Acetylcholinesterase crystal derived from Aspergillus niger GZUF36 and preparation method and application thereof

Abstract

The present invention discloses an acetylcholinesterase crystal derived from Aspergillus niger GZUF36 and a preparation method and application thereof, belonging to the field of enzyme engineering technology. The amino acid sequence of the acetylcholinesterase is shown in SEQ ID NO.2; the acetylcholinesterase crystal structure consists of an asymmetric monomer with a space P3 2 21, the unit cell parameters are #imgabs0##imgabs1#. This acetylcholinesterase has high specificity for acetylcholine and can maintain high catalytic efficiency even under low temperature conditions. In the presence of ethyl acetate, xylene, n-hexane and isooctane, its hydrolytic enzyme activity is improved, showing super enzyme activity, with a relative enzyme activity of more than 120%, and has good pH stability. It can efficiently detect organophosphorus pesticides and carbaryl, and the detection concentration of organophosphorus solution can be as low as 1μg / mL, and the detection concentration of carbaryl can be as low as 10 ‑6 mg / mL.

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering, and in particular to an acetylcholinesterase crystal derived from Aspergillus niger GZUF36, and a preparation method and application thereof. Background Art

[0002] GDSL lipase / esterase is a newly discovered type of lipase / esterase with a conserved GDSL sequence at the N-terminus of the protein. Its protein sequence contains five conserved sequence regions IV, of which four conserved regions I, II, III and V contain highly conserved catalytic sites Ser, Gly, Asn and His, respectively, and therefore belong to the SGNH hydrolase superfamily. GDSL lipase / esterase has a unique GDSL conserved sequence, which is different from traditional lipase / esterase with GxSxG sequence and shows uniqueness: this type of hydrolase has a more flexible catalytic site, can change its own conformation with the presence and binding of different substrates, and generally does not require cofactors. Due to the diversity of its catalytic substrates, different GDSLs also have structural and functional diversity. Therefore, GDSL lipase / esterase has potential for wide application in industries such as food processing, biology, pharmaceutical and cosmetic production, papermaking and pollutant treatment.

[0003] Acetylcholinesterase (AChE) is mainly derived from animals and is a multi-molecular complex protein. It is an important catalytic substance in the nervous system. It can quickly hydrolyze the neurotransmitter acetylcholine (Ach) between synapses, prevent neurotoxins caused by the accumulation of Ach, terminate the transmission of nerve signals, and ensure the normal physiological function of Ach in the body. AChE mainly consists of two parts, namely the anion subsite and the catalytic triad, of which the catalytic triad is responsible for hydrolyzing the substrate.

[0004] Compared with animal acetylcholinesterase, the GDSL type acetylcholinesterase of cold-active Aspergillus niger GZUF36 is discovered for the first time, and its selective catalytic mechanism of acetylcholine hydrolysis is unclear. Therefore, it is necessary to further study the enzyme, including its structure and properties, to provide reference and guidance for the application of this type of enzyme in industrial production. Summary of the invention

[0005] The purpose of the present invention is to provide an acetylcholinesterase crystal derived from Aspergillus niger GZUF36 and a preparation method and application thereof, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an acetylcholinesterase crystal derived from Aspergillus niger GZUF36, wherein the amino acid sequence of the acetylcholinesterase is shown in SEQ ID NO.2;

[0008] The acetylcholinesterase crystal structure consists of an asymmetric monomer with a spatial P3 2 21, the unit cell parameters are

[0009] Preferably, the acidic amino acid of the catalytic triad is replaced by Asn.

[0010] Preferably, the overall structure of the acetylcholinesterase crystal has 5 β-folds and 9 α-helices, forming an αβα-folded structure, which is a typical structural feature of SGNH hydrolase, and the active center is formed by the catalytic triad composed of Ser34, Asn267, and His270.

[0011] The present invention also provides a method for preparing the acetylcholinesterase crystals, which comprises constructing a recombinant expression strain containing the acetylcholinesterase gene, carrying out selenoprotein culture, and then purifying, concentrating and crystallizing to obtain the acetylcholinesterase crystals.

