Delivery system for targeted inhibition of epidermal growth factor receptor and its application in the preparation of anti-tumor products
By targeting the delivery system that inhibits epidermal growth factor receptors, exosome directed transport of siRNA inhibits EGFR gene expression, solving the problems of drug resistance and side effects of EGFR-TKI treatment, and achieving efficient and side-effect tumor treatment without side effects.
Patent Information
- Application Number
- CN202310691830.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-06-22
- Filing Date
- 2023-06-09
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2043-06-09
AI Technical Summary
The existing drug resistance problems and side effects of EGFR-TKI in the treatment of lung cancer limit its clinical application potential, and existing targeted drugs cannot completely cure EGFR mutant lung cancer.
Provides a delivery system targeting inhibiting epidermal growth factor receptors, including siRNA and delivery vectors, uses mammalian organ tissue to form exosomes, directed transport to tumor cells, and inhibits EGFR gene expression.
It has achieved efficient and side effects inhibition of EGFR expression, improved treatment effect, reduced production difficulty and cost, and is suitable for personalized treatment of various tumor types.
Smart Images

Figure CN117257970B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical technology, and in particular to a delivery system for targeted inhibition of epidermal growth factor receptor and its application. Technical Background
[0002] Lung cancer is one of the most common malignant tumors with the highest morbidity and mortality, posing the greatest threat to human health and life. Over the past 50 years, many countries have reported a significant increase in both the incidence and mortality of lung cancer. Lung cancer ranks first in both incidence and mortality among men and second in incidence and mortality among women. The development of effective targeted drugs for lung cancer is of great clinical significance.
[0003] Epidermal growth factor receptor (EGFR) is the expression product of the proto-oncogene C-erbB-1. It is a transmembrane protein and the first member of the epidermal growth factor receptor family. Mutations in the EGFR protein are closely associated with approximately 50% of advanced non-small cell lung cancer and are a very promising target for lung cancer treatment. Currently, the clinical treatments for EGFR-mutant lung cancer are all tyrosine kinase inhibitors (TKIs), which target proteins. However, these drugs are often accompanied by secondary drug resistance during clinical treatment and cannot completely cure EGFR-mutant lung cancer.
[0004] Currently, "personalized treatment" that selects molecular targeted drugs based on the genotype of lung cancer has become a commonly used treatment method in clinical practice. Improving the efficacy of drugs targeting mutated genes and reducing toxic side effects have also become the main research directions for lung cancer treatment. With the deepening of research, the development and application of new targeted drugs have emerged in an endless stream. However, most lung cancer patients who are effectively treated with EGFR-TKI will develop EGFR-TKI resistance after 9 to 14 months. Although some studies have shown that combination therapies (such as afatinib combined with trastuzumab (Cetuxumab)) can achieve therapeutic effects on these resistant NSCLCs, the inability to fundamentally solve the problem of drug resistance and the very obvious side effects have greatly limited its clinical application potential and become an urgent problem to be solved. Summary of the Invention
[0005] In response to the above-mentioned limitations, the present invention proposes a delivery system for targeted inhibition of epidermal growth factor receptor and its application, which overcomes the deficiencies and defects mentioned in the background art.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] The inventive point of the present invention is to provide a delivery system for targeted inhibition of epidermal growth factor receptor, wherein the delivery system includes RNA capable of inhibiting epidermal growth factor receptor gene expression; the RNA capable of inhibiting epidermal growth factor receptor gene expression includes: a promoter element and at least one of siRNA and encoding siRNA capable of inhibiting epidermal growth factor receptor gene expression.
[0008] Tables 1 and 2 below all show siRNA or DNA template chains encoding siRNA.
[0009] Furthermore, in the above-mentioned delivery system for targeted inhibition of epidermal growth factor receptor, the nucleotide sequence of the siRNA capable of inhibiting epidermal growth factor receptor gene expression is any one of SEQ ID No. 1 to SEQ ID No. 11 in the sequence listing, as shown in Table 1 below.
[0010] Table 1
[0011] <![CDATA[siR E -1(SEQ ID No.1)]]> tgttgcttctcttaattcct <![CDATA[siR E -2(SEQ ID No.2)]]> ataaccagccacctcctggat <![CDATA[siR E -3(SEQ ID No.3)]]> ttccaaaggaattcgctccac <![CDATA[siR E -4(SEQ ID No.4)]]> ttcaccagtacgttcctggct <![CDATA[siR E -5(SEQ ID No.5)]]> ttgataggcactttgcctcct <![CDATA[siR E -6(SEQ ID No.6)]]> ttccaatgccatccacttgat <![CDATA[siR E -7(SEQ ID No.7)]]> agaagttggagtctgtaggac <![CDATA[siR E -8(SEQ ID No.8)]]> aattgttgctggttgcactca <![CDATA[siR E -9(SEQ ID No.9)]]> atgtgctgttgacacaggtgg <![CDATA[siR E -10(SEQ ID No.10)]]> atttctatcaatgcaagccac <![CDATA[siR E -11(SEQ ID No.11)]]> taaagatgccatttggcttgg
[0012] Furthermore, in the above-mentioned delivery system for targeted inhibition of epidermal growth factor receptor, the nucleotide sequence encoding the positive chain of the siRNA capable of inhibiting the expression of the epidermal growth factor receptor gene is a sequence shown in any one of SEQ ID No.12 to SEQ ID No.22 in the sequence listing; the nucleotide sequence encoding the antisense chain of the siRNA capable of inhibiting the expression of the epidermal growth factor receptor gene is a sequence shown in any one of SEQ ID No.23 to SEQ ID No.33 in the sequence listing; the specific sequences are shown in Table 2 below.
