A CRISPR plasmid and primer design system

Abstract

The present invention discloses a CRISPR plasmid and primer design system, belonging to the field of bioinformatics technology. The present invention discloses a system that allows customers to provide a genome, a CRISPR master vector, and batch design of primers and plasmid maps for multiple targets. In addition to gRNA and quality assessment, the output results also provide primers that can be used to amplify gRNA, homology arms, and vector backbones, identification primers, and plasmid maps that facilitate sequencing data comparison and tracing during subsequent cloning and construction. The present invention overcomes the problem of poor 3' end primer specificity caused by conventional primer design through the Border primer design strategy. The design of complete primers meets the requirements of amplifying the complete target DNA sequence and higher 3' end specificity.

Description

Technical Field

[0001] The present invention relates to a CRISPR plasmid and primer design system, and belongs to the technical field of bioinformatics. Background Art

[0002] CRISPR can be used for gene / genome editing, such as knockout and knock-in of single or multiple targets, quickly and conveniently. When using CRISPR to precisely edit microbial genomes, it is often necessary to construct the CRISPR system and left / right homology arms onto a vector to form a complete CRISPR plasmid, including the vector backbone, expression elements for the Cas protein, expression elements for the gRNA, left / right homology arms, and the sequence to be knocked in (knock-in editing). To achieve efficient CRISPR editing, different hosts require the selection of compatible Cas proteins, the design of gRNAs with appropriate target sequences, and the design of homology arm sequences of appropriate length. Furthermore, the construction of CRISPR plasmids is currently a two-stage process. First, the gRNA is ligated to the plasmid using methods such as PCR, enzyme digestion / ligation, Golden Gate, or Gibson assembly. Then, the left and right homology arms are obtained by chemical synthesis or PCR amplification from the target genome and assembled with the plasmid to form the complete CRISPR plasmid. Finally, colony PCR and DNA sequencing are required to confirm the correctness of the CRISPR plasmid and the edited mutant strains. This complex process is crucial. On the other hand, in recent years, efforts have been underway to develop technologies and equipment that can automate and efficiently complete the design, build, test, and learn (DBTL) steps in synthetic biology through multidisciplinary collaboration. These efforts have led to the development of large-scale "bio-foundries," achieving laboratory automation and higher levels of reproducibility, which has become a long-term goal of synthetic biology. Therefore, automated platforms can be used to conduct high-throughput CRISPR-related research. There are currently existing patents for CRISPR-related technologies, such as: (CN202011546641.9) A method for simultaneously achieving gene editing and transcriptional regulation using a type I CRISPR-Cas system, which mainly uses CRISPR technology for new applications to superimpose the two functions of gene editing and transcriptional regulation; (CN201980052855.X) Amplification methods, systems, and diagnostics based on the CRISPR effector system, which are mainly used to expand the nucleic acid detection scenarios of CRISPR in clinical diagnosis. In addition, some gRNA design software has been developed, such as CHOPCHOP, etc. These software can often only design gRNA for individual genomes and do not involve subsequent plasmid design. Therefore, users still need a lot of time and energy to use other software such as SnapGene to complete the design of plasmid maps, primers, etc., which is inefficient and not suitable for subsequent automation and high-throughput operations.

[0003] There are four main problems with existing technologies: First, it generally only supports gRNA setting for a given genome. For genomes outside the software reference database, the genome cannot be directly uploaded for gRNA design. It needs to be uploaded through the software developer, which is a cumbersome process and inefficient; second, it can only help evaluate the predicted gRNA, but cannot provide the primer and plasmid map information required for constructing CRISPR plasmids. Users need to complete subsequent work through other channels or methods, which is inefficient, time-consuming and labor-intensive, and is not conducive to the construction of subsequent wet experiments; third, gRNA design can only be performed for one target at a time, and it is difficult to design batches of gRNAs, primers and plasmid maps for multiple targets; fourth, existing software is mainly online version, and its use depends on the network.

[0004] CRISPR can be applied to gene editing, as well as basic and applied research such as gene function analysis and metabolic pathway regulation. Construction of CRISPR plasmids requires the design of gRNA, homology arms, primers, plasmid maps, etc. Currently, there is a lack of software that can automatically batch design multiple targets at one time and output necessary information such as gRNA and its quality assessment, primers and their quality assessment, homology arms, plasmid maps, etc. Summary of the Invention

[0005] To address these issues, the present invention contemplates developing a system that allows users to design primers and plasmid maps for multiple targets using a given genome and CRISPR master vector. The system outputs, in addition to gRNA and quality assessment, primers for amplifying gRNA, homology arms, and vector backbones, identification primers, and plasmid maps to facilitate sequencing data alignment and tracing during subsequent cloning and construction. The system is packaged in a GUI for easy user access anytime, anywhere. The present invention aims to develop a CRISPR plasmid and primer design system. To improve system compatibility and enable convenient, one-stop design, we leveraged the open-source code from the online gRNA design software CHOPCHOP and PRIMER3 to implement Python scripting in the Linux operating system for multiple CRISPR plasmid and primer design for a given genome, vector, or single target, as well as batch design of CRISPR plasmids and primers for multiple targets. Target positioning allows for unique locus tag or base position. The CRISPR system supports either Cas9-based or Cpf1-based modes to meet diverse design requirements. Editing options include knockout and knockin. Output files include gRNA and quality assessment, primer and quality assessment, and plasmid maps. The system is packaged in a user-friendly graphical interface (GUI).

[0006] The present invention has developed a CRISPR plasmid and primer design system. The operation of the system includes three stages: data input and parameter setting stage, data processing and analysis stage, and data output stage. Figure 1 shown.

[0007] The present invention provides a CRISPR plasmid and primer design method, the method comprising:

[0008] (1) Obtain the information required to construct the CRISPR plasmid, including the target genome, editing target, linearized vector backbone, gene editing type, gRNA_common_part, gRNA design parameters, and primer design parameters:

[0009] (2) Design and screen gRNA sequences for target genes in the target genome;

[0010] (3) Design and evaluate primers required for constructing CRISPR plasmids;

[0011] (4) Draw a complete plasmid map with annotations of gRNA, gRNA_common_part, knock-in fragment, homology arms, and primer information.

[0012] In one embodiment, the user sets the Cas protein type, PAM sequence, gRNA sequence length, gRNA design algorithm model, gRNA design region, and gRNA positive and negative chains according to needs to design and screen the gRNA sequence.

