A halophilic tetragenococcus strain with high protease activity and high production of bioactive peptides and its application

Abstract

The present invention relates to the field of functional microorganism screening and application technology, and specifically provides a halophilic tetragenococcus (Tetragenococcus halophilus) with high protease activity and high production of bioactive peptides and its application. The halophilic tetragenococcus was screened from the traditional naturally fermented soybean paste in Northeast China, and the preservation number is CGMCC No.27586. The γ-glutamyl transferase activity of the strain is 7.361±0.003U / mL, the ability to scavenge DPPH free radicals reaches 57.32%, the ability to scavenge hydroxyl free radicals reaches 56.03%, and the protease activity is as high as 342.71±0.48U / mL, which are all higher than the standard strain ATCC 33315. The strain has high protease activity, high production of bioactive peptides, and has the potential for enhancing freshness while having good antioxidant capacity, and can be applied to the production of fermented functional foods.

Description

Technical Field

[0001] The present invention relates to the technical field of functional microorganism screening and application, and in particular to a halophilic tetragenococcus with high protease activity and high production of bioactive peptides and application thereof. Background Art

[0002] Bioactive peptides are peptide compounds that are beneficial to the life activities of biological organisms or have physiological effects. They are a class of polypeptides with a relative molecular mass of less than 6000Da and possess multiple biological functions. Their molecular structures vary in complexity and are molecular polymers between amino acids and proteins, ranging from as small as two amino acids to as large as dozens of amino acids connected by peptide bonds. These polypeptides can also be modified by phosphorylation, glycosylation, or acylation. Different fermentation strains can produce various forms of bioactive peptides, including antioxidant peptides, blood pressure-lowering peptides, immunomodulatory peptides, antimicrobial peptides, and opioid-active peptides, which have physiological functions such as regulating antioxidative stress, and regulating the cardiovascular system, immune system, nervous system, and gastrointestinal system.

[0003] As early as 1978, the umami octapeptide from beef was isolated, sparking research and utilization of umami peptides. Umami peptides are small peptides with molecular weights ranging from 150 to 3000 Da that can be directly extracted from natural foods. As a new, green and safe food flavoring agent, umami peptides can effectively enhance the umami flavor of foods while also modulating other taste attributes. The flavor of umami peptides primarily originates from intermediates in protein synthesis and degradation. In recent years, umami peptides have been found in many processed foods or unprocessed protein hydrolysates, including meat, insects, aquatic products, fungi, cereals, legumes, and their fermented products. However, research on the production of umami peptides by microbial fermentation through various metabolic pathways is limited, and the search for novel umami peptides continues. Microbial fermentation has also garnered significant attention. Microbial fermentation involves the degradation of raw protein or the synthesis of amino acids through the action of microorganisms or enzymes, converting the raw materials into small flavor peptides. These peptides are then isolated and extracted to produce umami peptides.

[0004] Antioxidant peptides belong to the category of bioactive peptides and are small molecule bioactive substances with antioxidant functions, usually composed of 2 to 20 amino acids. As a small molecule natural active substance, antioxidant peptides have attracted much attention from scholars due to their characteristics such as "green", "strong activity" and "easy absorption". Studies have shown that the biological activity of antioxidant peptides can be affected by amino acid sequence, molecular weight and hydrophobic amino acid content. Generally, the smaller the molecular weight and the higher the proportion of amino acid residues connected to hydrophobic amino acids such as proline (Pro), valine (Val), tryptophan (Trp), and phenylalanine (Phe), the stronger the antioxidant activity. In recent years, antioxidant peptides have been found in unprocessed foods such as beans, meat, and eggs, fermented products and hydrolyzates. At the same time, due to the characteristics of antioxidant peptides such as "green", "natural", "safe" and "easy absorption", the synthetic preparation method has become a hot topic.

[0005] Halophilic Tetragenococcus is a Gram-positive bacterium, approximately 0.5-1.5 microns in diameter. It is widely found in high-salt environments and can be isolated from fermented foods such as soybean paste, soy sauce, sauces, and pickles. It ferments to produce organic acids such as lactic acid, acetic acid, and pyruvic acid, which impart a sour taste and distinctive flavor. It secretes a large number of enzymes that catalyze a series of metabolic pathways to produce flavor compounds, potentially playing a crucial role in the flavor quality of soybean paste. Halophilic Tetragenococcus has been used in fermented soy sauce, demonstrating improved flavor. Tetragenococcus is a core bacterial group that influences the color and flavor of soy sauce. The enzymes it produces catalyze a series of metabolic pathways that produce flavor compounds. Proteases, a key enzyme in the soybean paste brewing process, degrade proteins in the raw materials into small peptides and amino acids, and are therefore often used as a measure of flavor quality.