[0013] Table 2
[0014]
[0015] The sense strands and antisense strands in Table 2 correspond one to one and correspond to the siRNA sequences shown in SEQ ID No. 1 to SEQ ID No. 11, respectively; specifically:
[0016] The sense strand SEQ ID No. 12 and the antisense strand SEQ ID No. 23 correspond to SEQ ID No. 1;
[0017] The sense strand is SEQ ID No. 13 and the antisense strand is SEQ ID No. 24, corresponding to SEQ ID No. 2;
[0018] The sense strand is SEQ ID No. 14 and the antisense strand is SEQ ID No. 25, corresponding to SEQ ID No. 3;
[0019] The sense strand is SEQ ID No. 15 and the antisense strand is SEQ ID No. 26, corresponding to SEQ ID No. 4;
[0020] The sense strand is SEQ ID No. 16 and the antisense strand is SEQ ID No. 27, corresponding to SEQ ID No. 5;
[0021] The sense strand is SEQ ID No. 17 and the antisense strand is SEQ ID No. 28, corresponding to SEQ ID No. 6;
[0022] The sense strand is SEQ ID No. 18 and the antisense strand is SEQ ID No. 29, corresponding to SEQ ID No. 7;
[0023] The sense strand is SEQ ID No. 19 and the antisense strand is SEQ ID No. 30, corresponding to SEQ ID No. 8;
[0024] The sense strand is SEQ ID No. 20 and the antisense strand is SEQ ID No. 31, corresponding to SEQ ID No. 9;
[0025] The sense strand is SEQ ID No. 21 and the antisense strand is SEQ ID No. 32, corresponding to SEQ ID No. 10;
[0026] The sense strand is SEQ ID No. 22 and the antisense strand is SEQ ID No. 33, corresponding to SEQ ID No. 11.
[0027] Furthermore, the above-mentioned delivery system for targeted inhibition of epidermal growth factor receptor also includes a delivery vector; the delivery vector carrying RNA capable of inhibiting epidermal growth factor receptor gene expression and the targeting element self-assemble in the organ tissue of a mammal to form a composite structure, and the composite structure searches for and delivers the RNA capable of inhibiting epidermal growth factor receptor gene expression into the target tissue through the targeting element, thereby inhibiting the expression of epidermal growth factor receptor in the target tissue.
[0028] Furthermore, in the above-mentioned delivery system for targeted inhibition of epidermal growth factor receptor, the epidermal growth factor receptor is EGFR.
[0029] Furthermore, in the above-mentioned delivery system for targeted inhibition of epidermal growth factor receptor, the composite structure is an exosome.
[0030] Furthermore, in the above-mentioned delivery system for targeted inhibition of epidermal growth factor receptor, the targeting element includes at least one targeting sequence GE11; the targeting sequence GE11 is the sequence shown in SEQ ID No. 34 in the sequence listing or a homologous sequence having a homology of greater than or equal to 90% with the sequence shown in SEQ ID No. 34; specifically as follows:
[0031] Targeting sequence GE11 SEQ ID No. 34:
[0032]
[0033] The homology is greater than or equal to 90%, and specifically can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0034] Furthermore, in the above-mentioned delivery system for targeted inhibition of epidermal growth factor receptor, the delivery vector is a plasmid vector or a viral vector; the viral vector preferably includes at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.
[0035] The second invention of the present invention is to provide the use of the above-mentioned delivery system for targeted inhibition of epidermal growth factor receptor in the preparation of anti-tumor products.
[0036] Furthermore, in the above-mentioned application, the anti-tumor product includes an agent that inhibits cancer cells or prevents the expression of the epidermal growth factor receptor EGFR gene, and a drug that has a preventive and / or therapeutic effect on tumors; the tumor preferably includes at least one of breast cancer, lung cancer, gastric cancer, intestinal cancer, bladder cancer, and ovarian cancer.
[0037] Compared with the prior art, the present invention has the following advantages:
[0038] The present application provides a delivery system for targeted inhibition of epidermal growth factor receptor, which includes RNA capable of inhibiting epidermal growth factor receptor gene expression and a delivery vector. The delivery vector carries RNA capable of inhibiting epidermal growth factor receptor gene expression and self-assembles with a targeting element in the organ tissue of a mammal to form a composite structure. The composite structure searches for and delivers the RNA capable of inhibiting epidermal growth factor receptor gene expression into the target tissue through the targeting element, thereby inhibiting the expression of epidermal growth factor receptor in the target tissue.
[0039] This delivery system is based on synthetic biology elements and uses mammals' own organs as natural bioreactors. The targeting elements and RNA that can inhibit the expression of the epidermal growth factor receptor EGFR gene are self-assembled in the mammalian body into a composite structure that can target the treatment of EGFR mutant diseases and secrete it into the circulatory system. Under the action of the targeting elements, the composite structure transports RNA in a targeted manner to tumor cells awaiting treatment, thereby exerting a therapeutic effect with good therapeutic effect and high efficiency.
[0040] The delivery system for targeted inhibition of epidermal growth factor receptor (EGFR) provided herein leverages a naturally occurring secretion mechanism, thereby avoiding the toxicity associated with other vectors. The targeting element efficiently delivers RNA to the tissue in need of treatment, with high efficiency and virtually no side effects.
[0041] The delivery system for targeted inhibition of epidermal growth factor receptor EGFR provided in this application is established based on a plasmid vector, which is easy to industrialize and purify in large quantities. Compared with other siRNA delivery methods, it greatly reduces the production difficulty and production cost.
[0042] The delivery system for targeted inhibition of epidermal growth factor receptor (EGFR) provided in this application is non-toxic, has no side effects, is rapidly effective, and has excellent efficacy, making it suitable for large-scale promotion and use. Furthermore, the targeting element and targeted gene can be adjusted to provide personalized treatment for different diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] Figure 1 This is a plasmid skeleton diagram provided in one embodiment of the present application;
[0044] Figure 2 is the siRNA expression element screening result provided in one embodiment of the present application; wherein, Figure 2 a represents 11 types of CMV-siR E Western blot electrophoresis results of the plasmid, Figure 2 b shows 11 types of CMV-siR E The results of qRT-PCR detection of protein expression levels of the plasmids were as follows: Figure 2 c represents 11 types of CMV-siR E The results of qRT-PCR detection of mRNA expression levels expressed by the plasmid.