[0012] Preferably, the concentration is to concentrate the purified acetylcholinesterase to 10-30 mg / mL.

[0013] Preferably, the crystallization condition is culturing under a buffer condition containing a high salt concentration.

[0014] Preferably, the buffer is 2M (NH 4 ) 2 SO 4 , 100mM Tris pH 8.5, 100mM HEPES pH 7.5 or 100mM MES pH 6.5.

[0015] The invention also provides a product for detecting organic phosphorus, comprising the acetylcholinesterase crystal.

[0016] The invention also provides a product for detecting carbaryl, comprising the acetylcholinesterase crystal.

[0017] The present invention also provides a method for hydrolyzing esters, which utilizes the acetylcholinesterase to catalyze the hydrolysis of the esters.

[0018] Based on the above technical solution, the present invention has the following technical effects:

[0019] The present invention provides an acetylcholinesterase crystal derived from Aspergillus niger GZUF36, a preparation method and application thereof. The acetylcholinesterase has high specificity for acetylcholine, can maintain high catalytic efficiency under low temperature conditions, and in the presence of ethyl acetate, xylene, n-hexane and isooctane, its hydrolytic enzyme activity is improved, showing a super enzyme activity phenomenon, with a relative enzyme activity of more than 120%, and has good pH stability. It can efficiently detect organophosphorus pesticides and carbaryl, with good detection effect, short time and high sensitivity. The detection concentration of organophosphorus solution can be as low as 1 μg / mL, and the detection concentration of carbaryl can be as low as 10 -6 mg / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 This is the gel electrophoresis analysis of the first GST purification of recombinant acetylcholinesterase, from left to right are protein marker and GST column eluate;

[0022] Figure 2 This is the gel electrophoresis analysis of recombinant acetylcholinesterase purified by Q column;

[0023] Figure 3 This is the gel electrophoresis analysis of the second GST purification of recombinant acetylcholinesterase, from left to right are protein marker and the second GST column eluate;

[0024] Figure 4 This is the gel electrophoresis analysis of the purified seleno-recombinant acetylcholinesterase, from right to left are the protein marker and the second GST column eluate;

[0025] Figure 5 This is a single crystal of Aspergillus niger GZUF36 acetylcholinesterase grown in the initial screening;

[0026] Figure 6 The overall structure of Aspergillus niger GZUF36 acetylcholinesterase;

[0027] Figure 7 is the local electron density map at the 1σ level;

[0028] Figure 8 It is the structural superposition of acetylcholinesterase and choe;

[0029] Fig. 9is the substrate specificity map of recombinant acetylcholinesterase;

[0030] Fig.10 This is the optimal reaction temperature diagram of recombinant acetylcholinesterase;

[0031] Fig.11 This is the optimal reaction pH diagram of recombinant acetylcholinesterase;

[0032] Fig.12 This is a graph showing the effect of metal ions on the activity of recombinant acetylcholinesterase;

[0033] Fig.13 This is a graph showing the effect of surfactant on the activity of recombinant acetylcholinesterase;

[0034] Fig.14 This is a graph showing the effect of organic solvents on the activity of recombinant acetylcholinesterase;

[0035] Fig.15 is the thermal stability diagram of recombinant acetylcholinesterase;

[0036] Fig.16 is the pH stability diagram of recombinant acetylcholinesterase;

[0037] Fig.17 The effects of two organophosphorus pesticides on recombinant acetylcholinesterase;

[0038] Fig.18 The effect of the pesticide carbaryl on recombinant acetylcholinesterase. DETAILED DESCRIPTION

[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0040] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0041] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0042] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0043] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0044] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.

[0045] Example 1

[0046] Construction of Recombinant Plasmid of Aspergillus niger GZUF36 Acetylcholinesterase in Escherichia coli

[0047] Based on the GDSL esterase gene of Aspergillus niger GZUF36 (GenBank accession number: MW605130.1), Shanghai Shenggong Biotechnology Co., Ltd. was commissioned to optimize the sequence according to the codon preference of Escherichia coli and synthesize the entire gene using an artificial synthesis method (SEQ ID NO.1).