[0006] Halophilic Tetragenococcus has a certain ability to produce proteases. Proteases are a major enzyme in the soybean paste brewing process, which can degrade proteins in the raw materials to produce small molecular peptides and amino acids with the above-mentioned activities. Halophilic Tetragenococcus promotes the utilization of glucose in soybean paste by secreting proteases such as aldose 1-epimerase (EC 5.1.3.3) and glucose phosphomutase (Aldose1-epimerase and sugar-specific II), and is a key saccharifying microorganism in soybean paste. At present, the protease activity value of Halophilic Tetragenococcus is low, resulting in poor application in food production practice and low strain utilization rate. Halophilic Tetragenococcus with high protease activity has the ability to enhance the flavor of food. Therefore, in order to improve the strain utilization rate of Halophilic Tetragenococcus for application in food production, it is necessary to screen out Halophilic Tetragenococcus with high protease activity. Summary of the Invention

[0007] The present invention provides a halophilic Tetragenococcus halophilus SNTH-3 that produces high protease activity and high bioactive peptides, and its application. The halophilic Tetragenococcus halophilus SNTH-3 was screened from 96 traditional naturally fermented soybean pastes from different regions of Liaoning Province in Northeast China. The halophilic Tetragenococcus halophilus has high protease activity, can increase the yield of bioactive peptides, promote the development of the fields of umami peptides and antioxidant peptides, and enhance their application value.

[0008] In one aspect, the present invention provides a strain of Tetragenococcus halophilus SNTH-3, the deposit number of which is CGMCC No. 27586. The present invention also provides the use of the aforementioned Tetragenococcus halophilus in producing bioactive peptides.

[0009] In the above technical solution, further, the fermentation temperature of the halophilic Tetragenococcus is 25° C. to 40° C., the inoculation amount is 1% to 5%, the NaCl concentration is 1% to 10%, and the pH value is 5.5 to 10.5.

[0010] In the above technical solution, further, the fermentation temperature of the halophilic Tetragenococcus is 37° C., the inoculation amount is 3%, the NaCl concentration is 4%, and the fermentation pH is 8.5.

[0011] The present invention also provides the use of the aforementioned halophilic Tetragenococcus in fermented foods.

[0012] Another aspect of the present invention provides a microbial preparation, wherein the microbial preparation comprises the aforementioned halophilic Tetragenococcus.

[0013] In the above technical solution, further, the amount of live bacteria of the halophilic tetragenococcus in the microbial preparation is not less than 10 8 CFU / g.

[0014] The present invention also provides the application of the aforementioned microbial preparation in fermented foods.

[0015] In the above technical solution, further, the fermented food is soybean paste or soy sauce; preferably soybean paste, broad bean paste or bean noodle paste.

[0016] Compared with the existing technology, the present invention has the following beneficial effects: The present invention provides a novel strain of Tetragenococcus halophilus (SNTH-3) with high protease activity. By fermenting this strain, the protease activity value of the culture medium supernatant can reach 342.71±0.48 U / mL, which is significantly higher than the protease activity value of the standard strain ATCC 33315. The γ-glutamyl transferase activity is 7.361±0.003 U / mL, the DPPH free radical scavenging ability reaches 57.32%, the hydroxyl free radical scavenging ability reaches 56.03%, and the polypeptide production capacity reaches 29.34±0.008 mg / mL, which is significantly higher than the peptide production content of the standard strain ATCC33315. Halophilic Tetragenococcus SNTH-3 can be widely used in the production of bioactive peptides, with the advantages of short production cycle, high yield, safety and no toxic side effects. Halophilic Tetragenococcus SNTH-3 has the ability to scavenge DPPH free radicals and hydroxyl free radicals, and plays an important role in antioxidant properties. This strain can also be used to prepare fermented foods, helping to improve the flavor of fermented foods and increase the safety of fermented foods, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the individual morphology of Tetragenococcus halophilus SNTH-3 cells;

[0018] Figure 2 This is the phylogenetic tree of halophilic Tetragenococcus SNTH-3 based on the 16S rDNA gene sequence;

[0019] Figure 3 This is a scanning electron micrograph of halophilic Tetragenococcus;

[0020] Figure 4 The transparent circles are images of some halophilic Tetragenococcus proteases.

[0021] Figure 5 DPPH free radical scavenging activity of Tetragenococcus halophilus SNTH-3 with ascorbic acid as positive control

[0022] Figure 6 The hydroxyl radical scavenging activity of Tetragenococcus halophilus SNTH-3 was measured with ascorbic acid as the positive control.

[0023] Figure 7 The effect of temperature on peptide production and growth of halophilic Tetragenococcus SNTH-3;

[0024] Figure 8 The effect of inoculum size on peptide production and growth of halophilic Tetragenococcus SNTH-3;

[0025] Figure 9The effect of salt concentration on peptide production and growth of halophilic Tetragenococcus SNTH-3;

[0026] Figure 10 The effect of pH on peptide production and growth of halophilic Tetragenococcus SNTH-3.

[0027] Figure 11 Response surface diagram and contour diagram of the effects of fermentation temperature and inoculation amount on polypeptide content;

[0028] Figure 12 Response surface diagram and contour diagram of the effects of fermentation temperature and NaCl concentration on polypeptide content;

[0029] Figure 13 Response surface diagram and contour diagram of the effects of fermentation temperature and pH value on polypeptide content;

[0030] Figure 14 Response surface diagram and contour diagram of the effects of inoculum size and NaCl concentration on polypeptide content;

[0031] Figure 15 Response surface diagram and contour diagram of the effects of inoculum size and pH value on polypeptide content;

[0032] Figure 16 Response surface diagram and contour diagram of the effects of NaCl concentration and pH value on polypeptide content. DETAILED DESCRIPTION

[0033] The screening methods of the present invention are not limited to those described in the Examples; any known method that can achieve the screening purpose may be used. The screening descriptions in the Examples are merely illustrative of the present invention and are not intended to limit the scope of protection of the present invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the present invention are within the scope of the present invention.