[0045] Figure 3 This is a comparison chart of related RNA and protein expression levels provided in an embodiment of the present application; wherein, Figure 3 a- Figure 3 c is CMV-GE11-siR E and CMV-siR E Comparison of protein and mRNA expression levels by western blot and qRT-PCR after transfection of the two plasmids into H358 cell lines. Figure 3 d- Figure 3 f is CMV-GE11-siR E and CMV-siR E Comparison of protein and mRNA expression levels by western blot and qRT-PCR after transfection of the two plasmids into H1975 cell lines.
[0046] Figure 4 This is a metabolic distribution diagram of siRNA in mice provided in an embodiment of the present application; wherein, Figure 4 a is the gene loop for expressing siRNA (CMV-siR Eand CMV-GE11-siR E ) After injection into mice, the expression levels of EGFR siRNAs in serum were detected at different time periods. Figure 4 b is the gene loop for expressing siRNA (CMV-siR E and CMV-GE11-siR E ) The expression levels of EGFR siRNAs in lung tissues were detected at different time periods after injection into mice.
[0047] Figure 5 This is an exosome tracing diagram in mice provided in one embodiment of the present application;
[0048] Figure 6 This is a comparison chart of the therapeutic effects of different delivery systems on a mouse lung cancer model provided in one embodiment of the present application (Test Example 2); wherein, Figure 6 a is a comparison of micro-CT scan images of mouse lung cancer models before and after treatment with five different delivery systems. Figure 6 b is a comparison of the statistical results of tumor size before and after treatment of mouse lung cancer models with five different delivery systems.
[0049] Figure 7 This is a mouse lung tissue pathology analysis diagram provided in an embodiment of the present application, showing the comparative results of HE staining and immunohistochemistry (IHC) staining of five groups of mice.
[0050] Figure 8 : is a graph of mouse lung tissue protein expression detection provided in an embodiment of the present application, showing the comparative results of mouse EGFR protein and mRNA expression detection; wherein, Figure 8 a is the western blot electrophoresis results of 5 groups of mice. Figure 8 b is the detection results of EGFR protein expression levels in 5 groups of mice. Figure 8 c is the detection results of p-AKT protein expression levels in 5 groups of mice, Figure 8 d is the detection results of p-ERK protein expression levels in 5 groups of mice, Figure 8 e is the detection results of EGFR mRNA expression levels in 5 groups of mice.
[0051] Figure 9 This is a graph for evaluating siRNA off-target effects provided in one embodiment of the present application; wherein, Figure 9 a) Mice in the CMV-CMV-scrR treatment group and CMV-siR E Comparison of expression differences in the lungs, liver, spleen, kidneys, thymus and tumors of mice in the treatment groups. Figure 9 b is CMV-siR E and CMV-GE11-siR ESignificant comparison of downregulated transcripts in the lung, liver, spleen, kidney, thymus, and tumors of treated mice. Figure 9 c is CMV-siR E and CMV-GE11-siR E Among the top 20 GO clusters in the group, the close correlation with the EGFR signaling pathway is compared. Figure 9 d is CMV-siR E 、CMV-GE11 siR E Expression of all target genes of miR-122 in the liver after treatment.
[0052] Figure 10 This is a comparison chart of drug administration safety provided in one embodiment of the present application, wherein: Figure 10 a is CMV-siR E or CMV-GE11-siR E Comparison of the test results of functional abnormality biomarkers (alanine transaminase ALT, aspartate transaminase AST, total bilirubin TBIL, serum urea nitrogen BUN, alkaline phosphatase ALP, creatinine CREA) after plasmid treatment, Figure 10 b is CMV-siR E or CMV-GE11-siR E Comparison of staining results of organ tissues (liver, kidney, heart, spleen) after plasmid treatment.
[0053] Figure 11 This is a comparison chart of the therapeutic effects of different delivery systems on mouse lung cancer models provided in one embodiment of the present application; wherein, Figure 11 a is the comparison of CT imaging results of 5 groups of mice before and after treatment; Figure 11 b is a comparison of tumor volume and survival results of the five groups of mice before and after treatment.
[0054] Figure 12 This is a pathological analysis diagram of five groups of mouse lung tissues provided in one embodiment of the present application (i.e., comparison of HE staining and IHC immunohistochemistry staining results).
[0055] Figure 13 is a graph showing the protein expression level of mouse lung tissue provided by another embodiment of the present application, showing the comparative results of the detection of mouse EGFR protein and mRNA expression levels; wherein, Figure 13 a is the western blot electrophoresis results of 5 groups of mice. Figure 13 b is the detection results of EGFR protein expression levels in 5 groups of mice. Figure 13 c is the detection results of p-AKT protein expression levels in 5 groups of mice, Figure 13 d is the detection results of p-ERK protein expression levels in 5 groups of mice, Figure 13e is the detection results of EGFR mRNA expression levels in 5 groups of mice. DETAILED DESCRIPTION
[0056] To make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described in detail below. However, it should be understood that the description herein is only for explaining the present invention and is not intended to limit the scope of the present invention.
[0057] Unless otherwise defined, all technical terms used herein are
[0058] The linguistic and scientific terms have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The reagents and instruments used herein are all commercially available. The characterization methods involved can be referred to the relevant descriptions in the prior art and will not be repeated here.
[0059] In order to further understand the present invention, the present invention is further described in detail below in conjunction with the best embodiment.
[0060] Example 1
[0061] A delivery system for targeted inhibition of epidermal growth factor receptor includes RNA capable of inhibiting epidermal growth factor receptor gene expression; the RNA capable of inhibiting epidermal growth factor receptor gene expression includes: a promoter element and at least one of siRNA and encoding siRNA capable of inhibiting epidermal growth factor receptor gene expression.
[0062] The above RNA can be a promoter element + siRNA capable of inhibiting epidermal growth factor receptor gene expression, or a promoter element + an encoding siRNA capable of inhibiting epidermal growth factor receptor gene expression.
[0063] Tables 1 and 2 show siRNA or DNA template chains encoding siRNA.
