Use of silica microspheres in the synthesis of ultralong oligonucleotides and methods of synthesizing ultralong oligonucleotides

Abstract

The application relates to the technical field of oligonucleotide synthesis, and discloses application of silica microspheres in synthesis of super-long oligonucleotides and a method for synthesizing super-long oligonucleotides, wherein the specific surface area of the silica microspheres is less than 1 m 2 / g, preferably, the surface of the silica microspheres is provided with a modification group. The method for synthesizing super-long oligonucleotides comprises: under coupling reaction conditions, coupling reaction of nucleoside phosphoramidite synthesis units by taking the silica microspheres with the modification group on the surface as a carrier. The carrier prepared by adopting the application can be used to prepare super-long oligonucleotides.

Description

Technical Field

[0001] This invention relates to the field of oligonucleotide synthesis technology, specifically to the application of silica microspheres in the synthesis of ultralong oligonucleotides and methods for synthesizing ultralong oligonucleotides. Background Technology

[0002] Research on the chemical synthesis of oligonucleotides (DNA oligos) began in the 1950s. In the 1980s, Marvin Caruthers first reported the synthesis of oligodinucleotides using the phosphodiester method. Currently, the most commonly used chemical synthesis method for oligonucleotides is the solid-phase phosphoramide method, which was developed by Beaucage and Caruthers and includes four steps: deprotection, coupling, capping, and oxidation.

[0003] Since the advent of the first chemical synthesis method for oligonucleotides, improvements in the length and quality of synthesizable oligonucleotides have opened up new application areas. The ability to synthesize oligonucleotides of 20-30 bases enabled the development of PCR and DNA sequencing, laying the foundation for recombinant DNA technology and molecular diagnostics. The ability to synthesize oligonucleotides of 50-100 bases enabled new technologies for precise manipulation of DNA, including site-directed mutagenesis and genetic engineering. However, due to inherent limitations, the length and quality of the produced oligonucleotides have reached a plateau. Current synthetic processes using deprotecting agents, coupling agents, and monomers can lead to byproducts such as depurination or incomplete capping, making the synthesis of ultra-long oligonucleotides extremely difficult. Nevertheless, scientists have an increasing demand for synthetic DNA of ultra-long oligonucleotides, and even gene lengths, for applications in cell and gene therapy, protein engineering, biomanufacturing, and basic life science research. Currently, longer DNA can only be produced by "splicing" shorter oligonucleotides together, but this process faces challenges from many specific sequences, such as DNA secondary structures, repetitive sequences, and high or low GC content. Furthermore, many applications require ultra-long single-stranded DNA, which is currently very difficult to prepare. Therefore, a novel or improved technology is needed to overcome the challenge of assembling these special sequences from shorter oligonucleotides and to directly synthesize single ultra-long oligonucleotides. Summary of the Invention

[0004] The purpose of this invention is to overcome the problem of short chain length in the preparation of oligonucleotides by chemical synthesis in the prior art, and to provide the application of silica microspheres in the synthesis of ultralong oligonucleotides and a method for synthesizing ultralong oligonucleotides.

[0005] To achieve the above objectives, the first aspect of the present invention provides the application of silica microspheres in the synthesis of ultralong oligonucleotides, wherein the silica microspheres have a specific surface area of ​​less than 1 m². 2 / g.

[0006] Preferably, the silica microspheres are solid silica microspheres, and the average particle size of the silica microspheres is 50-100 μm.

[0007] Preferably, the surface of the silica microspheres has modifying groups;

[0008] Preferably, the structure of silica microspheres with modified groups on the surface is as shown in formula (1);

[0009]

[0010] Where A is silica microspheres, R 1 and R 3 Each is independently selected from alkoxy groups, preferably C1-C. 10 Alkoxy; R 2 Selected from C1-C 10 Alkylene-O-C1-C 10 Alkylene, -C1-C 10 Alkylene-(NH-C1-C) 10 alkylene) n -、C1-C 10 Alkylene, n is an integer from 1 to 10; R 4 Selected from -NH-(CH2CH2O) m -C1-C 10 Alkylene -NH-, -(O-CH2CH2) p -O-, m and p are each an independent integer from 1 to 10; L1 is a linker group capable of coupling with nucleoside phosphoramidide.

[0011] Optionally, C1-C 10 Alkylene is C1-C 10 The substance is substituted with at least one of the following: alkyl ester group, hydroxyl group, and alkyloxy group.

[0012] A second aspect of the present invention provides a method for synthesizing ultralong oligonucleotides, the method comprising: using silica microspheres with modified groups on their surface as a carrier to perform a coupling reaction of nucleoside phosphoramidide synthesis units under coupling reaction conditions.

[0013] The carrier prepared using this invention can be used to prepare ultralong oligonucleotides (300-500 nt). In a preferred embodiment of this invention, using the carrier prepared by this invention in combination with a combined coupling agent and a combined deprotecting agent can further increase the chain length of the oligonucleotides. In a more preferred embodiment of this invention, using the carrier prepared by this invention in combination with a combined coupling agent, a combined deprotecting agent, and nucleoside phosphoramide can not only further increase the chain length of the oligonucleotides, but also improve the synthesis efficiency and shorten the synthesis time by approximately 40%. The method of this invention can also reduce reagent consumption by approximately 50%. Attached Figure Description

[0014] Figure 1 These are microscope images of the solid, non-porous silica microspheres used in the preparation of Example 1;

[0015] Figure 2 shows the liquid chromatography (a)-mass spectrum (b) of the preparation example A1 nucleoside phosphorimide trimer;

[0016] Figure 3 This is a PAGE gel image of the oligonucleotide chain identification in Example 1; where lane A: single-stranded DNA ladder; lane C: oligonucleotide synthesized in Comparative Example 1; lane E: 329nt oligonucleotide synthesized in Example 1;

[0017] Figure 4 This is a capillary electrophoresis peak diagram of the ultralong oligonucleotide chain amplified in Example 1;

[0018] Figure 5 This is a PAGE gel image for the identification of oligonucleotide chains in Example 2; where, left lane 1: single-stranded DNA ladder; left lane 2: 300nt, loading amount 50ng; left lane 3: 300nt, loading amount 100ng; left lane 4: 350nt, loading amount 50ng; left lane 5: 350nt, loading amount 100ng; left lane 6: 400nt, loading amount 50ng; left lane 7: 400nt, loading amount 100ng.

