" in Hanyin County, Ankang City, Shaanxi Province; "Qiang Sang No. 1" in Shiquan County, Ankang City, Shaanxi Province; "Da 10" in Shiquan County, Ankang City, Shaanxi Province; "Chang Guo Sang" in Shiquan County, Ankang City, Shaanxi Province; "Qiang Sang No. 1" in Yongren County, Yunnan Province; and "Nong Sang 14" in Yongren County, Yunnan Province.

[0067] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A method for detecting mitochondria of *Sphaerocarpus mollissima*, the pathogen of mulberry brown spot disease. cob Genes, characterized by, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The mitochondria of *Morus alba* var. *brown* with brown spots as described in claim 1. cob Application of gene detection reagents in the detection of mulberry brown spot disease and / or mulberry new brown spot scab.

3. The mitochondria of *Morus alba* var. *brown* with brown spots as described in claim 1. cob Application of gene detection reagents in the preparation of kits for detecting mulberry brown spot disease and / or mulberry new brown spot scab.

4. The application according to any one of claims 2 to 3, characterized in that, The detection reagent is for the mitochondria of *Salvia miltiorrhiza* var. *brown*. cob Gene-specific primers.

5. The application according to claim 4, characterized in that, The specific primers include an upstream primer HBcobF and a downstream primer HBcobR; the nucleotide sequence of the upstream primer HBcobF is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer HBcobR is shown in SEQ ID NO.

3.

6. A primer set for detecting mulberry brown spot disease and / or *Mulberry noroformis*, characterized in that, It includes an upstream primer HBcobF and a downstream primer HBcobR; the nucleotide sequence of the upstream primer HBcobF is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer HBcobR is shown in SEQ ID NO.

3.

7. A detection kit for mulberry brown spot disease and / or *Mulberry noroformis*, characterized in that, Contains the mitochondria of the mulberry brown spot shell spores as described in claim 1 cob Gene detection reagents; the detection reagents include the primer set as described in claim 6.

8. The reagent kit according to claim 7, characterized in that, The test kit also includes reagents required for PCR amplification.

9. A method for detecting mulberry brown spot disease and / or *Mulberry noroformis*, characterized in that, Using the genetic sample of the sample to be tested as a template, the kit described in claim 7 is used for detection.

Images