[0064] The delivery system for targeting and inhibiting epidermal growth factor receptor, wherein the nucleotide sequence of the siRNA capable of inhibiting epidermal growth factor receptor gene expression is any one of SEQ ID No. 1 to SEQ ID No. 11 in the sequence listing, as specifically shown in Table 1.
[0065] The delivery system targeted to inhibit epidermal growth factor receptor, the nucleotide sequence encoding the siRNA sense chain capable of inhibiting epidermal growth factor receptor gene expression is any one of SEQ ID No.12 to SEQ ID No.22 in the sequence listing; the nucleotide sequence encoding the siRNA antisense chain capable of inhibiting epidermal growth factor receptor gene expression is any one of SEQ ID No.23 to SEQ ID No.33 in the sequence listing; the specific sequences are shown in Table 2.
[0066] The sense strands and antisense strands in Table 2 correspond one to one and correspond to the siRNA sequences shown in SEQ ID No. 1 to SEQ ID No. 11, respectively; specifically:
[0067] The sense strand SEQ ID No. 12 and the antisense strand SEQ ID No. 23 correspond to SEQ ID No. 1;
[0068] The sense strand is SEQ ID No. 13 and the antisense strand is SEQ ID No. 24, corresponding to SEQ ID No. 2;
[0069] The sense strand is SEQ ID No. 14 and the antisense strand is SEQ ID No. 25, corresponding to SEQ ID No. 3;
[0070] The sense strand is SEQ ID No. 15 and the antisense strand is SEQ ID No. 26, corresponding to SEQ ID No. 4;
[0071] The sense strand is SEQ ID No. 16 and the antisense strand is SEQ ID No. 27, corresponding to SEQ ID No. 5;
[0072] The sense strand is SEQ ID No. 17 and the antisense strand is SEQ ID No. 28, corresponding to SEQ ID No. 6;
[0073] The sense strand is SEQ ID No. 18 and the antisense strand is SEQ ID No. 29, corresponding to SEQ ID No. 7;
[0074] The sense strand is SEQ ID No. 19 and the antisense strand is SEQ ID No. 30, corresponding to SEQ ID No. 8;
[0075] The sense strand is SEQ ID No. 20 and the antisense strand is SEQ ID No. 31, corresponding to SEQ ID No. 9;
[0076] The sense strand is SEQ ID No. 21 and the antisense strand is SEQ ID No. 32, corresponding to SEQ ID No. 10;
[0077] The sense strand is SEQ ID No. 22 and the antisense strand is SEQ ID No. 33, corresponding to SEQ ID No. 11.
[0078] The above siRNA can specifically bind to epidermal growth factor receptor (EGFR) mRNA and degrade it, thereby inhibiting the expression of EGFR.
[0079] The delivery system for targeted inhibition of epidermal growth factor receptor also includes a delivery vector; the delivery vector carrying RNA capable of inhibiting epidermal growth factor receptor gene expression and the targeting element self-assemble in the organ tissue of a mammal to form a composite structure, and the composite structure searches for and delivers the RNA capable of inhibiting epidermal growth factor receptor gene expression into the target tissue through the targeting element, thereby inhibiting the expression of epidermal growth factor receptor in the target tissue.
[0080] The epidermal growth factor receptor is EGFR.
[0081] The composite structure is an exosome.
[0082] The target tissue is preferably a cancer cell with EGFR mutation / EGFR expression.
[0083] The targeting element includes at least one targeting sequence GE11; the targeting sequence GE11 is the sequence shown in SEQ ID No. 34 in the sequence listing or a homologous sequence having a homology of greater than or equal to 90% with the sequence shown in SEQ ID No. 34; specifically as follows:
[0084] Targeting sequence GE11 SEQ ID No. 34:
[0085]
[0086] The homology is greater than or equal to 90%, and specifically can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0087] The delivery vector is a plasmid vector or a viral vector; the viral vector preferably includes at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.
[0088] The delivery vector is preferably a plasmid vector. In the case where the delivery vector is a plasmid vector, the above-mentioned delivery system can be regarded as a plasmid molecule.
[0089] Specifically, the plasmid carries siRNA that can inhibit the expression of the EGFR gene. This plasmid molecule can be enriched in the organ tissues of mammals and spontaneously form exosomes endogenously in the organ tissues of the mammals with the targeting element GE11. The exosomes deliver the siRNA into cells with EGFR mutations through the targeting element GE11, thereby inhibiting the expression of EGFR.
[0090] The delivery system based on plasmid vectors is easier to produce and purify on a large scale industrially. Compared with other siRNA delivery systems, the production difficulty and cost are greatly reduced.
[0091] In practical applications, a delivery system (plasmid molecule) targeting the EGFR gene was constructed, and the promoter element was connected in series with the siRNA that could inhibit the expression of the EGFR gene to construct the siR E and connected to the backbone vectors respectively. E Plasmid backbone structure Figure 1 shown.
[0092] In order to expand the potential therapeutic range and enable the expressed siRNA to inhibit both mutant and wild-type EGFR, siRNA was designed to target a segment in the EGFR coding region that does not have common mutations (e.g., exon 19 deletion, L858R point mutation in exon 21, and T790M exon 20 mutation). The possibility of siRNA off-target mediated by the seed region (bases 2-8) was also considered during the design process. 11 siRNA sequences were designed using BLOCK-iTM RNAi Designer, targeting siRNAs at different sites in the EGFR coding sequence, and 11 CMV-siR E The plasmid was then transfected into the human lung cancer cell line H358. Total RNA was extracted from the cells 24 hours later, and cell protein was extracted 36 hours later. qRT-PCR and western blot experiments were performed respectively. The results showed that compared with CMV-scrR, the 10th CMV-siRE Plasmid (CMV-siR E -10) had the most significant inhibitory effect on EGFR mRNA and protein expression levels ( Figure 2 a- Figure 2 c). Therefore, this plasmid was selected for subsequent experiments such as siRNA detection, in vivo and in vitro tracing, and verification of tumor inhibition effects.