[0019] Figure 6 This is a chemical synthesis route diagram for silica microspheres (carriers) with modified groups on their surface;

[0020] Figure 7 This is a schematic diagram of the preparation of ultralong oligonucleotides using surface-treated solid silica microspheres as a carrier. Detailed Implementation

[0021] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0022] The first aspect of this invention provides the application of silica microspheres in the synthesis of ultralong oligonucleotides, wherein the silica microspheres have a specific surface area of ​​less than 1 m². 2 / g. In this invention, the specific surface area of ​​the silica microspheres can be 0.9m². 2 / g, 0.8m 2 / g, 0.7m 2 / g, 0.6m 2 / g, 0.5m 2 / g, 0.4m 2 / g, 0.3m 2 / g, 0.2m 2 / g, 0.1m 2 / g, 0.05m 2 / g, 0.04m 2 / g, 0.01m 2 / g, 0.001m 2 / g, and the range formed by any two of the above points.

[0023] According to the present invention, preferably, the specific surface area of ​​the silica microspheres is less than 0.2 m². 2 / g, more preferably less than 0.15m 2 / g, more preferably 0.03-0.05m 2 / g.

[0024] According to the present invention, preferably, the silica microspheres are solid silica microspheres, and the average particle size of the silica microspheres is 50-100 μm, for example 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, 100 μm, and any two of the above ranges. In the present invention, unless otherwise specified, the specific surface area and particle size of the silica microspheres refer specifically to the silica microspheres and do not include the surface modification groups of the silica microspheres, that is, to the silica microsphere raw material before pretreatment.

[0025] According to the present invention, preferably, the surface of the silica microspheres has modifying groups; more preferably, the structure of the silica microspheres with modifying groups on the surface is as shown in formula (1);

[0026]

[0027] Where A is silica microspheres, R 1 and R 3 Each is independently selected from alkoxy groups, preferably C1-C. 10 Alkoxy; R 2 Selected from C1-C 10 Alkylene-O-C1-C 10 Alkylene, -C1-C 10 Alkylene-(NH-C1-C) 10 alkylene) n -、C1-C 10 Alkylene, n is an integer from 1 to 10; R 4 Selected from -NH-(CH2CH2O) m -C1-C 10 Alkylene -NH-, -(O-CH2CH2) p -O-, m and p are each an independent integer from 1 to 10; L1 is a linker group capable of coupling with nucleoside phosphoramidide.

[0028] Optionally, R 2 R 4 Any C1-C 10 Alkylene is C1-C 10 The substance is substituted with at least one of the following: alkyl ester group, hydroxyl group, and alkyloxy group.

[0029] In this invention, C1-C 10 The alkoxy group can be CH3O-, CH3CH2O-, CH3(CH2)2O-, CH3(CH2)3O-, CH3(CH2)4O-, CH3(CH2)5O-, CH3(CH2)6O-, CH3(CH2)7O-, CH3(CH2)8O-, or CH3(CH2)9O-. C1-C 10 Alkoxy groups can be straight-chain alkoxy groups or branched-chain alkoxy groups.

[0030] In this invention, C1-C 10 Alkylenes can be, for example, methylene, ethylene, propylene, butylene, pentylene, hexylene, heptylene, octylene, nonylene, or decylene. Alkylenes can be straight-chain or branched.

[0031] In this invention, n, m, and p can each independently be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0032] According to the present invention, preferably, the silica microspheres with modified groups on their surface have the structure shown in formula (2) or formula (3):

[0033]

[0034] In this invention, the linker group can be provided by a linker conventional in the art that can undergo a coupling reaction with nucleoside phosphoramidite. Preferably, the linker is selected from linker 1 to linker 31 described below, and particularly preferably from linker 31.

[0035] The present invention also provides a method for preparing silica microspheres with modified groups on their surface as described above, the method comprising the following steps:

[0036] (1) Pretreatment of silica microspheres yields silica microspheres with hydroxyl-rich surfaces;

[0037] (2) The silica microspheres rich in hydroxyl groups on the surface were grafted with silane reagent for the first time;

[0038] (3) In the presence of condensing agent and alkylamine, the first grafted silica microspheres undergo a condensation reaction with the linker.

[0039] According to the present invention, preferably, the pretreatment conditions include: a temperature of 20-50°C and a time of 0.5-5 hours, preferably 1-2 hours.

[0040] According to the present invention, preferably, the pretreatment method includes pretreating the silica microspheres with a fluorine-containing solution.

[0041] According to the present invention, preferably, the amount of fluorine-containing solution, calculated as fluorine, is 0.5-1 mol per 100 g of silica microspheres.

[0042] According to the present invention, preferably, the concentration of the fluorine-containing solution is 0.5-3 mol / L, and the solute in the fluorine-containing solution includes at least one of hydrogen fluoride, ammonium fluoride, tetrabutylammonium fluoride, tetraethylammonium fluoride, triethylamine hydrogen fluoride, and pyridine hydrogen fluoride.

[0043] According to the present invention, preferably, the conditions for the first grafting include: a temperature of 25-50°C and a time of 1-24 hours, preferably 16-18 hours.