[0048] SEQ ID NO.1:

[0049] atgactggtatccccacagtcacagccagaccatggacccaacgaccaagagcagaaaactcaaccacgaatcccacctacttcttcactttcggagactcctactcccaaaccggcttcagcgcctcgggcacccaaccatccgcctccaatcccatgggcaacccagacctaggaatcggcaccacaaccaacggccccaactggatcggctacctaaccacaaccgaaaacgcctccttagtgctttcctacaacctcgccgcgggcggtgccacaatcgacaatgccctggttcctgcatacccgggtgaccttgcatcacagttccggctattcgaggatgtgtatgctgataagccggcctcggcaccctggagtgcagaggatgcggtatttggggtgtggattgggattaatgatataggaaacgcgtattactctaccgatgcggagacatacacacccaagttaatctccagattggaaagtctagtggaagaggtatacaagaacgggggcaggaaattcctgttcctgaatgtgccgccgacgagtcgcagtccgttgtttttggagcagggagaggaggtggtgaagcagcatgcggagtatttgagtgtttataatgagaatttggagggaatggtggatgattttactaagaagaagggagatgtaacgactgtcttgtatgactcgtggtcattcatgacgaagatcctggatgatccgacagcgtatggattccccgatgcgacgtgtatcaatgatgatgggacgtcgtgtatctggtggaataattatcatcccgggatgaagtatcatcttttgcaggctgaggatatgaagccgaagttgaggaagttgggagggtgg;

[0050] The protein sequence encoded by this gene is shown in SEQ ID NO.2:

[0051] Met Thr Gly Ile Pro Thr Val Thr Ala Arg Pro Trp Thr Gln Arg Pro ArgAla Glu AsnSer Thr Thr Asn Pro Thr Tyr Phe Phe Thr Phe Gly Asp Ser Tyr SerGln Thr Gly Phe Ser AlaSer Gly Thr Gln Pro I Ala Ser Asn Thr GPro Thr Gly Asp Gly ThrAsn Gly Pro Asn Trp Ile Gly Tyr Leu ThrThr Thr Glu Asn Ala Ser Leu Val Leu Ser TyrAsn Leu Ala Ala Gly Ala ThrIle Asp Ala Leu Val Pro Ala Tyr Pro Gly Pro Gly Asp LeuAla Ser Gln Phe Arg LeuPhe Ala Asp Pro T Tyr Ala Tyr Phe Gly Val Trp Ile Gly Ile Asn Asp Ile Gly Asn Ala Tyr Tyr Ser ThrAspAla Glu Thr Tyr Thr Pro Lys Leu Ile Ser Arg Leu Glu Ser Leu Val Glu ValTyr Lysn Gly Gly Arg Lys Phe Leu Phe Leu Asn Gly Arg Val Pro GPro Pro Thr Val Val Lys Gln His Ala Glu Tyr Leu SerVal Tyr Asn Glu Asn LeuGlu Gly Met Val Asp Phe Thr Lys Lys Gly AspVal Thr Thr Val Leu Asp SerTrp Ser Phe Met Thr Lys Ile Leu Asp ProThr Ala Pro Asp Thr Gly PheIleAsn Asp Asp Gly Thr Ser Cys IleTrp Trp Asn Asn Tyr His Pro Gly Met Lys Tyr His LeuLeu Gln Ala Glu Asp MetLys Pro Lys Leu Arg Lys Leu Gly Gly Trp.

[0052] After obtaining the synthetic gene, PCR amplification was performed. After the PCR amplification product was purified by a DNA purification kit, the purified gene fragment and plasmid pGEX4T-1 (purchased from Haoge Biology) were double-digested with restriction endonucleases Bam HI and Not I, respectively, connected, and transformed into Escherichia coli DH5α competent state. Spread on LB plates (containing 100 μg / mL ampicillin). Positive clones were picked and identified by restriction enzyme double digestion and gene sequencing. The results showed that pGEX4T-1-Aspergillus niger GZUF36 acetylcholinesterase expression plasmid was obtained.