[0093] Therefore, the delivery system for targeted inhibition of EGFR provided in this embodiment is based on synthetic biological elements and uses the mammal's own organs as natural bioreactors. The targeting elements and RNA capable of inhibiting EGFR gene expression are self-assembled in the mammal's body into exosomes that can target and treat EGFR mutation diseases, and are secreted into the circulatory system. Under the action of the targeting elements, the exosomes transport RNA in a targeted manner to tumor cells awaiting treatment, thereby exerting a therapeutic effect with good therapeutic effect and high efficiency.
[0094] Especially for EGFR mutant lung cancer, this delivery system can accurately and quickly target and transport related RNA into cancer cells, inhibit the expression of EGFR in cancer cells, and thus achieve an excellent effect of suppressing tumors.
[0095] Example 2
[0096] Based on Example 1, this example provides an application of a delivery system for targeted inhibition of epidermal growth factor receptor in the preparation of an anti-tumor product.
[0097] Anti-tumor products include reagents that inhibit cancer cells or prevent the expression of epidermal growth factor receptor EGFR gene, and drugs that have preventive and / or therapeutic effects on tumors; the tumors preferably include at least one of breast cancer, lung cancer, gastric cancer, intestinal cancer, bladder cancer, and ovarian cancer.
[0098] Among them, the drug of this embodiment, in addition to including the above-mentioned delivery system, may also include a pharmaceutically acceptable carrier, including but not limited to diluents, buffers, emulsions, encapsulating agents, excipients, fillers, adhesives, sprays, transdermal absorbents, wetting agents, disintegrants, absorption enhancers, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.
[0099] The dosage form of the drug provided in this embodiment can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc.
[0100] The drug of this embodiment has a good therapeutic effect on tumors and tumor-related diseases. Tumor-related diseases can be diseases that arise during the formation or treatment of tumors or complications and sequelae caused by tumors, which are related to tumors.
[0101] The tumor includes at least one of breast cancer, lung cancer, stomach cancer, intestinal cancer, bladder cancer, and ovarian cancer.
[0102] The drug of this embodiment can also be used in combination with other therapeutic drugs or treatment methods with anti-tumor effects to treat patients with depression to improve the therapeutic effect.
[0103] For example, if the tumor is breast cancer, it can be combined with drugs such as paclitaxel, cyclophosphamide, fluorouracil, tamoxifen, letrozole, and Herceptin; if the tumor is lung cancer, it can be combined with drugs such as Iressa and Tarceva; if the tumor is gastric cancer, it can be combined with drugs such as Herceptin and apatinib; if the tumor is colorectal cancer, it can be combined with drugs such as Erbitux, epirubicin, doxorubicin, daunorubicin, mitomycin, and fluorouracil deoxyribonucleic acid; if the tumor is bladder cancer, it can be combined with drugs such as epirubicin, doxorubicin, pirarubicin, mitomycin, hydroxycamptothecin, gemcitabine, BCG, interferon, interleukin-2, gemcitabine, cisplatin, paclitaxel, and docetaxel; if the tumor is ovarian cancer, it can be combined with drugs such as cisplatin, carboplatin, paclitaxel, and cyclophosphamide. In addition, surgery and radiotherapy can be performed simultaneously with drug treatment to enhance the efficacy.
[0104] The delivery system for targeted inhibition of epidermal growth factor receptor provided in the present application is applied in anti-tumor products. It is non-toxic, has no side effects, takes effect quickly, has good efficacy, and is suitable for large-scale promotion and use.
[0105] Among the 11 CMV-siR constructs targeting different sites of the EGFR coding sequence, E The results of qRT-PCR and western blot experiments showed that the 10th CMV-siRE plasmid (CMV-siRE E -10) had the most significant inhibitory effect on EGFR mRNA and protein expression levels ( Figure 2 a- Figure 2 Based on this result, siR E -10 is the optimal siRNA sequence finally screened out. The experimental results shown in the subsequent experimental examples 1-4 are all based on this sequence. Without special annotation, the siR E All refer to this sequence "siR E -10”.
[0106] Test Example 1
[0107] In order to verify the constructed CMV-siR E 、CMV-GE11-siR EThe ability of the plasmid-expressed siRNA to inhibit the EGFR target gene in lung cancer cells was verified using the H358 cell line that does not contain EGFR mutations and the H1975 cell line that contains EGFR mutations.
[0108] The same dose of CMV-GE11-siR was extracted with an endotoxin-free plasmid extraction kit. E and CMV-siR E Plasmids were transfected into H1975 and H358 cell lines, and CMV-CMV-scrR plasmid (expressing a nonsense sequence) was used as a control. Total RNA was extracted from cells 24 hours after transfection, and cell protein was extracted 36 hours after transfection. qRT-PCR and western blot experiments were performed to verify the inhibitory efficiency of the two plasmids in different NSCLC cell lines. Figure 3 As shown, CMV-GE11-siR E and CMV-siR E After the plasmid was introduced, similar inhibitory effects were achieved in the two types of NSCLC cells mentioned above, indicating that the insertion of the targeting element did not affect the performance of the siRNA expression element. It also showed that the siRNA expression element constructed using this plasmid could exert a significant inhibitory effect on both wild-type EGFR and mutant EGFR, suggesting that it has a wider therapeutic potential.
[0109] In this test, CMV-siR E Experimental group and CMV-GE11-siR E The two experimental groups were divided into two groups: the gene loop expressing siRNA (CMV-siR E and CMV-GE11-siR E ) The same number of normal mice were injected with the drug through the tail vein at a dose of 10 mg / kg.
[0110] Three mice were randomly selected from each group 3, 6, 9, 12, 24, and 48 hours after injection, and their serum and lung tissues were collected to detect siRNA expression levels. The results are shown in Table 1. Figure 4 Injection of CMV-siR E or CMV-GE11-siR E After the plasmids were injected, the same amount of EGFR siRNAs was detected in the serum of EGFR DEL19 mice injected with the two plasmids. The accumulation of EGFR siRNAs in the serum was time-dependent, reaching a peak at 9 hours and decreasing to the background level after 48 hours. Figure 4 a). At the same time, CMV-GE11-siR E or CMV-siR EAfter the plasmid was injected, the EGFR siRNA level increased in the lung tissue of EGFR DEL19 mice with high EGFR expression in a time-dependent manner, and the injection of CMV-GE11-siR E The EGFR siRNA content in lung tissues with high expression of EGFR plasmid was about the same as that in the CMV-siR E 6.8 times of plasmid ( Figure 4 b).