[0013] In one embodiment, the primers include primers for amplifying upstream and downstream homology arms, primers for amplifying knock-in fragments, primers for amplifying gRNA expression frames, and primers for amplifying linearized vector backbones.

[0014] In one embodiment, an identification primer is also included.

[0015] In one embodiment, the gRNA expression cassette includes gRNA_common_part and gRNA.

[0016] In one embodiment, the primers are designed with or without a Border_Range primer design strategy, wherein:

[0017] Forward primer: Design a primer for amplifying the target fragment within a wide range on the 5' end of the target fragment to obtain an effective primer (Efficientprimer). Then, connect the 5' end of the Efficientprimer to the border sequence (Primer_Border) extending to the 5' end of the target fragment to obtain a complete forward primer;

[0018] Reverse primer: Design a primer for amplifying the target fragment within a wide range on the 3' end of the target fragment to obtain an effective primer. Then connect it to the Primer_Border that extends from the 5' end of the Efficientprimer to the 3' end of the target fragment to obtain a complete reverse primer.

[0019] The wider range is a region >0 bp away from the 5' end or the 3' end of the fragment.

[0020] In one embodiment, when the Border primer design strategy is adopted, the primer sequence consists of "Primer_Border+Efficient_Primer".

[0021] In one embodiment, when the Border primer design strategy is not adopted, the 5' end of the Efficient_Primer is fixed to the end of the target fragment to design the Efficient_Primer primer.

[0022] In one embodiment, when the Border primer design strategy is not adopted, the Efficient_Primer primer is designed in the extension region.

[0023] In one embodiment, the extended region is a region >0 bp extending outside the target fragment.

[0024] In one embodiment, when the Border primer design strategy is adopted, the primer sequence for amplifying the DNA fragment used for homologous recombination further contains an overlapping primer Primer_Overlap, that is, the complete primer consists of "Primer_Overlap+Primer_Border+Efficient_Primer".

[0025] In one embodiment, the Primer_Overlap is a sequence complementary to an adjacent fragment of the DNA fragment.

[0026] In one embodiment, the adjacent fragments include knock-in fragments, downstream homology arms, gRNA_common_part or vector backbone ends.

[0027] In one embodiment, when the gene editing type is gene knock-in, the primer design method for the left and right homologous arms away from the editing target side is: designing primers with a structure shown as "Primer_Overlap+Efficient_Primer"; the "Efficient_Primer" is an effective primer designed in the extension region; for the design of primers on the left and right homologous arms close to the editing target side, a Border primer design strategy is adopted to design a primer sequence with a structure shown as "Primer_Overlap+Primer_Border+Efficient_Primer"; the Efficient_Primer is an effective primer for amplifying the homologous arm; the Primer_Border is a border sequence on the homologous arm that extends the 5' end of the effective primer to the editing target.

[0028] In one embodiment, the adjacent fragments include knock-in fragments, downstream homology arms, gRNA_common_part or vector backbone ends.

[0029] In one embodiment, when the gene editing type is gene deletion, the design method for the primers on the left and right homologous arms away from the editing target site is: designing primers with a structure shown as "Primer_Overlap+Efficient_Primer"; the "Efficient_Primer" is an effective primer designed in the extension region; the design method for the primers on the left and right homologous arms close to the editing target site is: making one of the primers have a structure of "Primer_Overlap+Primer_Border+Efficient_Primer", and the other primer has a structure of "Primer_Border+Efficient_Primer".

[0030] In one embodiment, the Primer_Overlap is a sequence complementary to the adjacent fragment sequence.

[0031] In one embodiment, the adjacent fragments include downstream homology arms, gRNA_common_part or vector backbone ends.

[0032] In one embodiment, the upstream primer of the gRNA expression cassette adopts a Border primer design strategy, and a primer having a structure shown as "Primer_Border+Efficient_Primer" is designed; the "Efficient_Primer" is an effective primer for amplifying gRNA_common_part; the Primer_Border is a border sequence that extends the 5' end of the effective primer to the 5' end of the gRNA_common_part sequence on the gRNA_common_part; the downstream primer of the gRNA expression cassette does not adopt a Border primer design strategy, and a primer having a structure shown as "gRNA+Efficient_Primer" is designed. The 5' end of the Efficient_Primer is directly fixed at the end of the gRNA_common_part to design the Efficient_Primer primer, and the gRNA sequence is added to the 5' end of the Efficient_Primer.

[0033] In one embodiment, the 5' end of the downstream primer of the gRNA expression cassette is further connected to a Primer_Overlap sequence complementary to the end of the linearized vector.

[0034] In one embodiment, the evaluation is a calculation and evaluation of information such as primer length, GC content, Tm value, and PCR product length.

[0035] In one embodiment, the gene editing comprises gene editing of one or more targets.

[0036] The present invention also provides a computer device, which is programmed to execute the steps of the above method, or a storage medium of the computer device stores a computer program programmed to execute the above method.

[0037] The present invention also provides a CRISPR plasmid and primer design system, characterized by comprising an information acquisition module, a gRNA design and evaluation module, a primer design and evaluation module, and a map generation module:

[0038] (1) The information acquisition module is used to obtain the data information required for constructing the CRISPR plasmid;

[0039] (2) The gRNA design and evaluation module designs and screens gRNA sequences for target genes in the target genome;

[0040] (3) The primer design and evaluation module is used to design and evaluate the primers required for constructing the CRISPR plasmid, including primers for amplifying upstream and downstream homology arms, primers for the gRNA expression frame, primers for the vector backbone, and identification primers;

[0041] (4) The map generation module is used to draw a complete plasmid map annotated with gRNA, gRNA_common_part, knock-in fragment, homology arm, and primer information.

[0042] In one embodiment, the data information includes the target genome, editing target, linearized vector backbone file, gene editing type, gRNA design parameters, and primer design parameters.

[0043] In one embodiment, the user sets the Cas protein type, PAM sequence, gRNA sequence length, gRNA design algorithm model, gRNA design region, and gRNA positive and negative chains according to needs to design and screen the gRNA sequence.

[0044] In one embodiment, the gRNA expression cassette includes gRNA_common_part and gRNA.

[0045] In one embodiment, the system includes an online version or an offline version.