[0053] Example 2

[0054] Construction, screening and identification of Escherichia coli expression hosts

[0055] The pGEX4T-1-A. niger GZUF36 acetylcholinesterase expression plasmid was heat-shocked into E. coli BL21 (DE3), and the transformation solution was spread on an LB plate containing 100 μg / mL ampicillin and cultured at 37°C overnight. A single colony of E. coli on the plate was randomly picked and placed in 5 mL of fresh LB medium containing 100 μg / mL ampicillin, and cultured at 37°C, 200 rpm, and shaken overnight until the OD 600 The pH value was 0.6-0.8, and then IPTG was added to a final concentration of 0.1 Mm. The cells were induced with shaking at 16°C and 200 rpm for 20 h, and centrifuged at 4°C and 6000 x g for 10 min to collect the bacteria. The obtained bacteria were added with pre-cooled saline and washed twice, and then pre-cooled GST binding buffer was added to resuspend the bacteria, ultrasonically disrupted, and centrifuged at 4°C and 10000 x g for 20 min to remove insoluble substances. The whole cells, supernatant and precipitate were subjected to protein electrophoresis to verify whether the target protein was expressed.

[0056] Example 3

[0057] Expansion and purification of acetylcholinesterase from Aspergillus niger GZUF36

[0058] The positive recombinant expression strains screened were transferred to 50 mL of LB liquid medium containing 100 μg / mL ampicillin, and cultured at 37°C and 200 rpm with shaking as the primary seed solution. The seed solution was transferred to a 250 mL Erlenmeyer flask containing 100 mL of LB liquid medium at 37°C according to the inoculum ratio of 2:100 (v / v). 600 ) is about 0.6-0.8, 0.1mM IPTG is added to the culture medium to induce the expression of the target protein, and the culture is carried out at 16°C for 20h. The collection of bacterial liquid is carried out in accordance with Example 2. The harvested E. coli cells are resuspended in pre-cooled lysis buffer at a ratio of 20mL of binding buffer per gram of wet bacteria and ultrasonically treated (power 250W, ultrasonic time 5s, interval time 8s) for 30min. Cell disruption should always be carried out in an ice bath. The disrupted liquid is centrifuged at 10000xg for 20min at 4°C.

[0059] The supernatant was purified by GST affinity column chromatography. The expressed recombinant protein contained a GST tag and could be affinity adsorbed to the chromatography column. After elution with different concentrations of glutathione elution buffer, the eluted eluate was collected. The distribution of the target protein in the eluate was detected by SDS-PAGE ( Figure 1 ).

[0060] After purification by GST column, the eluate was collected and further purified by anion exchange column Q column, and the eluate was collected again. The distribution of the target protein in the eluate was detected by SDS-PAGE ( Figure 2 ).

[0061] The eluate purified by the Q column was collected, and the GST tag of the recombinant protein was removed by thrombin. 3U of thrombin was added to 1mg of protein, and the protein was placed at 22°C for 20h. The GST tag was removed by GST affinity column chromatography after enzyme cleavage. The target protein was fully purged, and the sample was collected for SDS-PAGE detection. The electrophoresis-pure recombinant esterase protein INANE1 ( Figure 3 ), molecular weight about 32kDa. Use ultrafiltration tube to concentrate protein to a certain concentration. Use BCA method to determine protein concentration.

