Preparation method and application of high-bioactivity cyclic peptide

Abstract

The application provides a preparation method and application of a high-bioactivity cyclic peptide. The application first synthesizes a short peptide sequence or fragment, and then catalyzes the cyclic peptide by using a directional mutant enzyme as a cyclase, so that the preparation method has high yield, is easy to purify, can obtain a high-purity cyclic peptide product, and is suitable for large-scale industrial production. The application provides the enzyme for preparing the cyclic peptide, designs a sequence, and mutates the sequence directionally, so that four mutant enzymes with outstanding effects are obtained, and the best mutant enzyme is found. The innovative preparation method and the enzyme with the directional design of the mutant make the prepared cyclic peptide have high bioavailability, has the effects of anti-photoaging and anti-wrinkle, has the performances of anti-enzymolysis and high skin permeability, and the performances make the effects more remarkable. The cyclic peptide is mainly applied to toners, masks, essences, emulsions, creams, and freeze-dried powders in the field of cosmetics and skin care, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the fields of chemical synthesis and bioengineering technology, and in particular to a method for preparing and applying a highly bioactive cyclic peptide, specifically a method for preparing a collagen small molecule cyclic peptide and its application in the anti-aging effects of cosmetics and skincare. Background Technology

[0002] Cyclic peptides (or cyclic peptides) are a type of polypeptide. The simplest cyclic peptide is formed by the reaction of two terminal groups to form a peptide bond, thus closing the peptide backbone. Other cyclic peptides form covalent bonds between their terminal amine and side chains, between their terminal carboxyl group and side chains, or between two side chains, resulting in a partially cyclic peptide molecule. Cyclic peptides have many advantages over conventional peptides, such as insensitivity to exopeptidases and greater stability than their linear counterparts. Due to the curvature and lower degrees of freedom of their backbone, many bond rotations are blocked, resulting in more side chains that can interact with external targets, increased interaction strength with their targets, and no interference from adjacent amino acids. Compared to linear peptides, they have higher bioavailability and are widely used in medicine and biology. In recent years, scientists have confirmed that cyclic peptides have long in vivo half-lives, relatively stable structures, and strong permeability. Therefore, topical products containing cyclic peptides can provide certain care, defense, and anti-aging effects, making the development of cyclic peptides for use in the beauty and skincare field both innovative and practical.

[0003] The synthesis of cyclic peptides follows the same methods as current peptide synthesis, which is mainly divided into chemical synthesis and biosynthesis. Classical chemical peptide synthesis methods include liquid-phase peptide synthesis (LPPS) and solid-phase peptide synthesis (SPPS). For example, using a solid or liquid medium, peptide chains are added sequentially to synthetic intermediates, i.e., the construction of amide functional groups. In this preparation method, the functional groups of amino acids that are not desired to participate in the reaction are protected, followed by sequential chemical coupling, and finally deprotection. This chemical synthesis method is suitable for the synthesis of short chains such as dipeptides and tripeptides. However, for the synthesis of longer polypeptide chains, it suffers from problems such as numerous reaction steps, many byproducts and intermediates, low overall yield, the presence of racemic mixtures, and high purification costs. Currently, many strategies for constructing cyclic peptides have been developed, such as Cu-catalyzed alkynyl [3+2] cycloaddition, Ru-catalyzed olefin metathesis, Pd-catalyzed arylation of cysteine ​​(Cys SH) and lysine (Lys NH2), metal-free catalytic disulfide bond formation, oxadiazole formation, and the Petasis-borono-Mannich reaction. The drawbacks of these strategies include the need to introduce non-natural amino acids, the need for transition metal catalysis, and the need for non-aqueous solvents.

[0004] Biosynthesis primarily utilizes protein expression or gene recombination within biological systems to express peptide fusion proteins within the host, followed by protein purification and peptide release to obtain the target peptide. This method is unaffected by peptide length and sequence, allowing for simple and efficient peptide synthesis with few byproducts. However, biosynthesis requires strain disruption and protein purification, increasing production costs and limiting the scale of synthesis. Currently, its application is highly targeted, limited by the synthesis of peptides from natural amino acids. Biotechnology, particularly enzyme-catalyzed amide bond construction for peptide synthesis, offers a more economical and environmentally friendly strategy. Unlike chemical methods, the regioselectivity and stereoselectivity of enzymatic peptide linking stem from the steric hindrance of the enzyme's active site and non-covalent interactions between groups, satisfying the fundamental requirements of regioselectivity and inhibition of racemic mixing in peptide splicing. This makes it increasingly important in the field of peptide and protein synthesis.

[0005] Natural polypeptide compounds synthesized by bacteria or fungi through their own metabolism, such as penicillin, cyclosporine, and echinocandins, are an important source of new drug discovery both domestically and internationally. Their biosynthetic pathways fall into two categories: one involves the condensation, modification, and cyclization of ribosomally derived polypeptides; the other involves the assembly of natural or non-natural amino acids one by one by a highly modular non-ribosomal polypeptide synthase (NRPS). This mechanism combines high efficiency and flexible specificity, ensuring the diversity of natural polypeptide product structures (DOI:10.12211 / 2096-8280.2020-064). For example, researchers discovered the asparagine / aspartate (Asx) peptide ligase—butelase 1. This highly efficient enzyme was isolated from the cyclic peptide-producing medicinal plant *Clitoria ternatea*. Butelase 1 shares 71% sequence identity and the same catalytic triplet with the legumain protease, but does not hydrolyze the legumain protease substrate. Conversely, butenase 1 cyclizes various peptides from plant and animal sources with yields greater than 95%. Butenase 1 has a catalytic efficiency as high as 542000 M. -1 s -1Butelase 1 is the fastest known peptide ligase. Notably, butelase 1 also exhibits broad specificity for the N-terminal amino acids of peptide substrates, thus providing a new tool for C-terminal-specific intermolecular peptide ligation. (Nguyen, Giang KT; Wang, Shujing; Qiu, Yibo; Hemu, Xinya; Lian, Yilong; Tam, James P (2014). Butelase 1 is an Asx-specific ligase enabling peptide macrocyclization and synthesis. Nature Chemical Biology, 10(9), 732–738.)