[0046] Beneficial effects:

[0047] (1) The present invention develops a CRISPR plasmid and primer design system, which is based on the combination of the open source code of the gRNA online design software CHOPCHOP, python scripts and the open source code of the primer design software Primer3.0. It allows users to give any genome and vector, reduces the restrictions on the user's research objects, allows batch CRISPR design of multiple editing targets, and allows users to provide different forms of editing targets (with unique locus_tags, or base positions). The output results provide gRNA and its quality assessment, primers for plasmid construction and its quality assessment, and facilitate the comparison of sequencing data and traceable plasmid maps during subsequent cloning and construction. It provides a visual operation interface and is easy to use without relying on the network. These advantages can effectively enable users to conduct CRISPR-related research on more different species, and quickly and one-stop provide the primers and plasmid maps required for downstream wet experiments, effectively reducing the work efficiency of scientific researchers and saving time and economic costs. Finally, we provide recommended parameters based on the high efficiency of downstream experiments through dry and wet experiment tests to facilitate user use.

[0048] (2) The present invention proposes a Border primer design strategy for the first time, which overcomes the problem of poor 3'-end primer specificity caused by conventional primer design. By allowing the design of longer primer sequences, high-quality primers with more specific 3' ends are obtained, and the 5' ends of the designed primers are fixed, which can ensure that the complete primers can simultaneously meet the requirements of amplifying the complete target DNA sequence and higher 3'-end specificity, and high-quality fragments have been amplified.

[0049] (3) The present invention has been tested in actual experiments and can accurately realize the design of multiple targets, correctly output multiple gRNAs and their quality assessments, primers, and plasmid maps, and can complete the design of one target within 1 minute. The output data information has been verified by downstream wet experiments and can be efficiently and conveniently used for CRISPR plasmid construction and analysis, etc., which fully proves the feasibility of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 A schematic diagram of the principle of a CRISPR plasmid and primer design system;

[0051] Figure 2 A schematic diagram of a CRISPR plasmid and primer design system;

[0052] Figure 3 A visual interface for a CRISPR plasmid and primer design system;

[0053] Figure 4 This is an example of the output results of a CRISPR plasmid and primer design system: a, target file, b, data output content, c, plasmid map output by the system, d, specific primer information.

[0054] Figure 5 PCR amplification results using primers designed for different methods. DETAILED DESCRIPTION

[0055] the term:

[0056] Overlap sequence (Primer_Overlap): In the present invention, "fragment overlap region", "overlap sequence", "overlap sequence", and "overlap primer" are used interchangeably. The overlapping sequence refers to the complementary sequence of a specified length between the 3' end of the upstream fragment and the 5' end of the downstream fragment, and also refers to the complementary sequence of a specified length between the fragment connected to the vector and the end of the linearized vector.

[0057] Primer prediction range (Border_Range): The primer prediction range refers to a region greater than 0 bp within the polynucleotide being amplified, preferably 40 bp within the 5' and / or 3' ends of the polynucleotide being amplified. In some embodiments of the present invention, effective primer design is performed within the Border_Range. Specifically, effective primer design is performed by starting with the first base at the 5' or 3' end of the polynucleotide and moving inward toward the polynucleotide.

[0058] Effective Primer: A short, single-stranded DNA fragment designed based on the target DNA for amplification and given parameters. When a Border primer design strategy is employed, the complete primer for amplifying the target DNA consists of an effective primer and a primer border, allowing the complete primer to bind to and complement the nucleic acid strand of the template DNA and serve as the starting point for nucleotide polymerization, synthesizing a new nucleic acid strand identical to the 5' end of the target DNA. Optionally, when the fragment amplified by the primer is also used for homologous recombination, the complete primer may also include an overlapping primer.

[0059] Primer Border: Primer border refers to the sequence between the 5' end of the effective primer and the 5' end or 3' end of the fragment used for amplification within the Border_Range region.

[0060] Homology arm: A homology arm refers to a segment of identical sequence between two gene segments. This identical sequence can cross-exchange during the recombination process, thereby achieving segment recombination. In this invention, "left homology arm (LHA)" and "upstream homology arm" are used interchangeably to refer to a segment that is identical or similar to the sequence upstream of the editing target site on the genome; "right homology arm (RHA)" and "downstream homology arm" are used interchangeably to refer to a segment that is identical or similar to the sequence downstream of the editing target site on the genome.

[0061] Extension region (Extend_size): The region larger than 0 bp extending outward from the 5' end of the left homology arm or the 3' end of the right homology arm. Primer3.0 designs effective primers starting from the first base in the extension region along the 5' to 3' direction.

[0062] gRNA: Generally speaking, gRNA (guide RNA) can include crRNA (crRNA includes a spacer region and conserved repeat sequences) and tracrRNA. These two can be integrated into a single RNA strand to form sgRNA (single guide RNA). The gRNA / sgRNA combines with the Cas protein to target specific genomic DNA through the specific complementary pairing between the spacer sequence and the specific genomic DNA. Here, gRNA / sgRNA design for different editing targets mainly refers to the design and screening of the spacer sequence.

[0063] gRNA common part (gRNA_common_part): gRNA common part refers to the part used to initiate gRNA transcription. The spacer sequence is introduced by primers and PCR and co-constructed with the vector backbone to complete the gRNA expression element: using the gRNA common part as a template, PCR amplification is performed using primers containing the gRNA sequence to obtain a gRNA_common_part fragment connected to the gRNA sequence. When the fragment and the homology arm sequence and the knock-in sequence (when the editing mode is knock-in) are further connected to the plasmid, a complete gRNA / sgRNA expression element is obtained (which can be transcribed to produce functional gRNA / sgRNA). This component can be set to: a promoter for initiating gRNA transcription. Those skilled in the art can select and modify the promoter according to conventional technical means.

[0064] Vector: refers to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it has been linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, for example, by standard molecular cloning techniques.

[0065] Cas proteins contain at least one domain that interacts with a guide RNA (gRNA) and possess DNA endonuclease activity. The gRNA guides the Cas protein to the target sequence, cleaving it. Cas can be selected from type II CRISPR-Cas systems, which are single-protein Cas nucleases, such as Cas9 and Cpf1.

[0066] Example 1

[0067] The system consists of four modules: information acquisition module, gRNA design and evaluation module, primer design and evaluation module, and map generation module.