[0111] To verify that the gene circuit constructed in vitro can also deliver EGFR siRNA specifically to EGFR-high-expressing tumor cells in vivo, a transgenic mouse model of non-small cell lung cancer driven by mutant EGFR (exon 19 deletion, DEL19) was used. In this model, after administration of doxycycline, the mutant EGFR protein in the lung tissue of EGFR DEL19 mice was continuously overexpressed, eventually forming spontaneous lung tumors. E or CMV-siR E The plasmid was transfected into HEK293T cells, and the untreated cells were used as the blank control group. After 36 hours, the cell supernatant was collected, the exosomes in the supernatant were separated, and labeled with PKH67 dye (green). The exosomes were then injected into EGFR DEL19 mice induced by doxycycline through the tail vein. Three hours after the injection of exosomes, the mice were anesthetized and perfused by heart, and their lung tissues were taken. The tissues were embedded in OCT at -20°C and cut into 10μm tissue sections using a freezing microtome. After fixation with 4% PFA, immunofluorescence experiments were performed to determine the location of fluorescent exosomes. E The efficiency of exosomes from transfected cells in binding to EGFR-overexpressing lung cells was compared with that of CMV-GE11-siR E Exosomes secreted by transfected cells more effectively bind to EGFR-high-expressing lung cells of EGFR DEL19 mice, and the co-localization signal of green fluorescence signal (exosomes) and red fluorescence (EGFR protein) increases ( Figure 5 ). The results showed that compared with wild-type exosomes, CMV-GE11-siR E Plasmid-processed exosomes have a higher affinity for EGFR high-expressing cells.
[0112] Test Example 2
[0113] In order to further confirm the therapeutic effect of the delivery system targeting EGFR inhibition in vivo, the EGFR-DEL19 transgenic lung cancer mouse model was used as the experimental subject (tumors spontaneously occurred in the lungs 30 days after DOX induction) to confirm the efficacy of CMV-GE11-siR E The therapeutic effect of the delivery system on lung tumors.
[0114] The mice with successful modeling were randomly divided into 5 groups: PBS group, CMV-scrR group, Gefitinib group, CMV-siR E group, CMV-GE11-siR E The PBS control plasmid, CMV-scrR plasmid, and CMV-siR plasmid were injected at a dose of 10 mg / kg. E Plasmid, CMV-GE11-siR E The plasmid was used for treatment, and the mice in the Gefitinib group were given the drug by gavage. The drug was given once every two days for a total of 7 treatments for 15 days. After treatment, the micro-CT scan images of the same mice before and after treatment were analyzed, and the whole lung 3D reconstruction was combined to evaluate the growth of the mouse lung tumor. Figure 6 As can be seen in the figure, the tumor volume and number of mice injected with PBS and control plasmid increased significantly, and new lesions appeared in both lung tissues. E The tumor volume of treated mice increased slightly slower and no new lesions were found, indicating that the tumor burden was reduced. E Mice treated with the gene loop did not develop new lesions, and the original tumors were significantly reduced to undetectable levels, indicating that the tumor burden in this group of mice was significantly reduced.
[0115] The lung tissues of the five groups of mice after treatment were subjected to HE staining, IHC-EGFR / pAKT / pERK / PCNA, and protein and mRNA expression analysis. The results are as follows: Figure 7 , Figure 8 shown. Figure 7 The comparison of HE staining and immunohistochemical staining results of five groups of mice shows that CMV-GE11-siR E The lung tissue of mice in group A was the best. Figure 8 This is a comparison chart of mouse EGFR protein and mRNA expression levels. It can be seen that the EGFR protein expression level of mice in the PBS group and the CMV-scrR group was the highest, followed by the siR E group, the expression level of EGFR protein in this group of mice was low, and CMV-GE11-siR E The expression level of EGFR protein in the mice of group 1 was the lowest, which was equivalent to that of normal mice. E The treatment group had a good therapeutic effect.
[0116] Test Example 3
[0117] Off-target effects of siRNA can lead to regulation of non-target genes, resulting in unpredictable consequences. Therefore, transcriptome sequencing was used to evaluate the off-target effects of in vivo self-assembled EGFR siRNA in an EGFR-driven NSCLC model. After inducing tumor formation in EGFR DEL19 mice using the above protocol, tumor-bearing mice were treated with CMV-CMV-scrR, CMV-siR at a dose of 10 mg / kg. E or CMV-GE11-siR E Plasmids were administered 7 times, and transcriptome sequencing was used to comprehensively evaluate transcript changes in various normal tissues and tumors. A more stringent threshold condition (average reads > 500, fold change > 2, P < 0.05) was used to screen out CMV-siR E vs CMV-scrR, CMV-GE11-siR E The transcripts with significant changes in expression in CMV-scrR vs CMV-siR treated mice were shown to be E In the lung, liver, spleen, kidney and thymus of the treated mice, 165, 206, 307, 111 and 65 transcripts were significantly changed, respectively. E After treatment, only 83, 192, 220, 52, and 55 transcripts were differentially expressed in normal tissues of lung, liver, spleen, kidney, and thymus, respectively ( Figure 9 a).