[0044] According to the present invention, preferably, the amount of silane reagent used is 50-100g relative to 100g of silica microspheres.

[0045] According to the present invention, in order to obtain a carrier with less steric hindrance, the silane reagent preferably includes at least one selected from 5,6-epoxyhexyltriethoxysilane, 3-[2-(2-aminoethylamino)ethylamino]propyl-trimethoxysilane, [8-(epoxypropyloxy)-n-octyl]trimethoxysilane, 3-glycidyl etheroxypropyltriethoxysilane, 11-(triethoxysilyl)undecane-1-amine, and 11-aminoundecyltrimethoxysilane. In the present invention, the silane reagent can be contacted in solution with silica microspheres rich in hydroxyl groups for a first grafting. The content of the silane reagent in the solution can be 1-50% by weight, and the solvent in the solution can be acetonitrile.

[0046] According to the present invention, in order to further reduce the steric hindrance effect of the carrier, preferably, the preparation method further includes performing a second grafting on the first grafted silica microspheres, and then subjecting them to a condensation reaction with the linker.

[0047] According to the present invention, preferably, the conditions for the second grafting include: a temperature of 25-50°C and a time of 1-24 hours, preferably 16-18 hours.

[0048] According to the present invention, preferably, the amount of grafting reagent used for the second grafting is 0.5-2g relative to 100g of silica microspheres.

[0049] According to the present invention, preferably, the grafting reagent used for the second grafting (hereinafter referred to as the second grafting reagent) is a long-chain molecule containing an active functional group, wherein the active functional group is selected from hydroxyl groups, and the number of carbon atoms in the long-chain molecule is 2-50 (preferably 5-50); more preferably, the long-chain molecule containing an active functional group includes at least one of pentaethylene glycol, hexaethylene glycol, and polyethylene glycol (e.g., PEG-800).

[0050] According to the present invention, preferably, the conditions for the condensation reaction include: a temperature of 20-50°C and a time of 1-24 hours, preferably 16-18 hours.

[0051] According to the present invention, preferably, the amount of the linker is 0.5-2g, the amount of the condensing agent is 1-4g, and the amount of the alkylamine is 0.5-2g relative to 100g of silica microspheres.

[0052] According to the present invention, preferably, the connector is selected from at least one of the following compounds:

[0053]

[0054]

[0055]

[0056] DMTr (dimethoxytriphenylmethyl) is the protecting group. DMTr can also be replaced with MMTr (p-methoxytriphenylmethyl), Tr (triphenylmethyl), etc. The carboxyl group in the linker undergoes a condensation reaction with the amine or hydroxyl groups in the second grafted silica microspheres.

[0057] According to the present invention, preferably, the condensing agent comprises at least one selected from dicyclohexylcarbodiimide, diisopropylcarbodiimide, N-ethyl-N'-3-dimethylaminopropylcarbodiimide or its hydrochloride, (benzotriazol-1-yloxy)tripyrrolidinephosphonium hexafluorophosphate, O-(benzotriazol-1-yl)-N,N,N',N'-tetramethylurea tetrafluoroborate, 1-[bis(dimethylamino)methylene]-5-chloro-1H-benzotriazol-3-oxide hexafluorophosphate, and O-(benzotriazol-1-yl)-N,N,N',N'-tetramethylurea hexafluorophosphate.

[0058] According to the present invention, preferably, the alkylamine is an alkylamine having 2-10 carbon atoms, and more preferably N,N-diisopropylethylamine.

[0059] In this invention, the linker, condensing agent, and alkylamine can be contacted with the first grafted silica microspheres in solution form to undergo a condensation reaction. The concentrations of the linker solution, condensing agent solution, and alkylamine solution can each be independently 1-5 mmol / L, and the solvent in the solution can be acetonitrile.

[0060] The inventors further discovered that when silica microspheres with modified groups on their surface, prepared using long-chain molecules with amine groups as active functional groups, are used as carriers for oligonucleotide synthesis, ultralong oligonucleotides can also be prepared, with chain lengths reaching over 300 nt. Therefore, the active functional group in the long-chain molecules containing active functional groups of this invention can also be an amine group. Preferably, the long-chain molecules containing active functional groups are... Where q is an integer from 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10).

[0061] In this invention, when the grafting reagent used for the second grafting contains long-chain molecules with active functional groups selected from... When performing a second graft, it is necessary to protect the amine group (NH2) at one end of the long-chain molecule with a protecting group, for example, using... The grafting reagent used as the second grafting agent is used to perform a second grafting on the silica microspheres after the first grafting.

[0062] According to the present invention, preferably, the present invention also provides a method for employing... A method for preparing silica microspheres with modified groups on the surface of the structure shown in formula (2) using a second grafting reagent: (1) Pre-treating silica microspheres with a fluorine-containing aqueous solution to obtain silica microspheres with hydroxyl-rich surfaces; (2) Performing a first grafting on the silica microspheres with hydroxyl-rich surfaces using a silane reagent; (3) Performing a second grafting on the first-grafted silica microspheres using a second grafting reagent in the presence of an alkylamine, then removing the protecting group in the second grafting reagent, and then, in the presence of a condensing agent, causing the second-grafted silica microspheres to undergo a condensation reaction with the linker; This preparation method can be referred to Figure 6 The flowchart is shown. Step (3) may further include reacting acetic anhydride with the hydroxyl groups in the second grafted silica microspheres to prevent the linker from reacting with the hydroxyl groups. The inventors further discovered that using an amino group as the active functional group can further increase the chain length of the ultralong oligonucleotide compared to using a hydroxyl group as the active functional group.

[0063] A second aspect of the present invention provides a method for synthesizing ultralong oligonucleotides, the method comprising: using silica microspheres with modified groups on their surface as a carrier to perform a coupling reaction of nucleoside phosphoramidide synthesis units under coupling reaction conditions.