[0034] The culture medium and its formula used in the embodiment of the present invention are as follows:

[0035] Prepare modified MRS medium (g / L): 10 g peptone, 3 g sodium acetate (anhydrous), 2 g potassium hydrogen phosphate, 0.575 g magnesium sulfate heptahydrate, 0.25 g manganese sulfate monohydrate, 20 g glucose, 2.42 g trisodium citrate, 4 g yeast extract, 8 g beef extract, 1 g Tween 80, 100 g sodium chloride, and 1 L distilled water. Adjust the pH to 7.0.

[0036] Enrichment medium (g / L): Add 150 g of sodium chloride, 2 g of natamycin, and 500 μL of crystal violet to MRS medium and adjust the pH to 7.0.

[0037] Solid separation medium (g / L): Add 150 g of sodium chloride, 2 g of natamycin, 10 g of calcium carbonate, and 20 g of agar to MRS medium and adjust the pH to 7.0.

[0038] Seed culture medium (g / L): Add 100 g of sodium chloride to the basal medium and adjust the pH to 7.0.

[0039] Skim milk powder medium (g / L): 110.0 g skim milk powder, 15 g agar, 1.0 L distilled water, pH to 7.4.

[0040] Simulated fermentation soybean paste culture medium: 20g of soy protein isolate, 8g of wheat flour, 0.028g of calcium chloride and 28g of deionized water were mixed, sterilized at 121℃ for 30min, cooled to 38℃, inoculated with 3.042% Aspergillus oryzae of Shanghai, and fermented for 3 days. 100mL of phosphate buffer solution was added, stirred vigorously for 1h, centrifuged at 4℃, 10000g / min for 15min, the supernatant was taken, 10% sodium chloride was added, and sterilized at 121℃ for 15min. Halophilic tetragenous cocci were inoculated at a 3% inoculum size.

[0041] Soy peptone medium (g / L): soy peptone 10 g, sodium acetate (anhydrous) 3 g, dipotassium hydrogen phosphate 2 g, magnesium sulfate heptahydrate 0.575 g, manganese sulfate monohydrate 0.25 g, glucose 20 g, trisodium citrate 2.42 g, Tween 80 1 g, sodium chloride 50 g.

[0042] protein Culture medium (g / L): protein 10g, sodium acetate (anhydrous) 3g, dipotassium hydrogen phosphate 2g, magnesium sulfate heptahydrate 0.575g, manganese sulfate monohydrate 0.25g, glucose 20g, trisodium citrate 2.42g, yeast extract 4g, beef extract 8g, Tween 80 1g, sodium chloride 100g, distilled water 1L, pH to 7.0.

[0043] Soy protein isolate medium (g / L): 10 g soy protein isolate, 3 g sodium acetate (anhydrous), 2 g potassium hydrogen phosphate, 0.575 g magnesium sulfate heptahydrate, 0.25 g manganese sulfate monohydrate, 20 g glucose, 2.42 g trisodium citrate, 4 g yeast extract, 8 g beef extract, 1 g Tween 80, 100 g sodium chloride, 1 L distilled water, pH to 7.0.

[0044] The present invention will be further described below with reference to specific embodiments.

[0045] Example 1: Isolation and Identification of Halophilic Tetragenococcus

[0046] (1) Collection of soybean paste samples

[0047] A total of 96 samples of naturally fermented soybean paste were collected from nine regions, including Benxi, Dandong, Dalian, Huludao, Jinzhou, Liaoyang, Liaozhong, Panjin, and Shenyang. Each sample was naturally fermented using traditional methods. After being mixed evenly, the samples were dispensed into disposable sampling tubes, placed in ice boxes, and quickly brought back to the laboratory and stored in a -80°C freezer.

[0048] (2) Isolation of halophilic tetragenococci

[0049] Accurately weigh 1.0 gram of the soybean paste sample and add it to 9 mL of sterile saline, stir thoroughly and let it stand for 15 to 20 minutes. After gradient dilution to the appropriate multiple, take 200 μL of the dilution and add it to the enrichment medium. Place the culture medium at 36°C for 2 to 3 days, and then use the plate spreading method to culture it in solid culture medium for 5 to 6 days. Select single colonies with a morphology similar to that of lactic acid bacteria colonies and perform Gram staining. Select bacteria in pairs or tetrads, and place their colonies in seed culture medium for purification culture. A total of 136 strains of suspected halophilic tetrads were preserved for future use.