[0062] Example 4

[0063] Cultivation and Purification of Acetylcholinesterase from Selenogenated Aspergillus niger GZUF36

[0064] The selenoprotein was cultured according to the method reported by Yang Zhenxing (Structure and Function Study of Thermophilic Esterase EstL5 of GDSL Family, Ph.D. Dissertation of Fudan University, 2011): The positive recombinants screened in Example 2 were cultured in M9 medium to express selenoprotein, and then purified and the GST tag was cleaved according to the method of Example 3, and finally the electrophoresis-pure selenoprotein was purified ( Figure 4 )

[0065] Example 5

[0066] Crystal preparation and structure elucidation

[0067] Purified A. niger GZUF36 acetylcholinesterase was concentrated to 10 mg / mL. All crystals were grown by hanging drop or sessile drop vapor diffusion at 15 °C by mixing 1 μL of 10 mg / mL A. niger GZUF36 acetylcholinesterase with 1 μL of crystallization pool solution in different buffers containing a high salt concentration (2 M (NH 4 ) 2 SO 4 , 100 mM Tris, pH 8.5, or 100 mM HEPES, pH 7.5, or 100 mM MES, pH 6.5). 4 )2SO 4 , 100 mM Tris, pH 8.5), crystals appeared overnight, and after one week of growth, the crystals gradually grew larger ( Figure 5 ). Cultivate the selenoAspergillus niger GZUF36 acetylcholinesterase and obtain crystals of selenoAspergillus niger GZUF36 acetylcholinesterase. Take out the obtained crystals with a crystal scoop, put them into the corresponding growth pool liquid supplemented with 20% glycerol, quickly take them out, put them into a puck pre-frozen in liquid nitrogen, and send them to Shanghai Light Source BL19U1 to collect diffraction data.

[0068] Use XDS to process the diffraction image of the protein crystal obtained in the previous step, convert the diffraction image file with the suffix .cbf into a digital file with the suffix .mtz, use Aimless to normalize the data, obtain the merged data, including the crystal diffraction intensity file, and then use truncate to convert the diffraction intensity file into amplitude information, including the structure factor, that is, the electron cloud density file. First, check the electron cloud density file of the seleno-Aspergillus niger GZUF36 acetylcholinesterase, analyze the se abnormal signal, use shelx software to resolve the crystal structure of the seleno-Aspergillus niger GZUF36 acetylcholinesterase, and alternately use the refine program of the phenix program and the Coot software to refine the initial model. Using the crystal structure of the seleno-Aspergillus niger GZUF36 acetylcholinesterase as a model, the crystal structure of the Aspergillus niger GZUF36 acetylcholinesterase was resolved by the molecular replacement method. Use the phaser program of the CCP4 software. Finally, the initial model was refined alternately using the REfmac program and Coot software to obtain the crystal structure of Aspergillus niger GZUF36 acetylcholinesterase ( Figure 6 ).

[0069] Table 1 Diffraction data and structural parameters of the crystal structure of Aspergillus niger GZUF36 acetylcholinesterase

[0070]

[0071]

[0072] a: The data in brackets are at high resolution.

[0073] Example 6

[0074] Activity detection of recombinant Aspergillus niger GZUF36 acetylcholinesterase

[0075] The activity of purified recombinant Aspergillus niger GZUF36 acetylcholinesterase was determined by the Ellman method. Specific operation: First, 1.85 ml of 0.1 mol / L Tris-HCl buffer (pH 8.0) was incubated at 30°C for 10 min, and then 50 μL of enzyme solution (0.150 mg / mL), 50 μL of 0.075 mol / L substrate ATCh and 50 μL of 10 mmol / L DTNB were added. After reacting at this temperature for 10 min, 1 mL of anhydrous ethanol was immediately added to terminate the reaction. The ultraviolet spectrophotometer (Beijing Puxi Instrument) was used to measure the activity of purified recombinant Aspergillus niger GZUF36 acetylcholinesterase. The activity of purified recombinant Aspergillus niger GZUF36 acetylcholinesterase was measured by the Ellman method. 412 The absorbance was measured at 100 nm. A pH 8.0 0.1 mol / L Tris-HCl buffer was used as a control for zero adjustment. The results were repeated three times and the average value was taken. Under the above determination conditions, the amount of enzyme that hydrolyzes 1 μmol ATCh per minute was defined as 1 enzyme activity unit (IU).