[0118] In addition, we also evaluated whether EGFR siRNA would bind to transcripts in a similar manner to miRNA, thereby causing off-target effects and significantly downregulating non-target transcripts. E There was no statistically significant correlation between the EGFRsiRNA seed region sequence and the 3'-UTR of the transcripts that were significantly down-regulated in the treatment group: only one transcript in each of the lung, liver, spleen, and kidney tissues had a perfect match with the EGFR siRNA seed region in its 3'-UTR, while there was no perfect match transcript in the thymus tissue. These numbers were significantly lower than the number of potential off-target genes predicted by the computer (approximately 100-1000). In sharp contrast, compared with CMV-CMV-scrR treated mice, CMV-siR E A total of 941 transcripts were identified as significantly differentially expressed in tumors from treated mice. E 4706 transcripts were significantly altered in treated tumors, with the magnitude of transcriptional changes significantly exceeding those observed in normal tissues.E and CMV-GE11-siR E The 3'-UTRs of downregulated transcripts in treated mouse tumors were significantly correlated with the EGFR siRNA seed region ( Figure 9 b) These results indicate that the miRNA-like activity of the EGFR siRNA guide strand occurs only in tumor cells, with almost no off-target effects in normal tissues. More importantly, CMV-GE11-siR E Treated mice showed few transcript changes in normal tissues, but more significant changes in tumors than those observed with CMV-siR E The treated mice were stronger, indicating that siRNA can be preferentially delivered to EGFR-high-expressing tumor cells through GE11-labeled sEVs, which not only reduces the impact of the self-assembled gene circuit on normal tissues and further reduces the risk of off-target effects, but also increases the targeting effect of the self-assembled gene circuit on tumor tissues and enhances the therapeutic effect.
[0119] Although miRNA-like off-target effects were found in tumor tissues, the vast majority of down-regulated genes were not related to off-target effects caused by EFGR siRNA delivery to tumor cells. In fact, only a very limited number of down-regulated transcripts were actually affected by seed sequence-mediated EGFR siRNA binding. Specifically, in CMV-siRNA E In treated tumors, only 2 of the 269 downregulated transcripts had 3'-UTR sequences that could be bound by the EGFR siRNA seed sequence; E In the treated tumors, only 24 of the 2114 downregulated transcripts had 3'-UTR sequences that could be bound by the seed sequence of EGFR siRNA. The other downregulated transcripts, and even upregulated transcripts, may be directly or indirectly caused by the silencing of EGFR and its related signaling pathways, and are also part of the targeting effect. In order to compare the effects of on-target and off-target on tumor cells, GO functional clustering analysis was performed to analyze the biological processes of altered gene enrichment in tumor cells. Figure 9 As shown in c, in CMV-siR E Among the top 20 GO clusters in the CMV-CMV-scrR group, 6 were closely related to the EGFR signaling pathway, such as “vascular system development”, “positive regulation of cell migration”, “regulation of endothelial cell proliferation” and “enzyme-linked receptor protein signaling pathway”. EAmong the top 20 GO clusters in the CMV-CMV-scrR group, 10 clusters were closely related to the EGFR signaling pathway, such as “positive regulation of cell migration”, “regulation of cytoskeleton organization”, “actin cytoskeleton organization” and “vascular development”. In particular, EGFR downstream signaling molecules, such as PI3K and KRAS, were expressed in the CMV-GE11-siR group. E After treatment, the expression of mitochondria was significantly downregulated and enriched in the GO cluster of “MAPK cascade”. E or CMV-siR E In treated tumor cells, the enrichment of GO clusters was associated with the EGFR signaling pathway, indicating that in vivo self-assembled EGFRsiRNA had a significant effect on EGFR and its related signaling pathways in tumor cells. It also showed that the siRNA-mediated targeting effect was stronger than the miRNA-mediated off-target effect.
[0120] In mammalian cells, both siRNA and miRNA assemble with the AGO2 protein into the RNA-induced silencing complex (RISC), forming the effector molecule of RNAi. Therefore, the cellular protein machinery required for gene regulation mediated by exogenous siRNA and endogenous miRNA is the same. In nature, RISC is naturally occupied by endogenous miRNA; however, when a large amount of exogenous siRNA is injected into the cell, it is conceivable that miRNA may be replaced from RISC by oversaturated siRNA, resulting in the instability of miRNA and the loss of its ability to regulate the endogenous mRNA it targets. Previous studies have revealed that the hepatotoxicity associated with siRNA administration in mice is caused by interference with the action of the hepatocyte-specific miRNA, miR-122. Given that EGFRsiRNA is expressed, assembled and secreted in the liver, it is indeed possible that excessive exogenous siRNA will occupy RISC, which will have a wide range of effects on miRNA processing and function. Therefore, CMV-siR was analyzed in the liver of the EGFR-driven NSCLC model. E 、CMV-GE11-siR E Changes in downstream target genes regulated by miR-122 after treatment. It was found that among the 1566 target genes of miR-122, only 13 target genes were expressed in CMV-siR E , 21 target genes in CMV-GE11-siR E There were significant changes in the treatment group, and the CMV-siR E 、CMV-GE11-siR E After treatment, the expression of all target genes of miR-122 in the liver ( Figure 9d) Compared with the CMV-CMV-scrR group, the CMV-siR E The treatment group was CMV-GE11-siR E Neither treatment group nor the other treatment groups showed significant changes in the expression of miR-122 target genes in the liver. These results suggest that the self-assembled EGFR siRNA in vivo is not produced in large quantities and is instead present in a moderate amount, maintaining sufficient activity and efficacy without oversaturating the siRNA and causing side effects such as miRNA dysregulation by excessively competing with the RISC complex.
[0121] Since the on-target effect was observed to be stronger than the off-target effect in tumor cells, and there was no obvious off-target effect in normal tissues, and the downstream pathway of miR-122 enriched in liver cells was not affected, theoretically the gene circuit would not have a significant side effect on normal tissues. The experimental results also confirmed this theory. E or CMV-GE11-siR E After one treatment cycle (10 mg / kg, once every two days for two weeks) of the plasmid, when the potential side effects and tissue toxicity of the in vivo self-assembled EGFR siRNA were evaluated in C57BL / 6J mice, no obvious hepatotoxicity, nephrotoxicity, or tissue damage was observed by histopathological examination. In addition, the changes in various biochemical indicators in the serum were observed. Since the self-assembled siRNA in the body is mainly processed and matured in the liver, the abnormal functional state of liver cells needs to be paid special attention. However, typical biomarkers of abnormal liver function, such as alanine aminotransferase, aspartate aminotransferase, and total bilirubin in the serum of mice, were not found in the CMV-siR E or CMV-GE11-siR E Significant changes were observed after plasmid treatment ( Figure 10 These results indicate that the in vivo self-assembly and delivery of EGFR siRNA induced by gene looping have no obvious side effects and have good biosafety.