[0050] (3) Identification of halophilic Tetragenococcus

[0051] 1) Colony morphology identification

[0052] Physiological and biochemical characterization experiments were conducted according to the "Classification and Identification of Lactic Acid Bacteria and Experimental Methods" and the "Handbook of Common Bacterial Identification." Among the 136 suspected halophilic tetradactylic cocci, 118 strains were selected. These strains had small, raised, milky white, opaque colonies, a smooth, shiny surface, and flat edges. They were non-motile and non-spore-forming. Gram-positive cells were spherical, tetrad-like, or paired.

[0053] 2) Molecular biological identification

[0054] The above 118 strains were inoculated into a modified MRS liquid culture medium at a volume of 3% (v / v), cultured at 37° C. for 48 h to 72 h, and DNA of the strains was extracted using a bacterial genome kit.

[0055] PCR upstream primer 27F and downstream primer 1492R were synthesized by Shanghai Bioengineering Co., Ltd.

[0056] 27F: AGAGTTTGATCCTGGCTCAG(5'---3');

[0057] 1492R: GGTTACCTTGTTACGACTT(5'---3').

[0058] The PCR reaction conditions were as follows: preheating at 95°C for 3 min, denaturation at 94°C for 30 s, annealing at 55°C for 45 s, extension at 72°C for 1 min 30 s, 30 cycles; maintaining at 72°C for 10 min, and keeping at 4°C.

[0059] PCR products were sent to Shanghai Bioengineering Co., Ltd. Sequences were aligned with those in the NCBI database using the BLAST algorithm, confirming that all 118 strains were Tetragenococcus halophilus. A phylogenetic tree was constructed using MEGA 10 software, and the neighbor-joining method was used to evaluate the evolutionary tree and determine the phylogenetic relationships of Tetragenococcus halophilus.

[0060] (4) Preliminary screening of protease production capacity of halophilic Tetragenococcus

[0061] The isolated halophilic tetragenous cocci were cultured in modified MRS medium to the second generation. To ensure the same bacterial concentration in each group, the OD value needed to be adjusted. The bacterial solution was transferred to modified MRS liquid medium at a 3% inoculum volume and cultured for 60 hours, with three parallel experiments performed. On the skim milk agar medium, a hole was punched using a 1 cm diameter punch. When punching, care should be taken to avoid loosening the culture medium. After mixing the bacteria with the culture medium, 200 μL of the fermentation liquid was injected into the hole. The culture dish was placed in a 37°C constant temperature incubator and cultured for 72 hours. Finally, the diameter and depth of the transparent zone were recorded.

[0062] The protease transparent zone can reflect the protease activity of the strain to a certain extent and is representative of the initial screening conditions.

[0063] The results are as follows Figure 4 As shown: The growth of 118 halophilic Tetragenococcus strains was observed and measured on skim milk culture medium. The casein around the bacterial solution was degraded, while no transparent zones appeared in other areas where the bacterial solution could not penetrate. 74 strains with protein transparent zones were selected, of which the circled one was halophilic Tetragenococcus SNTH-3.

[0064] (5) Determination of protease activity of halophilic Tetragenococcus

[0065] The protease activity of Tetragenococcus halophilus fermented in a soybean substrate was determined using a microbial protease ELISA kit. The assay was performed according to the manufacturer's instructions. OD values ​​were measured at 450 nm using a microplate reader, and sample activity was calculated using a standard curve.

[0066] Protease is a major enzyme in the soybean paste brewing process. It can degrade the protein in the raw materials into small molecular peptides and amino acids. Therefore, it is often used as one of the indicators to measure the flavor level.

[0067] The 74 halophilic tetragenous cocci identified in the initial screening were inoculated into culture media simulating different fermentation environments, namely soybean peptone medium, modified MRS medium, protein The protease activity of halophilic Tetragenococcus in four fermentation environments was comprehensively determined using culture medium and soy protein isolate culture medium.

[0068] The results showed that among the four fermentation environments, the average protease activity of halophilic Tetragenococcus SNTH-3 was the highest, reaching 318.64±0.58U / mL.

[0069] (6) Determination of γ-glutamyl transpeptidase activity of halophilic Tetragenococcus

[0070] The γ-glutamyl transpeptidase (γ-GT) activity assay kit was used to determine the γ-GT enzyme activity of Tetragenococcus halophilus in a soybean substrate fermentation environment. The operation was carried out according to the instructions. The main operating steps include: a. centrifugation to collect the bacteria; b. ultrasonic disruption; c. spectrophotometric measurement of its enzyme activity.

[0071] γ-GT, also known as γ-glutamyl transferase, also plays an important role in the production and enhancement of umami during the fermentation process. First, γ-GT enzymes help convert glutamine (Gln) in the fermentation system into the umami amino acid glutamate, which is one of the key amino acid residues that make up umami peptides.

[0072] The results showed that in soy peptone medium, SY2-1γ-GT had the highest activity among the 74 halophilic tetragenous cocci screened, reaching 4.649±0.007U / mL, and SNTH-3 had the second highest activity, reaching 4.478±0.005U / ml, and the activity values ​​of the two were similar. In the culture medium, SNTH-3γ-GT had the highest activity, reaching 9.069±0.071U / mL. In the modified MRS medium, SNTH-3γ-GT had the highest activity, reaching 4.581±0.031U / mL. Based on the γ-GT activity of the three fermentation media, the strain SNTH-3 had the highest activity, reaching 7.361±0.003U / mL.