[0076] Example 7

[0077] Analysis of substrate specificity of recombinant Aspergillus niger GZUF36 acetylcholinesterase

[0078] The substrate specificity analysis of recombinant Aspergillus niger GZUF36 acetylcholinesterase was performed using a system (3 mL): 0.1 mol / LTris-HCl buffer (pH 8.0), 0.075 mol / L substrate, 10 mmol / L DTNB, 0.150 mg / mL enzyme solution, and 1 mL of anhydrous ethanol was immediately added to terminate the reaction after reacting at 30 °C for 10 min. The absorbance value A was measured. 412 The substrates used in the assay were iodinated thioacetylcholine, iodinated thiopropionylcholine and iodinated thiobutyrylcholine. The assay showed that the recombinant Aspergillus niger GZUF36 acetylcholinesterase had a preference for the substrate iodinated thioacetylcholine, with the best hydrolysis effect, and had no obvious hydrolysis effect on other substrates, that is, it had high specificity for acetylcholine ( Fig. 9 ).

[0079] Example 8

[0080] Analysis on the Optimal Reaction Temperature Conditions of Recombinant Aspergillus niger GZUF36 Acetylcholinesterase

[0081] The optimal reaction temperature of recombinant Aspergillus niger GZUF36 acetylcholinesterase was determined in the range of 0-55°C. The specific operation was as follows: in a 3mL system, 0.1mol / L Tris-HCl buffer (pH 8.0), 0.075mol / L substrate, 10mmol / LDTNB, 0.150mg / mL enzyme solution was added, and the reaction was performed at 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55°C for 10min, and then 1mL of anhydrous ethanol was immediately added to terminate the reaction, and the absorbance value A was determined. 412 The results showed that the reaction temperature range of the recombinant Aspergillus niger GZUF36 acetylcholinesterase was 0-50°C, and the optimum reaction temperature was 30°C, indicating that the recombinant Aspergillus niger GZUF36 acetylcholinesterase could maintain a high catalytic efficiency under low temperature conditions ( Fig.10 ).

[0082] The optimal reaction pH of recombinant Aspergillus niger GZUF36 acetylcholinesterase was determined in the range of 2.0 to 10.0. The specific operation was as follows: 0.075 mol / L substrate, 10 mmol / L TNB, and 0.150 mg / ml enzyme solution were added to buffer solutions of different pH values ​​(pH 2-10 buffer solutions), and 1 mL of anhydrous ethanol was immediately added to terminate the reaction after reacting at 30°C for 10 min. The absorbance value A was determined. 412The results showed that the optimal reaction pH of the recombinant Aspergillus niger GZUF36 acetylcholinesterase was 7.0, and it was active in the pH range of 5.0 to 9.0 ( Fig.11 ).

[0083] Example 9

[0084] Analysis of the Enzymatic Stability of Recombinant Aspergillus niger GZUF36 Acetylcholinesterase

[0085] The specific operation of the determination of the effect of metal ions on the acetylcholinesterase activity of recombinant Aspergillus niger GZUF36 is as follows: 10mmol / L metal ions (Cu 2+ 、Na + , K + 、Zn 2+ 、Co 2+ Mg 2+ 、Al 3+ 、Aspergillus niger GZUF36 acetylcholinesterase e 3+ and Ca 2 + ) and enzyme solution in equal proportions and incubate at 4°C for 2h to measure enzyme activity. Enzyme activity measurement system: Add 0.1mol / LTris-HCl buffer (pH 8.0), 0.075mol / L substrate, 10mmol / LDTNB, 0.150mg / ml enzyme solution to 3ml system, react at 30°C for 10min, then immediately add 1mL of anhydrous ethanol to terminate the reaction, and measure the absorbance value A 412 nm. The results showed that + 、Zn 2+ 、Co 2+ 、Al 3+ and Aspergillus niger GZUF36 acetylcholinesterase e 3+ After incubation, the hydrolytic enzyme activity increased, showing a super enzyme activity phenomenon, with a relative enzyme activity of more than 115%. 2+ The strongest activation effect on the recombinant Aspergillus niger GZUF36 acetylcholinesterase was observed, with a relative enzyme activity of 158%. The other metal ions all had an inhibitory effect on the recombinant Aspergillus niger GZUF36 acetylcholinesterase, among which the activity of the esterase was inhibited by Cu 2+ Complete inhibition ( Fig.12 ).