[0068] (1) Information acquisition module: The information acquisition module is used to obtain specific information that needs to be analyzed input by the user, such as target genome, editing target, linearized vector backbone file, gene editing type, gRNA design parameters, and primer design parameters.

[0069] (2) gRNA design and evaluation module, which is used to evaluate and screen potential gRNAs for target genes in the target genome. According to user requirements, the module designs and screens gRNAs that meet the expectations for the target region on the specified genome, provides relevant information about the designed gRNA and quality evaluation, including the gRNA sequence, PAM sequence, specific base position of the gRNA in the genome, and positive and negative strands. At the same time, it analyzes factors that may affect the efficiency of CRISPR, including the GC content of the sequence, self-complementarity, off-target effects, and targeting efficiency.

[0070] In terms of gRNA design rules, users select the Cas protein type according to their needs; fill in the specified PAM sequence; set the length of the gRNA sequence; select the algorithm model for designing gRNA; and select the gRNA design region based on the locus_tag of the target gene in the target genome or the detailed base position information of the target in the target genome. At the same time, users are allowed to design multiple gRNA sequences for a single target and specify gRNA design from the sense chain and / or antisense chain. If the target is located in a non-coding sequence, the sense chain is defaulted to the positive chain of the genome and the antisense chain is defaulted to the negative chain of the genome.

[0071] (3) Primer design and evaluation module, which is used to design primers for PCR amplification of upstream and downstream homology arms, primers for PCR amplification of knock-in DNA fragments, primers for PCR amplification of gRNA_common_part, and CRISPR plasmid identification primers, and calculate and evaluate information such as primer length, GC content, Tm value, and PCR product length. Specifically, it also includes upstream and downstream homology arm primer design modules, knock-in fragment primer design modules, gRNA primer design modules containing overlap, vector backbone primer design modules, and identification primer design modules.

[0072] (a) Upstream and downstream homology arm primer design module:

[0073] When using the CRISPR system to achieve gene knock-in or knock-out, it is necessary to design upstream and downstream homology arms to perform homologous recombination with the target genome, thereby integrating the gene into the editing target site of the target genome or knocking out the editing target site in the target genome. This module is used to design primers for PCR amplification of upstream and downstream homology arms, that is, after determining the specific sequence of the homology arms based on the editing target site and the length of the homology arms specified by the user (Left_Flank / Right_Flank), the homology arm primers are designed ( Figure 2 ).

[0074] When designing primers for the left and right homologous arms away from the editing target (the forward primer for the left homologous arm (LHA) and the reverse primer for the right homologous arm (RHA)), a wide extension region (Extend_size) is given for primer design to obtain high-quality, effective primers. The overlap between the forward primer for LHA and the reverse primer for RHA is the vector backbone end sequence and the left end sequence of the gRNA_common_part of the user-specified length (Overlap_Length);

[0075] When designing primers for the left and right homology arms near the target site, given that the sequences of the left and right homology arms near the target site are determined by the editing target site, the 5' ends of the LHA reverse primer and the RHA forward primer cannot be changed arbitrarily. Two types of primer design are performed according to the user's choice: (1) To design high-quality primers with high specificity, a relatively wide primer prediction range (Border_Range) is given to design effective primers (Efficient_Primer). The 5' end of the designed effective primer is filled to the sequence of the editing target site, which is called the border sequence (this additional filled sequence is called the primer boundary, i.e., Primer_Border). In addition, an overlap sequence (Primer_Overlap) for subsequent DNA fragment assembly is added to form a complete LHA reverse primer and RHA forward primer, i.e., Primer_Overlap+Primer_Border+Efficient_Primer (5'-3'). When the editing type is knockout, the RHA forward primer does not contain the overlap sequence, i.e., Primer_Border+Efficient_Primer (5'-3'). This primer design method can ensure high specificity at the 3' end sequence, thereby improving the success rate of downstream PCR amplification, while ensuring that the expected sequences of the left and right homology arms close to the target side remain unchanged. The primer prediction range (Border_Range) is selected by the user, and the default value is 40nt, which is a recommended value based on the comprehensive consideration of primer synthesis cost and effective overlap length; (2) If Border_Range is not filled in, it means that the primer design strategy of adding Primer_Border is not used. At this time, the primer design close to the target side is to fix the 5' end of the primer at the end of the homology arm or the end of the knock-in fragment to design an effective primer (Efficient_Primer), and then add an overlapping sequence (Primer_Overlap) to the 5' end of the effective primer to form a complete primer, namely Primer_Overlap + Efficient_Primer (5'-3'), which is used for recombinant plasmid construction.

[0076] The overlap sequence of the reverse primer of LHA and the forward primer of RHA is the knock-in fragment sequence of the user-specified length (Overlap_Length) (the editing type is knock-in, Knock-in) or the end of the other homology arm (the editing type is knock-out, Knock-out, in this case there is no knock-in fragment, and the left and right homology arms are directly connected).

[0077] (b) Knock-in fragment primer design module

[0078] Used to design primers for PCR amplification of knock-in DNA fragments. Use the primer design strategy of adding Primer_Border, that is, a relatively broad primer prediction range (Border_Range) is given for the knock-in DNA fragment to design an effective primer (Efficient_Primer), and the 5' end of the designed effective primer is filled to the end of the knock-in DNA fragment. The sequence is called the border sequence (Primer_Border), and the effective primer and the border sequence are connected to form a complete primer Primer_Border+Efficient_Primer (5'-3'). The complete knock-in DNA fragment can be amplified using this primer pair. It should be noted that the primers of the knock-in fragment do not have an overlap region, and the assembly between the homology arms on both sides and the knock-in DNA fragment is achieved by the overlap on the left and right homology arms.