[0064] Oligonucleotides, as is known in the art, are typically prepared under anhydrous and anaerobic conditions. Therefore, the preparation of oligonucleotides in this invention is also carried out under anhydrous and anaerobic conditions commonly used in the art.

[0065] According to the present invention, preferably, the method further includes: removing the protecting groups of the silica microspheres using a deprotecting agent, and then performing a coupling reaction.

[0066] According to the present invention, preferably, the deprotecting agent comprises at least one selected from trichloroacetic acid, dichloroacetic acid, and 3,5-dinitrobenzoic acid. More preferably, the deprotecting agent comprises trichloroacetic acid, dichloroacetic acid, and 3,5-dinitrobenzoic acid. Even more preferably, the deprotecting agent is composed of trichloroacetic acid, dichloroacetic acid, and 3,5-dinitrobenzoic acid.

[0067] According to the present invention, preferably, the weight ratio of trichloroacetic acid, dichloroacetic acid, and 3,5-dinitrobenzoic acid is 1:1-10:1-10. In the present invention, the weight ratio of trichloroacetic acid, dichloroacetic acid, and 3,5-dinitrobenzoic acid can be 1:1:1, 1:2:2, 1:3:3, 1:4:4, 1:5:5, 1:6:6, 1:7:7, 1:8:8, 1:9:9, 1:10:10, or any two of the above ratios within a range.

[0068] According to the present invention, preferably, the temperature for removing the protective groups from the silica microspheres is 25-50°C.

[0069] According to the present invention, preferably, the coupling reaction is carried out in the presence of a coupling agent, which is at least one selected from 5-benzylthio-1H-tetrazole, N-methylimidazolium, and 4,5-dicyanoimidazolium. More preferably, the coupling agent comprises 5-benzylthio-1H-tetrazole, N-methylimidazolium, and 4,5-dicyanoimidazolium. Even more preferably, the coupling agent is composed of 5-benzylthio-1H-tetrazole, N-methylimidazolium, and 4,5-dicyanoimidazolium.

[0070] According to the present invention, preferably, the weight ratio of 5-benzylthio-1H-tetrazole, N-methylimidazolium, and 4,5-dicyanoimidazolium is 5-15:0.5-3:1. In the present invention, the weight ratio of 5-benzylthio-1H-tetrazole, N-methylimidazolium, and 4,5-dicyanoimidazolium can be 5:0.5:1, 6:0.5:1, 7:0.5:1, 8:0.5:1, 9:0.5:1, 10:0.5:1, 11:0.5:1, 12:0.5:1, 13:0.5:1, 14:0.5:1, 15:0.5:1, 9:2:1, 11:2:1, and any two of the above ratios within a range.

[0071] According to the present invention, preferably, the nucleoside phosphoramide synthesis unit includes a nucleoside phosphoramide monomer and / or a nucleoside phosphoramide polymer, preferably, the nucleoside phosphoramide polymer includes at least one of a nucleoside phosphoramide dimer, a nucleoside phosphoramide trimer and a nucleoside phosphoramide tetramer.

[0072] According to the present invention, preferably, the nucleoside phosphoramide dimer has the structure shown in formula (1), and the nucleoside phosphoramide trimer has the structure shown in formula (2);

[0073]

[0074] Among them, B1, B2 and B3 are each an independent base or a base with a protecting group, R is selected from H or -O-hydroxy protecting group, and Pg is a phosphorus amide protecting group.

[0075] According to the present invention, preferably, the base is selected from at least one of adenine, thymine, cytosine and guanine.

[0076] According to the present invention, preferably, the protecting group of the base is selected from substituted or unsubstituted C1-C10 acyl groups and substituted or unsubstituted amidine groups; more preferably, the C1-C10 acyl groups are selected from acetyl, benzoyl, isobutyryl, phenoxyacetyl, and methoxyacetyl, and the amidine group is selected from dimethylformamidinyl.

[0077] According to the present invention, preferably, the hydroxyl protecting group in R is selected from triisopropylsilyloxymethyl, tert-butyldimethylsilyl, tert-butyldithiomethyl, 2-cyanoethoxymethyl, neopentyloxymethyl, bis-(2-acetoxyethoxy)methyl, thiocarbamate, ethyl iminooxymethylpropionate, 2-cyano-2,2-dimethylethyleneimine-N-oxymethyl, p-nitrobenzyloxymethyl, cyanoethylated, 2-(4-toluenesulfonyl)ethoxymethyl, and acetal acetylpropionate.

[0078] According to the present invention, preferably, Pg is selected from alkyl, -CH2CH2CN, -CH2CH=CHCH2CN, p-CH2C6H4CH2CN, -(CH2)2-N(H)COCF3, -CH2CH2Si(C6H5)2CH3, and -CH2CH2N(CH3)COCF3.

[0079] In this invention, the nucleoside phosphoramide dimer can be obtained by condensing two nucleoside phosphoramide monomers, or by synthesizing the nucleoside phosphoramide dimer using other methods in the prior art, or by directly purchasing the nucleoside phosphoramide dimer. For example, the nucleoside phosphoramide dimer is selected from AA, AC, AT, AG, CA, CT, CC, CG, TG, TT, TA, TC, GA, GC, GT, and GG.

[0080] According to the present invention, the nucleoside phosphoramide trimer can be obtained by condensing two nucleoside phosphoramide monomers, or by synthesizing the nucleoside phosphoramide trimer using other methods in the prior art, or by directly purchasing the nucleoside phosphoramide trimer. Examples include: TTC, AAA, AAC, ACT, ATC, ATG, CAG, CAT, CCG, CGT, CTG, GAA, GAC, GCT, GGT, GTT, TAC, TCT, TGC, TGG, and TTC.