[0122] Test Example 4:
[0123] This experiment studies GE11-siR E The therapeutic effect of the plasmid on the lung cancer mouse model with H1975 cells orthotopically implanted (30 days after tracheal intubation, lung tumors were generated) was verified by GE11-siR E The therapeutic effect of the delivery system on drug-resistant mutant lung cancer in mice.
[0124] After the successful establishment of the transgenic mouse model was verified by CT imaging, the mice were randomly divided into five groups: PBS group, CMV-scrR group, Osimertinib group, CMV-siR group,E group, CMV-GE11-siR E The two groups were injected with PBS, CMV-scrR and CMV-GE11-siR at a dose of 10 mg / kg, respectively. E The osimertinib group received the drug via oral gavage. The drug was administered every two days for 15 days. Before and after treatment, CT imaging combined with whole-lung 3D reconstruction was used to examine lung tumor changes and assess mouse survival.
[0125] like Figure 11 As shown in a, before and after treatment, CMV-GE11-siR E The lung tumor volume of mice injected with CMV-siR was significantly reduced. E The lung tumor volumes of mice receiving the PBS group and the CMV-scrR plasmid increased partially, while the tumor volumes of mice receiving the PBS group increased significantly. Figure 11 b is the statistical survival of model mice after treatment, and it can be seen that CMV-GE11-siR E The group survived longer.
[0126] The lung tissues of the five groups of mice after treatment were subjected to HE staining, IHC-EGFR / pAKT / pERK / PCNA, and protein and mRNA expression analysis. The results are as follows: Figure 12 , Figure 13 shown. Figure 12 The comparison of HE staining and IHC results of five groups of mice shows that CMV-GE11-siR E The lung tissue of mice in group A was the best. Figure 13 This is a comparison chart of mouse EGFR protein and mRNA expression levels. It can be seen that the EGFR protein expression levels of mice in the PBS group and the CMV-scrR group were the highest, followed by the CMV-siR E group, the expression level of EGFR protein in this group of mice was low, and CMV-GE11-siR E The expression level of EGFR protein in the mice of group 1 was the lowest, which was equivalent to that of normal mice. E The treatment group had a good therapeutic effect.
[0127] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A delivery system for targeted inhibition of epidermal growth factor receptor, characterized in that: The delivery system includes: a promoter element CMV, an RNA capable of inhibiting epidermal growth factor receptor gene expression, and a delivery vector; the RNA capable of inhibiting epidermal growth factor receptor gene expression includes: an siRNA capable of inhibiting epidermal growth factor receptor gene expression or an encoding siRNA; The nucleotide sequence of the siRNA capable of inhibiting epidermal growth factor receptor gene expression is the sequence shown in SEQ ID No. 10 in the sequence list; The nucleotide sequence encoding the sense strand of the siRNA capable of inhibiting epidermal growth factor receptor gene expression is the sequence shown in SEQ ID No. 21 in the sequence listing, and the nucleotide sequence encoding the antisense strand of the siRNA capable of inhibiting epidermal growth factor receptor gene expression is the sequence shown in SEQ ID No. 32 in the sequence listing; The delivery vector is a plasmid vector.
2. A delivery system for targeted inhibition of epidermal growth factor receptor, characterized in that: The delivery system includes: a promoter element CMV, a targeting element GE11, an RNA capable of inhibiting epidermal growth factor receptor gene expression, and a delivery vector; the RNA capable of inhibiting epidermal growth factor receptor gene expression includes: siRNA capable of inhibiting epidermal growth factor receptor gene expression or encoding siRNA; The nucleotide sequence of the siRNA capable of inhibiting epidermal growth factor receptor gene expression is the sequence shown in SEQ ID No. 10 in the sequence list; The nucleotide sequence encoding the sense strand of the siRNA capable of inhibiting epidermal growth factor receptor gene expression is the sequence shown in SEQ ID No. 21 in the sequence listing, and the nucleotide sequence encoding the antisense strand of the siRNA capable of inhibiting epidermal growth factor receptor gene expression is the sequence shown in SEQ ID No. 32 in the sequence listing; The targeting element GE11 is the sequence shown in SEQ ID No. 34 in the sequence list; The delivery vector is a plasmid vector.
3. The targeted epidermal growth factor receptor inhibition delivery system according to claim 2, characterized in that: A delivery vector carrying RNA capable of inhibiting epidermal growth factor receptor gene expression and a targeting element self-assemble in mammalian organ tissues to form a composite structure. The composite structure searches for and delivers the RNA capable of inhibiting epidermal growth factor receptor gene expression into the target tissue through the targeting element, thereby inhibiting the expression of epidermal growth factor receptor in the target tissue.
4. The targeted epidermal growth factor receptor inhibition delivery system according to claim 3, characterized in that: The epidermal growth factor receptor is EGFR.
5. The targeted epidermal growth factor receptor inhibition delivery system according to claim 4, characterized in that: The composite structure is an exosome.
6. Use of the delivery system for targeted inhibition of epidermal growth factor receptor according to any one of claims 1 to 5 in the preparation of anti-tumor products.
7. The use according to claim 6, characterized in that The anti-tumor products include agents that inhibit cancer cells or prevent the expression of epidermal growth factor receptor EGFR gene, and drugs that have preventive and / or therapeutic effects on tumors.
8. The use according to claim 7, characterized in that The tumor includes at least one of breast cancer, lung cancer, gastric cancer, intestinal cancer, bladder cancer, and ovarian cancer.
Citation Information
Patent Citations
Application of inhibitors namely CALM1 and EGFR in synergistic tumor inhibition
CN104368001A
siRNA inhibiting EGFR expression as well as precursors and application of siRNA
CN109971756A