[0079] (c) gRNA expression cassette primer design module:

[0080] Primers used to design gRNA_common_part and introduce gRNA are designed based on the gRNA_common_part sequence and the gRNA passed in by the gRNA design and evaluation module. The forward primer to the left of the gRNA expression frame is designed using the primer design strategy with Primer_Border added. A relatively broad primer prediction range (Border_Range) is given for gRNA_common_part to design an effective primer (Efficient_Primer). The 5' end of the designed effective primer is filled to the 5' end of the gRNA_common_part sequence, which is called the border sequence (Primer_Border). The effective primer and the border sequence are connected to form a complete primer Primer_Border+Efficient_Primer (5'-3'), which is the final primer (the gRNA_common_part forward primer does not contain the overlap region and is reversed by the right homology arm). The overlap introduced into the primer realizes the connection between RHA and gRNA_common_part); the primer design strategy of adding Primer_Border is not adopted for the design of the reverse primer of the gRNA expression cassette. The 5' end of the primer is directly fixed to the 3' end on the right side of gRNA_common_part to design the effective primer (Efficient_Primer). Then, a python script is used to process it, that is, the overlap homologous to the end of the linearized vector and the gRNA sequence introduced by the gRNA design and evaluation module are added to the 5' end of the effective primer (Efficient_Primer) to splice it into a complete primer sequence of Primer_Overlap+gRNA+Efficient_Primer (5'-3').

[0081] (d) Vector backbone primer design module:

[0082] Primers used to design PCR amplification to obtain linearized vector backbones use a primer design strategy that incorporates Primer_Border. Effective primers are designed based on a relatively broad primer prediction range (Border_Range) for the vector backbone, and the border sequence (Primer_Border) between the 5' end of the effective primer and the vector end constitutes a complete primer Primer_Border+Efficient_Primer (5'-3'). The reverse primer to the right of the gRNA_common_part adjacent to the vector end and the forward primer of LHA have already been designed with an overlap region, so the vector primer no longer needs to incorporate Primer_Overlap. The overlap on the gRNA and the overlap on the LHA enable assembly between the vector backbone and the fragment containing the upper and lower homologous arms and gRNA. (e) Identification of primer design modules

[0083] This module includes two functions: one is to design primers to determine whether the constructed CRISPR plasmid is correct, which can be used for colony PCR, DNA sequencing, etc.; the other is to design primers to determine whether the gene editing of the target host is successful, which can be used for colony PCR, DNA sequencing, etc. Primer3.0 is used to design identification primers and output information such as primer sequence, length, GC content, Tm value, primer type, template, and PCR product length. The primer design method is:

[0084] When the gene editing type is knock-in,

[0085] The primer design method for knock-in CRISPR plasmid identification is as follows: primers are designed for the range of 200 to 300 bp on both sides of each of the following junctions, including the junction between the vector fragment and the left homology arm, the junction between the vector fragment and the right homology arm, the junction between the knock-in fragment and the left homology arm, and the junction between the knock-in fragment and the right homology arm;

[0086] The method for designing primers for knock-in CRISPR gene editing identification is as follows: primer pairs are designed within the 200 bp region on the genome upstream of the left homology arm and the 200 bp region near the 5' end of the knock-in fragment, and within the 200 bp region near the 3' end of the knock-in fragment and the 200 bp region on the genome downstream of the 3' end of the right homology arm.

[0087] When the gene editing type is knockout,

[0088] The primer design method for identifying knockout CRISPR plasmids is as follows: primers are designed for the 200-300 bp range on both sides of the following junctions: the junction between the vector fragment and the left homology arm, the junction between the vector fragment and the right homology arm, and the junction between the left homology arm and the right homology arm;

[0089] The method for designing primers for knockout CRISPR gene editing identification is as follows: primer pairs are designed within the 200 bp region on the genome upstream of the left homology arm and the 200 bp region near the 5' end of the right homology arm, and within the 200 bp region on the genome near the 3' end of the left homology arm and the 200 bp region on the genome downstream of the right homology arm.

[0090] (4) A map generation module is used to simulate the complete gene knock-in plasmid after the gRNA_common_part, upstream and downstream homology arms, knock-in fragments and vector backbone are connected, and draw a complete plasmid map, which is annotated with information such as homology arms, knock-in fragments, gRNA_common_part, gRNA, primers, etc. Alternatively, it is used to simulate the complete gene knock-out plasmid after the gRNA_common_part, upstream and downstream homology arms are connected to the vector backbone, and draw a complete plasmid map, which is annotated with information such as homology arms, gRNA, gRNA_common_part, primers, etc.

[0091] Example 2

[0092] The operation of the system includes three stages: data input and parameter setting stage, data processing and analysis stage, and data output stage. Figure 1 As shown, the system operation process is as follows.

[0093] (1) During the data input and parameter setting stage:

[0094] S001 user defines the input file and sets the parameters;

[0095] Custom input files include

[0096] (a) Target genome file (Genome), which allows users to upload genome files locally or enter NCBIAssembly Accession IDs. The uploaded genome files are stored on the server to form a target database.

[0097] (b) CRISPR linearized vector backbone file (Vector), allowing users to upload linearized vector backbone files, and the uploaded linearized vector backbone files are saved in the server to form a linearized vector backbone database; users are allowed to select the target vector backbone file from the linearized vector backbone database;

[0098] (c) Target file (Configure), target file refers to the file containing target editing information, target editing type, knock-in fragments, etc. Target information includes the name of the genome where the target is located (ChrID), target name (GeneID), base position of the target on the genome (Stard, End), positive and negative chains (Strand); target editing types include knockout and knock-in; knock-in fragment (Sequence) is the DNA sequence introduced into the target by replacing the original sequence at the target when the editing type is knock-in, allowing users to upload target files, and the uploaded target files are saved on the server to form a target database; allowing users to select target files from the target database. The target file is a table-delimited text file, which can be a unique locus_tag ( Figure 4 a), or a specific base position ( Figure 4 a), and target design can be batch.

[0099] (d) gRNA common part (gRNA_common_part), which refers to the part used to initiate gRNA transcription.