[0081] In this invention, in the nucleoside phosphoramide synthesis unit, A is adenine ribonucleoside, T is thymine ribonucleoside, C is cytosine ribonucleoside, and G is guanine ribonucleoside.

[0082] According to the present invention, preferably, the temperature of the coupling reaction is 20-40°C.

[0083] According to a specific embodiment of the present invention, the method for synthesizing ultralong oligonucleotides (e.g.) Figure 7 (As shown), the method includes the following steps:

[0084] (a) Under the action of a deprotecting agent, the protecting groups on the linker of the above-described carrier are removed;

[0085] (b) In the presence of a coupling agent and the support obtained in step (a), the nucleoside phosphoramide synthesis unit is coupled together.

[0086] (c) The product of the coupling reaction is subjected to a first capping and oxidation;

[0087] (d) Repeat steps (a)-(c).

[0088] According to the present invention, preferably, step (c) further includes a second capping of the oxidation product. More preferably, the capping reagent used for the second capping can be the same as the first capping reagent.

[0089] According to the present invention, preferably, in step (a), the deprotecting agent is used in solution form, and the single dosage of the deprotecting agent solution is 10-40 μL relative to 20 mg of carrier. The deprotecting agent can be formulated as a solution of toluene or dichloromethane, and the content of the deprotecting agent in the solution can be 1-5% by weight. The content of the deprotecting agent in the solution refers to the total weight percentage of trichloroacetic acid, dichloroacetic acid, and 3,5-dinitrobenzoic acid in the solution.

[0090] According to the present invention, preferably, in step (a), the coupling agent is used in solution form, and the single dosage of the coupling agent solution is 5-20 μL relative to 20 mg of carrier. The coupling agent can be formulated as a solution of acetonitrile, and the concentration of the coupling agent in the solution can be 0.1-0.5 mol / L. The concentration of the coupling agent in the solution refers to the sum of the concentrations of 5-benzylthio-1H-tetrazole, N-methylimidazolium, and 4,5-dicyanimidazolium in the solution.

[0091] According to the present invention, preferably, in step (a), the nucleoside phosphoramide synthesis unit is used in solution (e.g., the deprotecting agent is prepared into a solution of acetonitrile), and the single use of the nucleoside phosphoramide synthesis unit solution is 5-20 μL relative to 20 mg of carrier.

[0092] According to the present invention, the first capping is to block sites where the coupling reaction failed to occur, preventing the coupling reaction from occurring in the next cycle and introducing a deleted sequence. The first capping can be a conventional capping reagent in the art. Preferably, the first capping reagent is selected from at least one of acetic anhydride, pyridine, and N-methylimidazole. More preferably, the first capping reagent is selected from acetic anhydride, pyridine, and N-methylimidazole, wherein the weight ratio of acetic anhydride, pyridine, and N-methylimidazole is 1:0.5-2:70-90.

[0093] According to the present invention, the oxidation is to oxidize the trivalent phosphine after the coupling reaction to pentavalent phosphine, thereby improving the stability of the oligonucleotide chain; the oxidation can be carried out using conventional oxidizing agents in the art, preferably selected from iodine, more preferably a mixed solution of iodine, pyridine and water, wherein the concentration of iodine in the mixed solution is 0.01-0.1 mol / L, and the volume ratio of pyridine to water is 15-20:1.

[0094] According to the present invention, preferably, the method further includes sequentially cleaving, deprotecting, desalting, and purifying the product of the coupling reaction to obtain an ultralong oligonucleotide. The cleavage, deprotecting, desalting, and purification can employ methods commonly used in the art.

[0095] The present invention will be described in detail below through embodiments. In the following embodiments,

[0096] The room temperature is approximately 25-30℃.

[0097] Preparation Example A1

[0098] This preparation example illustrates the method for preparing nucleoside phosphoramid trimer.

[0099]

[0100] Preparation process of nucleoside phosphoramidide trimer TTC

[0101] Specific experimental steps:

[0102]

[0103] (1) Compound 1 (50 g, 78.9 mmol) was added to a 2 L single-necked flask, a magnetic stir bar was added, and then 800 ml of dry pyridine was added. The mixture was stirred magnetically until compound 1 was fully dissolved. The reaction system was then purged with nitrogen and placed in an ice bath to maintain the temperature at 0 °C. Tert-butyldimethylchlorosilane (14.27 g, 94.68 mmol) was added to the pyridine solution of compound 1, and the reaction was stirred thoroughly under a nitrogen atmosphere. After 30 minutes, the ice bath was removed, and the reaction was allowed to proceed at room temperature. After 4 hours, the sample was analyzed by ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS). The analysis showed that the starting material compound 1 (MW: 633.70) had reacted completely, yielding product compound 2 (MW: 747.96). Add 400 ml of saturated sodium bicarbonate aqueous solution at 0°C to the reaction mixture, followed by extraction with dichloromethane (600 ml * 2). UPLC-MS analysis was performed to detect product residues in the aqueous phase. The organic phases from the two extractions were combined, dried over anhydrous sodium sulfate, filtered, and then the solvent dichloromethane was removed by rotary evaporation under reduced pressure, yielding a brown oily substance. The crude product was redissolved in 400 ml of dichloromethane, and pyridine was washed with 2% citric acid aqueous solution, followed by extraction and separation. After several repeated washings, a sample was taken for UPLC-MS analysis, showing that pyridine was largely removed. The dichloromethane solution was dried over anhydrous sodium sulfate, filtered, and then the solvent dichloromethane was removed by rotary evaporation under reduced pressure, yielding a brown oily substance. The crude product requires no further processing and can be used in the next reaction.