[0073] (7) Determination of the ability of halophilic Tetragenococcus to produce polypeptides

[0074] The polypeptide content in the culture medium of the fermentation medium of Tetragenococcus halophilus was determined using a BCA protein concentration assay kit according to the instructions. A 562nm was measured using a microplate reader, and the polypeptide concentration was calculated based on the standard curve.

[0075] The results showed that all the tested strains had the ability to produce polypeptides, but the production capacity of polypeptides varied greatly among different strains. SNTH-3 had the strongest polypeptide production capacity (18.41±0.001mg / mL) in the Aspergillus oryzae culture medium that simulated the fermentation process of soybean paste. The production capacity of SNTH-3 was the highest in the three culture media (soybean peptone medium, modified MRS medium, protein In the comprehensive evaluation of culture medium, SNTH-3 had the strongest polypeptide production capacity, reaching 22.14±0.008mg / mL.

[0076] (8) Factor analysis

[0077] 1) KMO and Bartlett's test of sphericity

[0078] The results are shown in Table 1. The KMO value was 0.710, which is greater than 0.5, indicating a certain correlation between the variables. In the Bartlett test of sphericity, the Sig value was 0.000 < 0.005, indicating that the data were normally distributed. Therefore, it can be concluded that the flavor index data of different halophilic tetradactyls are suitable for factor analysis.

[0079] Table 1 KMO and Bartlett's test of sphericity

[0080]

[0081] 2) Factor analysis of taste data of different halophilic tetragenococci

[0082] The data were factor analyzed using SPSS software. The results are shown in Table 2. The characteristic root of the first factor is 2.694, which contains 89.803% of the total variance of the original three variables; the cumulative variance contribution rate of the first two factors is 98.234%, indicating that the first two common factors basically contain all the variable information.

[0083] Table 2 Eigenvalues ​​and variance contribution rates

[0084]

[0085] According to Fi=Ui*Xi(i=1,2,3), a linear regression equation with two common factors is constructed:

[0086] F1=0.860X1+0.668X2-0.765X3

[0087] F2=-0.504X1-0.257X2+1.495X3

[0088] A factor score model was constructed based on the function F=0.57999 / 0.98234*F1+0.40235 / 0.98234*F2 and the comprehensive score was calculated.

[0089] The results showed that the strain with the highest comprehensive factor score was SNTH-3, which had the potential to enhance flavor and provide antioxidants, as well as the ability to produce bioactive peptides.

[0090] In summary, halophilic Tetragenococcus SNTH-3 was determined to be the best strain, with a protease activity of 342.71±0.48U / mL, a γ-glutamyltransferase activity of 7.361±0.003U / mL, and a polypeptide production capacity of 27.14±0.008mg / mL.

[0091] Example 2

[0092] (1) Identification of colony morphology of halophilic Tetragenococcus SNTH-3

[0093] Halophilic Tetragenococcus SNTH-3 colonies are small, raised, milky white, opaque, with a smooth and shiny surface and flat edges; they are non-motile and do not produce spores; they are Gram-positive, and the cells are spherical, tetrad-like or paired. Figure 1 shown.

[0094] (2) Molecular biological identification

[0095]

[0096] SEQ ID NO: 1 was compared with sequences in the NCBI database and matched using the BLAST algorithm, confirming that it was Tetragenococcus halophilus.

[0097] The phylogenetic tree was constructed using MEGA 10 software, and the Neighbor-Joining method was used to evaluate and analyze the evolutionary tree to determine the phylogenetic and phylogenetic relationships of the halophilic Tetragenococcus. Figure 2 Shown is the phylogenetic tree of the SNTH-3 strain, which has the highest homology with Tetragenococcus halophilus.

[0098] The applicant deposited the halophilic Tetragenococcus SNTH-3 on June 8, 2023 at the General Microbiology Center of the China Culture Collection Administration (CGMCC for short, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101), with the deposit number CGMCC No. 27586.

[0099] Example 3: Scanning electron microscopy analysis of halophilic Tetragenococcus

[0100] The structure of halophilic tetragenococcus SNTH-3 was observed and analyzed using cold field emission scanning electron microscopy. 200 mL of modified MRS medium was prepared, and enrichment culture was carried out according to a 3% inoculation volume for 56 hours. Finally, the cells were centrifuged at 3000 g / min and 4°C for 10 minutes, and the centrifuged bacteria were washed 3 times with phosphate buffer solution. The samples were fixed with 2.5% glutaraldehyde electron microscope special fixative for 4 hours. The samples were then washed 4 times with phosphate buffer solution for 20 minutes each time. The samples were dehydrated with a gradient of 30%, 50%, 70%, 90%, and 100% ethanol, and the dehydrated samples were immersed in isoamyl acetate for 15 minutes. Finally, the samples were dried using a carbon dioxide critical point dryer and observed and analyzed using cold field emission scanning electron microscopy.