[0100] The parameters set in S002 include gRNA design and primer design parameter settings;

[0101] (A) Parameter settings for gRNA design

[0102] 1) Cas protein type (Model);

[0103] 2) PAM sequence (PAM);

[0104] 3) gRNA length (Spacer_Len);

[0105] 4) Design the positive and negative strands of gRNA (gRNA_Strand);

[0106] 5) The number of gRNAs designed for each target site (gRNA_Num);

[0107] 6) Design and evaluate the algorithm model for gRNA quality (Algorithm);

[0108] 7) Whether to count the GC content of gRNA (Score_GC)

[0109] 8) Maximum number of off-targets in gRNA genome alignment (Max_Off_Targets);

[0110] 9) The maximum number of mismatches allowed when gRNA is aligned with the genome (Max_Mismatches);

[0111] (B) Parameter settings for homology arm and primer design

[0112] 1) Length of the left and right homology arms (Left_Flank / Right_Flank);

[0113] 2) the extension region of the left and right homology arms (Extend_size);

[0114] 3) Target site Feature type gene\CDS (Target_type) in Genbank;

[0115] 4) Allows users to set the following parameters: minimum effective primer length (Min_Len), maximum primer length (Max_Len), optimal primer length (Opt_Len), minimum GC content (Min_GC), maximum GC content (Max_GC), optimal GC content (Opt_GC), monovalent ion concentration in PCR reaction system (Mv_Conc, mM), divalent ion concentration in PCR reaction system (Dv_Conc, mM), dNTP concentration in PCR reaction system (dNTP_Conc, mM), DNA concentration in PCR reaction system (DNA_Conc, nM), Tm value calculation method (Tm_Method), minimum Tm value (Min_Tm), maximum Tm value (Max_Tm), optimal Tm value (Opt_Tm), maximum Tm difference between paired primers (Max_Diff_Tm), maximum number of repeated bases allowed at the 3' end of the primer (Max_PolyX), and maximum number of primer pairs returned (Prim_Num);

[0116] 5) Length of primer overlap region (Primer_Overlap);

[0117] 6) The range of effective primers predicted in the Border primer design strategy (Border_Range);

[0118] Select the genome file in step (a) of S001, the linearized vector backbone file in step (b), the target file of the target gene in step (c), and the gRNA universal component in step (d). Based on the parameters set in step S002, fill in the compressed file name of the result output and click RUN to perform data processing and analysis.

[0119] (2) Data processing and analysis stage

[0120] S003 gRNA design, gRNA evaluation and screening using CHOPCHOP and python scripts

[0121] CHOPCHOP and Python scripts are used to evaluate and screen gRNAs. In this stage, gRNAs are designed based on the genome file of S001 and the parameters set by the user of S002. Three gRNAs are designed by default. Relevant information and quality assessment of the designed gRNAs are provided, including the gRNA sequence, PAM sequence, specific base position of the target gene, and positive and negative strands. An algorithm model is used to analyze GC content, self-complementarity, off-target effects, and targeting efficiency.

[0122] CHOPCHOP was used to design gRNA according to the parameters set by the S002 user and the design rules provided by CHOPCHOP.

[0123] Use a Python script to locate the target of the target gene based on the target file provided in S001. Use the locus_tag name of the gene or the detailed base position information of the target on the genome to locate the target. Use a Python script to select the gRNA that meets the requirements based on the parameters set by the user in S002, including the number of gRNAs and the positive and negative strands of the designed gRNA.

[0124] The algorithm model is a built-in module of CHOPCHOP, which uses the algorithm model to analyze the GC content, self-complementarity, off-target effect, and targeting efficiency of the gRNA sequence.

[0125] For the design of upstream and downstream homology arms of S004, a python script was used to determine the homology arm sequences based on the genome file of S001, the target site file based on the target gene (Configure), and the length of the homology arm specified by the user (Left_Flank / Right_Flank).

[0126] Design of upstream and downstream homology arm primers of S005. Use python script and Primer3.0 to realize the design of upstream and downstream homology arm primers. For the design of forward primer of LHA and reverse primer of RHA, based on the CRISPR linearized vector backbone file (Vector) provided by S001, gRNA_common_part file, extension region (Extend_size) given by the user in S002 and primer design parameters given by the user of S002, the python script is used to confirm the sequence within the Extend_size range, and effective primers (Efficient_Primer) are designed through Primer3.0. Use python script to connect the vector backbone end sequence as primer overlap region (Primer_Overlap) to the 5' end of the effective primer of LHA, and connect the sequence at the left end of the gRNA_common_part sequence passed in by S001 as primer overlap region (Primer_Overlap) to the 5' end of the effective primer of RHA.

[0127] For the design of reverse primers for LHA and forward primers for RHA, according to the sequence of the knock-in fragment provided in the target file provided by S001, the CRISPR linearized vector backbone file (Vector), the primer prediction range (Border_Range) given by the user in S002, and the primer design parameters given by the user in S002, effective primers (Efficient_Primer) were designed by Primer3.0. Then, the 5' end of the effective primer was filled to the editing target (border sequence, Primer_Border) using a python script, and the overlap sequence (Primer_Overlap) was added. The complete primer is Primer_Overlap + Primer_Border + Efficient_Primer (5'-3'). If the user does not specify a primer prediction range (Border_Range) in S002, a Python script is used to fix the 5' end of the primer to the end of the homology arm or the end of the knock-in fragment to design an effective primer (Efficient_Primer). Then, a primer overlap region (Primer_Overlap) is added to the 5' end of the effective primer to form a complete primer, Primer_Overlap + Efficient_Primer (5'-3'). The overlap sequence of the reverse primer of LHA and the forward primer of RHA is the knock-in fragment sequence (if the editing type is knock-in) or the end of the other homology arm (if the editing type is knockout, in this case there is no knock-in fragment, so the left and right homology arms are directly connected).

[0128] The design of S006 knock-in fragment primers, using python script and Primer3.0 to realize the design of knock-in fragment primers, using the primer design strategy adding Primer_Border. According to the sequence of the knock-in fragment provided in the target file provided by S001 and the primer prediction range (Border_Range) given by user in S002, under the primer design parameters given by S002 users, effective primers (Efficient_Primer) are designed by Primer3.0, then the 5 ' end of effective primer is padded to the end (border sequence, Primer_Border) of knock-in fragment using python script, complete primer Primer_Border+Efficient_Primer (5'-3') is formed. Python script is used to confirm the sequence of Border_Range scope, and effective primers (Efficient_Primer) are designed by Primer3.0, and python script is utilized to confirm Primer_Border and generate complete primer Primer_Border+Efficient_Primer (5'-3').