[0086] Determination of the effect of surfactant on the activity of recombinant Aspergillus niger GZUF36 acetylcholinesterase Specific operation: 0.1% (v / v) surfactant (CTAB, Span 80, sodium N-lauroyl sarcosine, Tween 20, 40, 60, 80, Triton X-100, SDS) and enzyme solution were mixed in equal proportions and incubated at 4°C for 2h to determine the enzyme activity. Enzyme activity measurement system: 0.1mol / L Tris-HCl buffer (pH 8.0), 0.075mol / L substrate, 10mmol / L TNB, 0.150mg / ml enzyme solution were added to the 3ml system, and 1mL of anhydrous ethanol was immediately added to terminate the reaction after reacting at 30°C for 10min, and the absorbance value A was determined. 412 The results showed that the esterase INANE1 could still maintain more than 50% activity in the presence of CTAB, Span 80, sodium N-lauroyl sarcosine, Tween 20, 40, 60, 80, Triton X-100 and 10% SDS ( Fig.13 ).

[0087] Determination of the effect of organic solvents on the activity of recombinant Aspergillus niger GZUF36 acetylcholinesterase Specific operation: Mix the organic solvent (dimethyl sulfoxide, methanol, acetonitrile, acetic acid, ethanol, ethyl acetate, xylene, n-hexane, isooctane) with the enzyme solution in equal proportions and incubate at 4°C for 2 hours. Determine the enzyme activity. The determination system is: in 3mL system, add 0.1mol / L Tris-HCl buffer (pH 8.0), 0.075mol / L substrate, 10mmol / L DTNB, add 0.150mg / mL enzyme solution, react at 30°C for 10min, immediately add 1mL of anhydrous ethanol to terminate the reaction, and measure the absorbance value A 412 The results showed that the activity of acetylcholinesterase of recombinant Aspergillus niger GZUF36 was completely inhibited in the presence of acetic acid, while in the presence of ethyl acetate, xylene, n-hexane and isooctane, its hydrolytic enzyme activity was enhanced, showing a super enzyme activity phenomenon, with a relative enzyme activity of more than 120% ( Fig.14 ).

[0088] The specific operation of the thermal stability analysis of the recombinant Aspergillus niger GZUF36 acetylcholinesterase is as follows: the enzyme solution is kept in a water bath at 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, and 60℃ for 60min, and its residual enzyme activity is determined. The specific operation of the pH stability analysis of the recombinant Aspergillus niger GZUF36 acetylcholinesterase is as follows: the enzyme solution is mixed with buffer solutions of different pH values ​​in a ratio of 1:2, and then allowed to stand at room temperature for 48h, and its residual enzyme activity is determined. The determination system is as follows: 0.1mol / L Tris-HCl buffer (pH 8.0), 0.075mol / L substrate, 10mmol / L DTNB, 0.150mg / mL enzyme solution are added to the 3mL system, and 1mL of anhydrous ethanol is immediately added to terminate the reaction after reacting at 30℃ for 10min, and the absorbance value A is determined. 412 The results showed that at 20, 25, 30, 35 and 40°C, the recombinant Aspergillus niger GZUF36 acetylcholinesterase could maintain more than 80% activity, and at 45, 50 and 55°C, the recombinant Aspergillus niger GZUF36 acetylcholinesterase could still maintain more than 50% activity, indicating that the recombinant Aspergillus niger GZUF36 acetylcholinesterase has good thermal stability ( Fig.15 ). Under pH 2.0, the activity of the recombinant Aspergillus niger GZUF36 acetylcholinesterase only remained more than 30%, while under pH 3.0-10.0, the recombinant Aspergillus niger GZUF36 acetylcholinesterase could still maintain more than 55% activity. This indicates that the recombinant Aspergillus niger GZUF36 acetylcholinesterase has good pH stability ( Fig.16 ).