[0101] The results are as follows Figure 3 As shown: (A) is the observation result at ×10.0k magnification, and (B) is the observation result at ×20.0k magnification. The results show that the appearance of halophilic Tetragenococcus is good at ×10.0k (A) magnification and ×20.0k (B) magnification, and there is no structural variation.

[0102] Example 4: Determination of Antioxidant Activity of Halophilic Tetragenococcus

[0103] (1) Determination of DPPH free radical scavenging activity

[0104] 1) mixing the reaction system and reacting the mixture at room temperature for 30 minutes;

[0105] 2) Absorbance was measured at 517 nm, with deionized water and ascorbic acid used as blank and positive controls. The reaction system consisted of 0.5 ml of the activated SNTH-3 strain (at concentrations of 2, 4, 6, 8, and 10 mg / ml), 1 ml of a 0.25 mM DPPH ethanol solution, and 1 ml of water.

[0106] Clearance rate (%) = (1-(A S -A o ) / A b )×100;

[0107] Among them, As is the absorbance of the sample and the reaction solution, Ao is the background absorbance of the sample, and A b As blank control.

[0108] The results show that: Figure 5 The DPPH free radical scavenging rate was determined to be as high as 56.03% at a concentration of 10 mg / mL, indicating that the strain has a strong ability to scavenge DPPH free radicals and has strong antioxidant capacity.

[0109] (2) Determination of hydroxyl radical scavenging activity

[0110] 1) Mix the reaction system and react the mixture at 25°C for 30 minutes

[0111] 2) Measure the absorbance at 510 nm and use deionized water and ascorbic acid as blank and positive controls, respectively;

[0112] The reaction system consisted of 1 mL 9.0 mM ferrous sulfate, 1 mL 9.0 mM salicylic acid, 1 mL 0.03% H2O2, and 1 mL of activated SNTH-3 strain (at concentrations of 2, 4, 6, 8, and 10 mg / ml, respectively) to be tested.

[0113] Clearance rate (%) = (1-(A S -A o ) / A b )×100;

[0114] Among them, As is the absorbance of the sample and the reaction solution, Ao is the background absorbance of the sample, and A b As blank control.

[0115] The results show that: Figure 6By measuring the scavenging rate of hydroxyl radicals, at a concentration of 10 mg / mL, the scavenging rate of halophilic Tetragenococcus SNTH-3 was as high as 54.72%, indicating that the strain SNTH-3 has a strong ability to scavenge hydroxyl radicals and shows strong antioxidant capacity.

[0116] Example 5: Analysis of fermentation conditions for high production of bioactive peptides from halophilic Tetragenococcus SNTH-3

[0117] (1) Response surface optimization

[0118] Fermentation temperature, inoculation amount, NaCl concentration, and pH value were selected as experimental factors. Based on the single-factor experiment, the Box-Behnken response surface analysis method was used to design the experimental plan. With fermentation temperature, inoculation amount, NaCl concentration, and pH value as experimental factors and polypeptide content as response value, a regression model was established to analyze the effectiveness of the regression model and the influence of each single factor. The extraction factors of high-yield bioactive peptides were optimized to obtain the optimized process conditions for high-yield bioactive peptide extraction.

[0119] The four factors of fermentation temperature, inoculation amount, NaCl concentration, and pH value were selected as independent variables. The single factor value of fermentation temperature, inoculation amount, NaCl concentration, and pH value was taken as the intermediate value for the independent variable. The peptide production was selected as the response surface value. The response surface optimization was performed to obtain the regression equation of the peptide production content:

[0120] Y=29.23+0.56A+0.61B+0.33C-0.49D+0.34AB-0.12AC+0.087AD+0.18BC+0.21BD-0.010CD-3.31A 2 -3.00B 2 -1.28C 2 -1.45D 2

[0121] Where A is the fermentation temperature, B is the inoculation amount, C is the NaCl concentration, and D is the pH value

[0122] The maximum value of polypeptide content and the corresponding fermentation temperature, inoculation amount, NaCl concentration and pH value under the interaction of four factors, fermentation temperature, inoculation amount, NaCl concentration and pH value, were optimized and obtained by software Design-Expert8.0.5.0.

[0123] (2) Analysis of optimal fermentation temperature

[0124] The activated halophilic Tetragenococcus SNTH-3 was inoculated into a soybean protein matrix medium at a 3% inoculum size and a NaCl concentration of 4%. The fermentation pH was controlled at 8.5, and the fermentation was allowed to proceed at 25°C, 29°C, 33°C, 37°C, and 41°C. The peptide content in the bacterial solution was measured every 8 hours from 0 to 6 days, and the blank medium at 0 hours of inoculation was used as the control to plot the peptide production curve. The results are shown in the figure below. Figure 7 shown.

[0125] from Figure 7 It can be seen that when the fermentation temperature is 37℃, the peptide production cycle of halophilic Tetragenococcus SNTH-3 is advanced by 17 hours. When the fermentation is continued for 64 hours, the peptide content in the bacterial solution is the highest, reaching 20.06mg / mL-20.67mg / mL;

[0126] (3) Analysis of the optimal inoculum size

[0127] The activated halophilic Tetragenococcus SNTH-3 was inoculated into a soybean protein matrix medium at an inoculum size of 1%, 2%, 3%, 4%, and 5%, respectively. The NaCl concentration was 4%, the fermentation pH was controlled at 8.5, and the fermentation was allowed to stand at 37°C. The peptide content in the bacterial solution was measured every 8 hours from 0 to 6 days, and the blank medium at 0 hours of inoculation was used as the control to plot the peptide production curve. The results are shown in the figure below. Figure 8 shown.