[0129] Primer design of S007 gRNA expression cassette, using Primer3.0 and python script to implement primer design of gRNA expression cassette

[0130] Use Python scripts and Primer3.0 to design primers for overlapping gRNA expression cassettes, which include gRNA_common_part and gRNA. For the design of the gRNA expression cassette forward primer, use the Border primer design strategy based on the gRNA_common_part sequence passed in S001 and the primer design parameters given by the user in S002. Use Python scripts to select the region for primer design based on the primer prediction range (Border_Range). Use Primer3.0 to design effective primers. Then use Python scripts to fill the 5' end of the effective primer to the end of the gRNA_common_part (border sequence, Primer_Border), forming a complete primer Primer_Border + Efficient_Primer (5'-3'), resulting in the forward primer for gRNA_common_part. For the design of the reverse primer of the gRNA expression cassette, the Border primer design strategy was not used. The 5' end of the primer was directly fixed at the end of the gRNA_common_part and the effective primer (Efficient_Primer) was designed using Primer3.0. Then, the gRNA sequence introduced by S003 was added to the 5' end of the effective primer using a python script, and the overlap (Primer_Overlap) homologous to the end of the linearized vector was spliced ​​into Primer_Overlap+gRNA.

[0131] +Complete primer sequence of Efficient_Primer (5'-3').

[0132] Design of S008 vector primers: Use python scripts and Primer3.0 to design vector backbone primers. According to the CRISPR linearized vector backbone file in S001 and the primer design parameters given by the user in S002, use python scripts to select the region for designing primers according to the primer prediction range (Border_Range). Then use Primer3.0 to design effective primers and give the primer Tm value, GC content, and length. Then use python scripts to fill the 5' end of the effective primer to the end of the linearized vector (border sequence, Primer_Border) to form a complete primer Primer_Border+Efficient_Primer (5'-3').

[0133] S009 identification primer design: Based on the genome file, target file, CRISPR linearized vector backbone file of S001 and the primer design parameters given by the user in S002, Primer3.0 is used to output the identification primers, including the information of CRISPR plasmid identification primers and genome editing identification primers. The effective primer (Efficient_Primer) output by Primer3.0 is the final primer, including primer sequence, length, GC content, Tm value, PCR product length, etc.

[0134] The splicing of the S0010 plasmid map was achieved through a python script, including the gRNA designed by S003, the upstream and downstream homology arms designed by S004, the gRNA_common_part in S001, the knock-in fragment in S001, and the complete plasmid after connecting with the vector backbone in S001, drawing a complete plasmid map. The plasmid map is annotated with homology arms, knock-in fragments, gRNA, and primer information introduced by S005 to S009.

[0135] (3) Data output stage

[0136] During the data output stage, the processing results can be directly output to a local specified path.

[0137] The output mainly includes:

[0138] 1) gRNA_result is the gRNA prediction result, and gRNA.conf is the specific gRNA sequence information;

[0139] 2) input is the original input data;

[0140] 3) KO_Primer is the primer information result of the final construction of the plasmid, of which KO_Final_PrimerSeq.xlsx summarizes the results;

[0141] 4) pKO_plasmid is the vector map;

[0142] 5) Check_Primer is the result of primer identification;

[0143] 6) Primer3_out is the primer prediction result, and Primer.conf is the specific primer sequence information;

[0144] 7) KO_HRA_Fragment is the sequence information of the homology arm.

[0145] Example 3

[0146] This example uses the design of a CRISPR plasmid for knocking out a target gene in E. coli BL21 as an example to test the effectiveness of the software. Targets ECO_2361, ECO_2362, ECO_2363, and ECO_2364 were edited, with the edit types being knockout and knockin, respectively. Target ECO_2361 was directly located based on locus_tag (gene), while the remaining targets were edited with precise base positions and positive and negative strand information rather than the entire gene sequence (see Figure 4 a). Upload the target genome file Genome related to E. coli BL21, the CRISPR linearized vector backbone file Vector, the target site file Configure based on the target gene, and the gRNA common component file gRNA_common_part. In the parameter settings, select the Cas9 protein type as Model, and use the default parameters for the other parameters. Select the output path outdir and click RUN. The software runs successfully and outputs the results (see Figure 4 b), including homology arm sequence information (stored in the KO_HRA_Fragment folder), final primer information (stored in the KO_Primer folder, where the results of KO_Final_PrimerSeq.xlsx are summarized in Figure 4 c), plasmid construction primer prediction results (stored in the Primer3_out folder), gRNA prediction results (stored in the gRNA_result folder), identification primer prediction results (stored in the Check_Primer folder), original input data (stored in the input folder), plasmid map (stored in the pKO_plasmid folder, see Figure 4 d).

[0147] Example 4

[0148] This example uses the plasmid designed to knock out the target genes SVEN_0276 and SVEN_0279 of Streptomyces venezuelae ISP5230 as an example to test the effect of the Border_Range primer design strategy. During the parameter setting stage, upload the Streptomyces venezuelae ISP5230 genome file (SVEN_ISP5230.gb) in "Genome", the vector file (pKC1132_batchA_linear.gb) in "Vector", the gRNA common component file in "gRNA_common_part", and the target information file (SVEN_without_border.txt and SVEN_with_border.txt) in "Configure". Fill in 0 (indicating that the Border strategy is not used) and 40 for Border_Range respectively, and use the default parameters (such as Figure 3 ), select the output path outdir and click RUN. The software runs successfully and outputs the results. From each of the two output folders, select the primers for amplifying the left homology arm:

[0149] Primers designed using conventional primer design software without using the Border design strategy:

[0150] Forward primers for the left homology arm of the plasmids editing targets SVEN_0276 and SVEN_0279:

[0151] SIAT-717: CGTATTCAGAGTATTTGTCGGCCCTGGCGGCGGGGCGC;

[0152] SIAT-718: CGTATTCAGAGTATTTGTCGCCCCTCCAGGCCCCGCGC;

[0153] Reverse primers for the left homology arm of the plasmid editing targets SVEN_0276 and SVEN_0279:

[0154] SIAT-722: AGAAGTAGTATGAGATCGACCCGGCGTCGACGACGCAC;

[0155] SIAT-723: GCATGATCTTCTCTTCGAATTCACGGCTTTACCGGACATG.