[0089] Example 10

[0090] Sensitivity of recombinant Aspergillus niger GZUF36 acetylcholinesterase to organophosphorus pesticides

[0091] A series of organophosphorus pesticide solutions (omethoate and dichlorvos) with concentration gradients were prepared, with concentrations of 0, 1, 2, 4, 5, 6, 8, and 10 μg / mL, and the enzyme solution and organophosphorus pesticide were mixed in equal proportions and incubated at 30°C for 10 minutes, and the absorbance was measured. The determination system is as follows: 0.05 mol / L Tris-HCl buffer (pH 8.0), 0.01 mol / L substrate, 0.04% 2,6-dichloroindophenol solution, 0.015 mg / mL enzyme solution were added to the 2 mL system, and 1 mL of anhydrous ethanol was immediately added to terminate the reaction after reacting at 30°C for 10 minutes, and the absorbance value A was measured. 600 nm. The results show that Fig.17The inhibition of recombinant Aspergillus niger GZUF36 acetylcholinesterase on omethoate standard solution and dichlorvos standard solution at 30°C can be observed: with the increase of organophosphorus pesticide concentration, the inhibition rate gradually increased, indicating that the detection effect is good, the time is short, and the sensitivity is high; the detection concentration of organophosphorus solution can be as low as 1μg / mL.

[0092] Embodiment 11

[0093] Sensitivity of recombinant Aspergillus niger GZUF36 acetylcholinesterase to carbaryl

[0094] Prepare a series of carbaryl solutions with a concentration gradient of 0, 10 -6 , 10 -5 , 10 -4 , 10 -3 , 10 -2 , 10 -1 , 1, 3, 5, 10 mg / mL, the enzyme solution and the carbaryl solution were mixed in equal proportions and incubated at 30°C for 10 minutes, and the color development after the reaction was observed. The assay system is: in a 2mL system, 0.05 mol / L Tris-HCl buffer (pH8.0), 0.01 mol / L substrate, 0.04% 2,6-dichloroindophenol solution, 0.015 mg / mL enzyme solution was added, and 1 mL of anhydrous ethanol was immediately added to terminate the reaction after reacting at 30°C for 10 minutes. The color development after the reaction was observed, and the darkening of the color indicated that carbaryl had an inhibitory effect on the activity of the recombinant Aspergillus niger GZUF36 acetylcholinesterase. The assay results showed that Fig.18 The inhibition of recombinant Aspergillus niger GZUF36 acetylcholinesterase on carbaryl solution at 30°C can be observed: with the increase of carbaryl concentration, the inhibition rate gradually increases, indicating that the detection effect is good, the time is short, and the sensitivity is high; the detection concentration of carbaryl can be as low as 10 -6 mg / mL.

[0095] These results indicate that the recombinant Aspergillus niger GZUF36 acetylcholinesterase can efficiently detect organophosphorus pesticides and carbaryl.

[0096] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An acetylcholinesterase crystal derived from Aspergillus niger GZUF36, characterized in that: The amino acid sequence of the acetylcholinesterase is shown in SEQ ID NO.2; The acetylcholinesterase crystal structure consists of an asymmetric monomer with a space P3221 and a unit cell parameter of 2. The method for preparing acetylcholinesterase crystals according to claim 1, characterized in that: constructing a recombinant expression strain containing the acetylcholinesterase gene, carrying out selenoprotein culture, and then purifying, concentrating and crystallizing to obtain the acetylcholinesterase crystals; The concentration specifically comprises concentrating the purified acetylcholinesterase to 10 mg / mL; The crystallization conditions are: culturing at 15°C in a buffer solution containing high salt concentration by hanging drop or sessile drop vapor diffusion method; the buffer solution is 2M (NH4)2SO4, 100mM Tris pH 8.5, 100mM HEPES pH 7.5 or 100mM MES pH 6.5.

Images