[0128] from Figure 8 As can be seen, when the inoculum size was 3%, the peptide production curve of halophilic Tetragenococcus SNTH-3 was the highest, indicating that this strain has the strongest peptide production ability. At 64 hours of fermentation, the peptide content in the bacterial liquid of this strain reached its highest value, ranging from 20.31mg / mL to 20.79mg / mL.

[0129] (4) Analysis of optimal NaCl concentration

[0130] The activated halophilic Tetragenococcus SNTH-3 was inoculated into a soybean protein matrix medium at a 3% inoculum size. The fermentation pH was controlled at 8.5 and the culture was allowed to ferment at 37°C under NaCl concentrations of 0%, 2%, 4%, 6%, 8%, and 10%. The peptide content in the culture medium was measured every 8 hours from 0 to 6 days. The peptide production curve was plotted using the blank culture medium at 0 hours of inoculation as the control. The results are shown in the figure below. Figure 9 shown.

[0131] from Figure 9 It can be seen that when the NaCl concentration in the fermentation medium is 4%, the peptide production curve of halophilic Tetragenococcus SNTH-3 is the highest. The peptide content in the bacterial liquid is the highest at 64 hours of fermentation, reaching 19.06-19.14 mg / mL.

[0132] (5) Optimal fermentation pH analysis

[0133] The activated halophilic Tetragenococcus SNTH-3 was inoculated into a soybean protein matrix medium at a 3% inoculum size. The NaCl concentration was 4%. The fermentation pH was controlled at 5.5, 6.5, 7.5, 8.5, 9.5, and 10.5 using a 5M NaOH solution. The fermentation was allowed to proceed at 37°C. The peptide content in the bacterial solution was measured every 8 hours from day 0 to day 6. The peptide production curve was plotted using the blank medium at 0 hours of inoculation as the control. The results are shown in the figure below. Figure 10 shown.

[0134] from Figure 10 It can be seen that when the fermentation pH is 8.5, the peptide production curve of halophilic Tetragenococcus SNTH-3 is the highest. The peptide content in the bacterial liquid is the highest at 64 hours of fermentation, reaching 18.95 mg / mL-19.04 mg / mL.

[0135] Example 6 Response surface experiment optimization

[0136] (1) Box-Behnken experiment

[0137] Based on the principles of response surface design, four factors with significant effects on polyphenol extraction efficiency were selected based on the single-factor experiment: fermentation temperature, inoculum size, NaCl concentration, and pH value as independent variables, and polypeptide content as the response value. A four-factor, three-level experiment was conducted, with a total of 29 experimental sites and five central experimental sites. The factor levels of the response surface experiment are shown in Table 3, and the experimental design and results are shown in Table 4.

[0138] Table 3

[0139]

[0140] Table 4

[0141]

[0142] (2) Establishment of regression model and significance test

[0143] The data were analyzed by variance analysis using response surface optimization software, and the regression equation of Y (polypeptide content), A (fermentation temperature), B (inoculation amount), C (NaCl concentration), and D (pH value) was obtained by fitting the data: Y = 29.23 + 0.56A + 0.61B + 0.33C - 0.49D + 0.34AB - 0.12AC + 0.087AD + 0.18BC + 0.21BD - 0.010CD - 3.31A 2 -3.00B 2 -1.28C 2 -1.45D 2 The regression equation was subjected to variance analysis and significance test, and the results are shown in Table 3. 2, calibration determination coefficient R adj 2 , signal-to-noise ratio, lack of fit term, coefficient of variation and other results were used to analyze the accuracy and credibility of the model. As shown in Table 5, the regression model P<0.001, indicating that the regression model results are extremely significant; the lack of fit term P is 0.5447>0.05, indicating that the lack of fit term is not significant, and the coefficient of determination R 2 0.9985>0.8 indicates that the model can explain 99.85% of the response value variation; the correction coefficient of determination R adj 2 , 0.997 and R 2 The model fit was good, with a signal-to-noise ratio of 85.932, greater than the critical value of 4, indicating high accuracy. The coefficient of variation (CV) was 0.45%, less than 10%, indicating high precision and reliability of the experimental results. In summary, the regression model had a high fit, small error, and high credibility, and could be used for optimizing the content of high-yield bioactive peptides.

[0144] Analysis of the P value shows that there are very significant factors A, B, C, D, AB, A 2 、B 2 、C 2 、D 2 There are significant factors AC, BC, and BD; there are also insignificant factors AD and CD. From this, we can see that the response value is affected not only by the first-order factors, but also by the second-order and interaction factors. This shows that the influence of each factor on the response value is not a linear relationship, but a quadratic relationship. The four factors affect each other and have an interactive effect. From the size of the F value, we can see that the influence of the four factors A, B, C, and D on the polypeptide content is B>A>D>C

[0145] Table 5

[0146]

[0147]

[0148] Note: ** indicates extremely significant, * indicates significant.