[0156] Using the system provided in Example 1, primers designed using the Border design strategy were:

[0157] Forward primers for the left homology arm of the plasmids editing targets SVEN_0276 and SVEN_0279:

[0158] SIAT-727: CGTATTCAGAGTATTTGTCGGAACGTGACCTGACCCCGGCTCCTC;

[0159] SIAT-728: CGTATTCAGAGTATTTGTCGACCCCGTCCCACACCCCTTCGCGAAG;

[0160] Reverse primers for the left homology arm of the plasmid editing targets SVEN_0276 and SVEN_0279:

[0161] SIAT-732: AGAAGTAGTATGAGATCGACCCGGCGTCGACGACGCACCAGGC;

[0162] SIAT-733: GCATGATCTTCTCTTCGAATTCACGGCTTTACCGGACATGCGGCTCTCCT;

[0163] The above primers were submitted to the company for synthesis (Qingke Biotechnology) and used for PCR amplification to verify the effect. The primer pair SIAT-717 and SIAT-722 amplified fragment F1 with a length of 2140 bp; the primer pair SIAT-718 and SIAT-723 amplified fragment F2 with a length of 2140 bp; the primer pair SIAT-727 and SIAT-732 amplified fragment F3 with a length of 2098 bp; the primer pair SIAT-728 and SIAT-733 amplified fragment F4 with a length of 2114 bp.

[0164] The PCR reaction system is as follows:

[0165] ddH2O: 20.5 μL;

[0166] Upstream primer / downstream primer (10 μM): 2 μL;

[0167] Template (S. venezuelae ISP5230 genome, 102 ng / μL): 0.5 μL;

[0168] 2×Phanta mix: 25 μL;

[0169] Total system: 50 μL.

[0170] The reaction conditions were: 95°C, 3 min; [95°C, 15 s; 60°C, 15 s; 72°C, 1 min] × 32 cycles; 72°C, 5 min; 4°C, hold.

[0171] After the reaction, 5 μL of the reaction solution was taken from each sample for agarose gel electrophoresis analysis. Figure 5 As shown in the results, the band brightness and specificity of fragments F3 and F4 amplified using primers designed using the Border design strategy are significantly stronger than those of F1 and F2 amplified using primers not designed using the Border design strategy. This result fully demonstrates that the Border design strategy proposed by the present invention for primer design can significantly improve primer quality and facilitate the acquisition of high-concentration and specific PCR products.

[0172] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A method for designing CRISPR plasmids and primers, characterized in that: The method comprises: (1) Obtain the information required to construct the CRISPR plasmid, including the target genome, editing target, linearized vector backbone, gene editing type, gRNA_common_part, gRNA design parameters, and primer design parameters: (2) Design and screen gRNA sequences for target genes in the target genome; (3) Design and evaluation of primers required for constructing CRISPR plasmids; (4) Draw a complete plasmid map with annotations of gRNA, gRNA_common_part, knock-in fragment, homology arms, and primer information; The primers are designed with or without the Border_Range primer design strategy, wherein: Forward primer: Design a primer for amplifying the target fragment within a wide range on the 5' end of the target fragment to obtain an effective primer. Then, ligate the primer with the Primer_Border sequence that extends from the 5' end of the effective primer to the 5' end of the target fragment to obtain a complete forward primer. Reverse primer: Design a primer for amplifying the target fragment within a wide range on the 3' end of the target fragment to obtain an effective primer. Then, connect it to the Primer_Border that extends from the 5' end of the effective primer to the 3' end of the target fragment to obtain a complete reverse primer. The wider range is a region >0 bp away from the 5' end or the 3' end of the fragment.

2. The method according to claim 1, characterized in that Users design and screen gRNA sequences by setting the Cas protein type, PAM sequence, gRNA sequence length, gRNA design algorithm model, gRNA design region, and gRNA positive and negative chains according to their needs.

3. The method according to claim 1, characterized in that The primers include primers for amplifying upstream and downstream homology arms, primers for amplifying knock-in fragments, primers for amplifying gRNA expression frames, and primers for amplifying linearized vector backbones; optionally, identification primers are also included; the gRNA expression frame includes gRNA_common_part and gRNA.

4. The method according to claim 1 or 3, characterized in that When the Border primer design strategy is used, the primer sequence consists of "Primer_Border + Efficient_Primer". When the Border primer design strategy is not used, the 5' end of the Efficient_Primer is fixed to the end of the target fragment for the Efficient_Primer primer design; or, the Efficient_Primer primer is designed in the extension region, which is the region >0 bp extending outside the target fragment.

5. The method according to claim 1 or 3, characterized in that The upstream primer of the gRNA expression cassette adopts the Border primer design strategy; the downstream primer of the gRNA expression cassette does not adopt the Border primer design strategy. A primer with the structure shown as "gRNA+Efficient_Primer" is designed, and the 5' end of the Efficient_Primer is directly fixed to the end of the gRNA_common_part to design the Efficient_Primer primer, and the gRNA sequence is added to the 5' end of the Efficient_Primer.

6. The method according to claim 1 or 3, characterized in that The editing target is a single target or multiple targets; optionally, the editing target is a unique locus_tag or base position.

7. A system for designing CRISPR plasmids and primers, characterized in that: Including information acquisition module, gRNA design and evaluation module, primer design and evaluation module, map generation module: (1) The information acquisition module is used to obtain the data information required for constructing the CRISPR plasmid; (2) The gRNA design and evaluation module designs and screens gRNA sequences for target genes in the target genome; (3) The primer design and evaluation module is used to design and evaluate the primers required for constructing the CRISPR plasmid, including primers for amplifying upstream and downstream homology arms, primers for gRNA, primers for the vector backbone, and identification primers; (4) The map generation module is used to draw a complete plasmid map with annotations of gRNA, gRNA_common_part, knock-in fragment, homology arm, and primer information; the primer design adopts or does not adopt the Border_Range primer design strategy, and the Border_Range primer design strategy: Forward primer: Design a primer for amplifying the target fragment within a wide range on the 5' end of the target fragment to obtain an effective primer. Then, ligate the primer with the Primer_Border sequence that extends from the 5' end of the effective primer to the 5' end of the target fragment to obtain a complete forward primer. Reverse primer: Design a primer for amplifying the target fragment within a wide range on the 3' end of the target fragment to obtain an effective primer. Then, connect it to the Primer_Border that extends from the 5' end of the effective primer to the 3' end of the target fragment to obtain a complete reverse primer. The wider range is a region >0 bp away from the 5' end or the 3' end of the fragment.

8. The system according to claim 7, characterized in that: Available in online or offline versions.

9. A computer device, characterized in that: The computer device is programmed to perform the steps of the method according to any one of claims 1 to 6, or the storage medium of the computer device stores a computer program programmed to perform the method according to any one of claims 1 to 6.

Images