[0104]

[0105] (2) Compound 2 (59.02 g, 78.91 mmol) was dissolved in 800 ml of dry dichloromethane and cooled to 0°C in an ice bath. Dodecanethiol (25.55 g, 126.25 mmol, 30.24 ml) was added with magnetic stirring, and the temperature was maintained at 0°C. After 30 minutes, trifluoroacetic acid (44.99 g, 394.54 mmol, 30.19 ml) was slowly added. Half an hour later, a sample was taken for UPLC-MS analysis. The starting compound 2 (MW: 747.96) reacted completely to obtain product compound 3 (MW: 445.59). Excess trifluoroacetic acid was neutralized by adding saturated sodium bicarbonate aqueous solution at 0°C to the reaction system. The product was then extracted with dichloromethane (600 ml * 3). The aqueous phase was analyzed by UPLC-MS; no compound 3 remained in the aqueous phase. The organic phase solutions were combined, dried with anhydrous sodium sulfate, and the solvent dichloromethane was removed by vacuum filtration and rotary evaporation under reduced pressure, yielding an oily crude product. The crude product was dissolved in 2000 ml of methyl tert-butyl ether / n-hexane (V:V = 1:1) and stirred thoroughly with a magnetic stirrer to obtain a white suspension. This suspension was filtered to obtain a white filter cake. The filter cake was rotary evaporated and dried with an oil pump to obtain a white powder. UPLC-MS analysis showed a product purity >95%.

[0106]

[0107] (3) Compound 3 (10 g, 22.44 mmol) was dissolved in 200 ml of dry dichloromethane (DCM). Then, under magnetic stirring, DCI (4,5-dicyanimidazole, 5.3 g, 2 eq) was added and dissolved until clear. Then, compound (I) (20.09 g, 1.2 eq) was added. The reaction system was stirred at room temperature under nitrogen for 2 hours. Samples were taken for UPLC-MS analysis. After the starting material was completely converted into the intermediate product, the reaction system was cooled to 0 °C in an ice bath. 70% tert-butanol peroxide (7.22 g, 2.5 eq) was added, and the reaction system was kept at 0 °C. After 2 hours, samples were taken for UPLC-MS analysis. The oxidation of the intermediate product was complete. Then, dodecyl mercaptan (7.26 g, 1.6 eq) was added, and the mixture was stirred at 0 °C for 10 min. Then, trifluoroacetic acid (12.79 g, 5 eq) was slowly added dropwise. After 30 minutes, the ice bath was removed, and a sample was taken for UPLC-MS analysis. The 5'-DMTr protecting group was completely removed. The reaction system was placed in an ice bath at 0°C, and excess trifluoroacetic acid was neutralized by adding saturated sodium bicarbonate aqueous solution. Extraction and washing were then performed, the organic phases were combined, dried with anhydrous sodium sulfate, filtered, and the dichloromethane solvent was removed by rotary evaporation. The crude product was purified using a thin-layer silica gel column chromatography (0–10 wt% ethanol in dichloromethane solution). The concentrated fraction was dried with an oil pump to obtain 16.4 g of white powder. A sample was taken for UPLC-MS analysis, and the product purity was >95%.

[0108]

[0109] (4) Compound 4 (1.93 g, 2.61 mmol) was dissolved in 20 mL of dry dichloromethane. Then, under magnetic stirring, DCI (4,5-dicyanimidazole, 615.38 mg, 2 eq) and imidazole (2.06 g, 15 eq) were added. After dissolution and clarification, compound dT-phosphite (2.339 g, 1.2 eq) was added. The reaction system was stirred at room temperature under nitrogen for 2 hours. Samples were taken for UPLC-MS analysis. After the starting material was completely converted to the intermediate product, the reaction system was cooled to 0 °C using an ice bath. 70% tert-butanol peroxide (587 mg, 2.5 eq) was added, and the reaction system was kept at 0 °C. After 2 hours, samples were taken for UPLC-MS analysis, and the oxidation of the intermediate product was complete. Subsequently, Py.HF (pyridine hydrofluoric acid, 521.24 mg, 10 eq) was added slowly dropwise at 0 °C. After 30 minutes, the ice bath was removed, and the reaction was allowed to proceed at room temperature for 1 hour. A sample was taken for UPLC-MS analysis, and the 3'-TDDMS protecting group was completely removed. The reaction system was then placed in an ice bath at 0°C, and excess trifluoroacetic acid was neutralized by adding saturated sodium bicarbonate aqueous solution. Extraction and washing were then performed, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the dichloromethane solvent was removed by rotary evaporation. The crude product was purified using a thin-layer silica gel column chromatography (0–10% wt% ethanol in dichloromethane solution). The concentrated fraction was dried over an oil pump to obtain 16.4 g of white powder. A sample was taken for UPLC-MS analysis, and the product purity was >95%.

[0110]

[0111] (5) Dissolve 2 g (1.48 mmol) of dried compound 5 in 20 mL of dry dichloromethane, then add DCI (4,5-dicyanimidazole, 350.39 mg, 2.97 mmol, 2 eq). Stir under nitrogen protection until clear. Weigh phosphorus reagent (668.5 mg, 2.23 mmol, 1.5 eq) and add it to the reaction system under nitrogen atmosphere. React at room temperature for half an hour, then take a sample for UPLC-MS analysis. The reaction is complete. Add the reaction system dropwise to 100 mL of n-hexane under stirring. A white precipitate forms. Filter and remove the filtrate to obtain a white solid compound 6. Dry by rotary evaporation at low temperature. The product is sent for UPLC-MS analysis. 31 Phosphorus NMR was used for analysis and detection. The UPLC-MS analysis results are shown in Figure 2, where Figure 2(a) is the ultra-high performance liquid chromatography (UHPLC) chromatogram and Figure 2(b) is the mass spectrum. Analysis of the HPLC and mass spectra yielded the molecular weight of the white solid compound 6. Phosphorus NMR spectroscopy showed that the product purity was >95%, making it suitable for subsequent oligonucleotide synthesis reactions.