[0149] (3) Interaction analysis

[0150] As shown in Table 3, the interaction between AB has a significant effect on the peptide content (P<0.01), while the interaction between AD and CD has no significant effect on the peptide content (P>0.05). Figures 11 to 16 The shape of the contour line can be used to judge the strength of the interaction between factors. The closer the contour line is to a circle, the weaker the interaction. Figures 11 to 16It can be seen that the interaction between fermentation temperature and inoculation amount has a significant effect on polypeptide content, while the interaction between fermentation temperature and pH value, and the interaction between pH value and NaCl concentration have no significant effect on polypeptide content.

[0151] The slope of the response surface can reflect the degree of influence of the change of factor level on the response value. The larger the slope of the response surface, the greater the influence. The peptide content fluctuates with the change of factor interaction. Figures 11 to 16 This is a surface plot obtained from response surface optimization. It shows the interaction between any two factors (A, B, C, and D) and their effects on peptide content when the levels of any two of them are fixed at zero. Response surface analysis is based on the interaction of each factor. Response surface contour plots intuitively reflect the impact of each factor on the response value, allowing for identification of optimal process parameters and their interactions. The center of the smallest ellipse within the contour lines represents the highest point on the response surface. Both the response surface and contour plots indicate that the interaction between fermentation temperature and inoculum size significantly influences peptide content.

[0152] (4) Response surface optimization results

[0153] The optimal process conditions were optimized using the software Design-Expert 8.0.5.0. The polypeptide content could reach 29.2517 mg / ml when the fermentation temperature was 37.34°C, the fermentation pH was 8.5, the optimal inoculation size was 3%, and the optimal NaCl concentration was 4%. Considering the operability of the experiment, the optimal process conditions were determined to be 37°C, the fermentation pH was 8.5, the optimal inoculation size was 3%, and the optimal NaCl concentration was 4%, which were the optimal culture conditions for high yield of umami peptides. Under the optimal process conditions, the results of three parallel experiments showed that the content of high yield of umami peptides was not much different from the theoretical predicted value, proving that the regression model well predicted the polypeptide content effect, and the optimized process conditions parameters were reasonable and suitable for the cultivation of high yield of umami peptides.

[0154] (5) Experimental verification

[0155] The peptide was produced using the optimized process conditions mentioned above:

[0156] The activated halophilic Tetragenococcus SNTH-3 was inoculated into a soybean protein matrix medium with a NaCl concentration of 4% and an inoculum size of 3%. The fermentation pH was controlled at 8.5 and the culture was allowed to ferment at 37°C. The culture medium was collected every 8 hours for determination of polypeptide content within 0-6 days.

[0157] After 72 hours of fermentation, peptide production was higher than that of the pre-optimized Tetragenococcus halophilus SNTH-3 strain, reaching 29.25 mg / mL. Electronic tongue analysis revealed an umami value of 20.43, demonstrating excellent umami flavor. Its protease activity reached 342.71±0.48 U / mL, significantly higher than that of the unoptimized SNTH-3 strain. This provides a solid foundation for further research into the umami peptide production characteristics of T. halophilus SNTH-3 in modified MRS medium and its application in production.

[0158] In summary, the halophilic Tetragenococcus SNTH-3 strain obtained by screening in this invention can be widely used in the production of bioactive peptides, offering advantages such as a short production cycle, high yield, safety, no toxic side effects, and strong antioxidant capacity. This strain can also be used to prepare fermented foods, helping to improve the flavor and safety of fermented foods, and has broad application prospects. This will facilitate future in-depth research on bioactive peptides and provide basic data support for further exploration of the freshness production mechanism of T. halophilus and its future applications in food, medicine, and other fields.

[0159] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of halophilic Tetragenococcus ( Tetragenococcus halophilus ) SNTH-3, characterized in that The deposit number of the halophilic Tetragenococcus is CGMCC No. 27586.

2. Use of the halophilic Tetragenococcus according to claim 1 in producing bioactive peptides.

3. The use according to claim 2, characterized in that The fermentation temperature of the halophilic tetragenococcus is 25° C. to 40° C., the inoculation amount is 1% to 5%, the NaCl concentration is 1% to 10%, and the pH value is 5.5 to 10.

5.

4. The use according to claim 3, characterized in that The fermentation temperature of the halophilic Tetragenococcus is 37° C., the inoculation amount is 3%, the NaCl concentration is 4%, and the fermentation pH value is 8.

5.

5. Use of the halophilic Tetragenococcus according to claim 1 in fermented foods.

6. A microbial preparation, characterized in that The microbial preparation comprises the halophilic Tetragenococcus according to claim 1.

7. The microbial preparation according to claim 6, characterized in that The viable bacteria count of the halophilic tetragenous cocci in the microbial preparation is not less than 10 8 CFU / g.

8. Use of the microbial preparation according to claim 6 in fermented foods.

9. The use according to claim 5 or claim 8, characterized in that The fermented food is soybean paste and soy sauce.

Images