[0112] Preparation Example A2-20

[0113] Nucleoside phosphoramid trimers were prepared according to the method of Preparation Example A1: AAA, AAC, ACT, ATC, ATG, CAG, CAT, CCG, CGT, CTG, GAA, GAC, GCT, GGT, GTT, TAC, TCT, TGC, TGG, and TTC.

[0114] Preparation Example 1

[0115] This preparation example illustrates the method for preparing carriers for the chemical synthesis of ultralong oligonucleotides.

[0116] (1) 100g of solid, non-porous silica microspheres (microscopic image of solid, non-porous silica microspheres as shown in the figure) Figure 1 As shown, the solid, non-porous silica microspheres have an average particle size of approximately 60 μm and a specific surface area of ​​approximately 0.045 m². 2 The mixture (g) was added to 500 mL of ammonium fluoride aqueous solution (concentration 2 mol / L), stirred at room temperature, and sonicated for 1 h. It was then washed with deionized water and dried. The stirring speed was 60 r / min.

[0117] (2) A first grafting was performed by adding an acetonitrile solution (10%, w / w) of 3-glycidyl etheroxypropyltriethoxysilane to the silica microspheres obtained in step (1) during drying. The conditions for the first grafting included: room temperature and a time of 16 h. The amount of silane reagent used was 80 g relative to 100 g of silica microspheres.

[0118] (3) Pentaethylene glycol was added to the first grafted silica microspheres for a second grafting, followed by washing with deionized water and drying. The conditions for the second grafting included a temperature of 30°C and a time of 16 hours. The amount of grafting reagent used for the second grafting was 2 g per 100 g of silica microspheres.

[0119] A condensation reaction was carried out on the second-grafted silica microspheres by adding an acetonitrile solution (2 mM) of the linker, an acetonitrile solution (3 mM) of the condensing agent, and an acetonitrile solution (4 mM) of DIEA (N,N-diisopropylethylamine) to the microspheres to obtain silica microspheres with modified groups on the surface. The condensation reaction conditions were: temperature 25 °C, time 16 h. The amount of linker used was 1 g, the amount of condensing agent was 2 g, and the amount of DIEA was 1 g per 100 g of silica microspheres. The linker was unylinker; the condensing agent was O-(benzotriazol-1-yl)-N,N,N',N'-tetramethylurea hexafluorophosphate.

[0120] Example 1

[0121] 20 mg of the carrier prepared in Example 1 was loaded into an empty synthesis column of a solid-phase synthesizer, and then the synthesis of ultra-long oligonucleotides was automatically started according to the set program. The synthesis process (performed at room temperature) included:

[0122] (a) Add a toluene solution of the combined deprotecting agent (the content of the combined deprotecting agent in the toluene solution of the combined deprotecting agent is 3%, w / w) to the synthesis column to remove the protecting groups on the carrier linker; then clean with a cleaning agent; wherein the combined deprotecting agent is composed of trichloroacetic acid, dichloroacetic acid and 3,5-dinitrobenzoic acid in a weight ratio of 1:1:2;

[0123] (b) An acetonitrile solution of a combined coupling agent (the concentration of the combined coupling agent in the acetonitrile solution of the combined coupling agent is 0.2 mol / L) and an acetonitrile solution of the nucleoside phosphoramide trimer prepared in Preparation Example A1-20 are added to the synthesis column to allow the activated nucleoside phosphoramide trimer and a small amount of nucleoside phosphoramide monomers (T, C, G, A) to undergo a coupling reaction; wherein the combined coupling agent is composed of 5-benzylthio-1H-tetrazole, N-methylimidazolium, and 4,5-dicyanimidazolium in a weight ratio of 10:1:1;

[0124] (c) The product of the coupling reaction is subjected to first capping, oxidation and second capping in sequence;

[0125] (d) Repeat steps (a)-(c).

[0126] The types and amounts of each reagent are shown in Table 1.

[0127] Table 1

[0128]

[0129]

[0130] Note: Cap A is a mixed solution of 10 wt% acetic anhydride / 10 wt% 2,6-dimethylpyridine / 80 wt% tetrahydrofuran; Cap B is a tetrahydrofuran solution of 16 wt% N-methylimidazolium; the oxidant is a solution of 0.05 mol / L I2 (the solvent consists of pyridine and water in a volume ratio of 95:5).

[0131] After the synthesis process, the vector containing the ultralong oligonucleotides was lysed and deprotected: treated with 30% ammonia at 80°C for 2 hours; then desalted and purified: a C18 desalting column was eluted with deionized water, and then recovered with 60% acetonitrile aqueous solution; the ultralong oligonucleotides were obtained. The synthesized crude ultralong oligonucleotides were analyzed using a polyacrylamide gel electrophoresis (PAGE). The recovered product was then recovered by PAGE gel extraction, and the purified ultralong oligonucleotides were amplified by PCR.

[0132] The chain length of ultralong oligonucleotides was determined using a capillary electrophoresis system (manufacturer: Taiwan Guangding, model Qsep). The testing method used was the Standard Cartridge Kit of the Qsep system. The test results are as follows: Figure 3 As shown, lane E is the electrophoresis diagram of the oligonucleotide prepared in Example 1. As can be seen from the figure, the oligonucleotide prepared in Example 1 can be clearly seen as a full-length product at the 329nt product band position.

[0133] The oligonucleotide synthesis sequence prepared in Example 1 is the Herceptin VLκ gene sequence:

[0134] TCGCACCAGCGTGTGCACCATCTGTCTTCATCTTCCCGCCATCTGATCGGAAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGA GTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGCACTGCGGCTCCTCA.

[0135] The capillary electrophoresis peak pattern of the oligonucleotide chains amplified in Example 1 (testing method: Standard Cartridge Kit of Qsep equipment) is shown below. Figure 4 As shown, by Figure 4 It can be seen that the nucleotide chain length after amplification by primers containing Flank regions on both sides is 361 bp.

[0136] Comparative Example 1

[0137] The procedure was carried out according to Example 1, except that the solid silica microsphere carrier was replaced with commercially available microporous glass (CPG). The commercially available microporous glass (CPG) had an average particle size of 80 μm and a specific surface area of ​​30 m². 2 / g, with a loading of 40 μmol / g and an average pore size of 1000 Å; and the combined deprotecting agent is replaced with trichloroacetic acid; the combined coupling agent is replaced with 5-ethylthio-1H-tetrazole; and the nucleoside phosphoramidite trimer is replaced with the nucleoside phosphoramidite monomer.

[0138] Test results are as follows Figure 3As shown in the figure, it can be seen that the full-length product cannot be observed at the target band position of 329 nt in lane C (electrophoresis diagram of oligonucleotides prepared in Comparative Example 1).

[0139] Example 2

[0140] The procedure was followed as described in Example 1, except that the nucleoside phosphoramidite trimer prepared in Preparation Example A1-20 was replaced with the TTT nucleoside phosphoramidite trimer, and a small amount of C, G, and A monomers were replaced with T monomers. The synthesized ultralong oligonucleotide crude product was identified using PAGE (polyacrylamide) gel analysis, and the test results are as follows. Figure 5 . Figure 5 In the middle, lane 1 from the left: single-stranded DNA ladder; lane 2 from the left: 300nt, 50ng loading amount; lane 3 from the left: 300nt, 100ng loading amount; lane 4 from the left: 350nt, 50ng loading amount; lane 5 from the left: 350nt, 100ng loading amount; lane 6 from the left: 400nt, 50ng loading amount; lane 7 from the left: 400nt, 100ng loading amount.

[0141] Depend on Figure 5 It can be seen that three types of ultra-long oligonucleotides were selected for this synthesis, with three synthetic sequence examples of 300 consecutive Ts, 350 consecutive Ts, and 400 consecutive Ts.

[0142] Compared to Example 1, when using TTT nucleoside phosphoramidide trimer, the method of the present invention can synthesize oligonucleotides with longer chains.

[0143] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. The application of silica microspheres in the synthesis of ultralong oligonucleotides, characterized in that, The specific surface area of ​​these silica microspheres is less than 1 m². 2 / g; The surface of the silica microspheres has modifying groups; the structure of the silica microspheres with modifying groups on the surface is shown in formula (1); Equation (1) Where A is silica microspheres, R 1 and R 3 Each is independently selected from C1-C 10 Alkoxy; R 2 Selected from C1-C 10 Alkylene-O-C1-C 10 Alkylene, -C1-C 10 Alkylene-(NH-C1-C) 10 alkylene) n -、C1-C 10 Alkylene, n is an integer from 1 to 10; R 4 Selected from -NH-(CH2CH2O) m -C1-C 10 Alkylene -NH-, -(O-CH2CH2) p -O-, m and p are each an independent integer from 1 to 10; L1 is a linker group capable of coupling with nucleoside phosphoramidide.

2. The application according to claim 1, wherein, The silica microspheres are solid silica microspheres, and the average particle size of the silica microspheres is 50-100 μm.

3. A method for synthesizing ultralong oligonucleotides, characterized in that, The method includes: under coupling reaction conditions, using silica microspheres as a carrier as described in claim 1 or 2 to carry out a coupling reaction of nucleoside phosphoramide synthesis units.

4. The method according to claim 3, wherein, The method further includes: removing the protecting groups of the silica microspheres using a deprotecting agent, and then carrying out a coupling reaction.

5. The method according to claim 4, wherein, The deprotecting agent includes at least one of trichloroacetic acid, dichloroacetic acid, and 3,5-dinitrobenzoic acid.

6. The method according to claim 4, wherein, The deprotecting agents include trichloroacetic acid, dichloroacetic acid, and 3,5-dinitrobenzoic acid.

7. The method according to claim 6, wherein, The weight ratio of trichloroacetic acid, dichloroacetic acid and 3,5-dinitrobenzoic acid is 1:1-10:1-10.

8. The method according to claim 3, wherein, The coupling reaction is carried out in the presence of a coupling agent, which is at least one selected from 5-benzylthio-1H-tetrazole, N-methylimidazolium, and 4,5-dicyanimidazolium.

9. The method according to claim 8, wherein, The coupling agents include 5-benzylthio-1H-tetrazole, N-methylimidazolium, and 4,5-dicyanimidazolium.

10. The method according to claim 9, wherein, The weight ratio of 5-benzylthio-1H-tetrazole, N-methylimidazolium and 4,5-dicyanimidazolium is 5-15:0.5-3:

1.

11. The method according to any one of claims 3-10, wherein, The nucleoside phosphoramide synthesis unit includes nucleoside phosphoramide monomers and / or nucleoside phosphoramide polymers.

12. The method according to claim 11, wherein, Nucleoside phosphoramide polymers include at least one of nucleoside phosphoramide dimer, nucleoside phosphoramide trimer, and nucleoside phosphoramide tetramer.

13. The method according to claim 3, wherein, The method includes the following steps: (a) Under the action of a deprotecting agent, the protecting groups on the linker of the above-described carrier are removed; (b) In the presence of a coupling agent and the support obtained in step (a), the nucleoside phosphoramide synthesis unit is coupled together; (c) The product of the coupling reaction is subjected to a first capping and oxidation; (d) Repeat steps (a)-(c).

Images