[0006] In addition, ATP-grasp enzymes (ATP-dependent carboxylic acid-amine ligases) are good candidates for the synthesis of short oligopeptides. ATP-grasp enzymes are widely distributed in nature and catalyze the formation of amide bonds by activating carboxylic acids as acyl phosphate intermediates, accompanied by ATP hydrolysis. Within the ATP-grasp superfamily, L-amino acid ligases (Lals: EC 6.3.2.28) can accept two unprotected L-amino acids as their optimal substrates to catalyze peptide biosynthesis in an ATP-dependent manner. This reaction is unidirectional; furthermore, no complex substrate protection or derivatization procedures are required.

[0007] Collagen in the skin is closely related to skin aging. The peptide with the sequence Pro-x-Gly Pro is a homologous sequence fragment of collagen, with a low molecular weight, enabling it to effectively penetrate the stratum corneum and dermis. Therefore, it is widely used in skin care products for moisturizing, anti-wrinkle, repair, and breast enhancement. However, this small collagen molecule is easily recognized and hydrolyzed by the body's proteases, greatly reducing its bioavailability. Cyclic modification can significantly improve its stability and bioavailability. Simultaneously, it increases the complexity of its spatial structure and specific surface area, providing more opportunities for contact with target sites, resulting in more diverse and multi-dimensional enhancements in efficacy. A search of Chinese invention patent application CN 111670027 A discloses the use of cyclic peptides in cosmetics, confirming their application in the field of beauty and skincare. Regarding the synthesis and preparation of cyclic peptides, Chinese patent application No. 202210368579.1 discloses a method for preparing cyclic hexapeptides. This method involves traditional solid-phase synthesis of long-chain linear peptides, followed by cyclization using a chemical condensing agent, and finally separation and purification to obtain the relevant cyclic hexapeptides and their derivatives. However, the solid-phase synthesis method described in this application has relatively limited yields, necessitating the invention of a new synthesis method with higher yields and simpler preparation processes. Meanwhile, Chinese patent application No. CN 115820578 A discloses a method for preparing small-molecule collagen tripeptides. This method uses amino acid ligases to sequentially link L-glycine, L-proline, and L-hydroxyproline to generate collagen tripeptides with high conversion rates, followed by separation and purification to obtain the relevant tripeptides. However, the bioenzymatic synthesis methods in these applications do not address long-chain polypeptide molecules; therefore, there is an urgent need to invent new synthesis methods for long-chain polypeptides, cyclic peptides, and their derivatives.

[0008] Therefore, there is still a need in the field for improved methods of peptide cyclization that overcome the shortcomings of existing technologies and are ideally simple, rapid, and universal. One object of this invention is to provide a simple and feasible cyclization synthesis strategy for such specific sequences, thereby improving the synthetic yield of polypeptide molecules. This involves combining chemical methods with enzymatic ligation methods to establish diverse cyclic peptide synthesis strategies. Summary of the Invention

[0009] To address the aforementioned problems, the present invention aims to provide a method for preparing and applying highly bioactive cyclic peptides. By innovating a more efficient and concise chemical-enzymatic synthesis method, L-glycine, L-proline, and L-glutamine are sequentially linked to generate collagen tripeptides with high conversion rates. Then, a series of target products—cyclic peptides—are rapidly generated through a mild and simple amino acid ligase (bioenzyme) catalyzed amide reaction. Compared to commonly used purification, extraction, enzymatic cleavage, and chemical synthesis methods, this patented large-scale production process is stable, and the method offers high purity and fewer byproducts, significantly outperforming purely chemical synthesis methods. This peptide synthesis method combines the advantages of atom economy and environmental friendliness, integrating organic and biological transformation of compounds to improve synthesis efficiency. It enables faster, more economical, and efficient large-scale synthesis of peptides and their derivatives, minimizing solvent usage, promoting green production, and utilizing readily available raw materials, reducing waste and pollution, thus benefiting environmental protection. It has significant practical application value in organic synthesis and peptide chemistry. This series of cyclic peptides is mainly used in the field of beauty and skin care. Studies on their properties have revealed that this group of cyclic peptides has excellent stability, is not easily degraded, and has very strong skin permeability and the ability to promote collagen production. It has greater application potential in the fields of beauty and skin care and medical aesthetic anti-aging.

[0010] This invention is based on L-glutamate ligase (EC 6.3.2.60), a peptide ligase / cyclase, and its mutants. The mutant enzyme can ligate / cyclize peptides with very high catalytic activity. It recognizes L-glutamate at the C-terminus and requires no modification of other groups, exhibiting high cyclization efficiency and eliminating the need for complex subsequent purification. Notably, this enzyme can effectively cyclize not only corresponding amino acids and short peptide fragments, making it highly versatile and useful in various applications where the desired cyclization of peptides containing L-glutamate, glutamine, etc., macrocyclic oligopeptides, or proteins is desired, thus enriching its applications in medicine and other fields. The synthesized cyclic peptides and mixtures of cyclic peptides possess excellent biological activity and can be applied in fields such as cosmetics and skincare.

[0011] The L-glutamate ligase (EC 6.3.2.60) peptide ligase / cyclase and its mutants mentioned in this invention are not limited to the preparation of cyclic peptides, but can be used to prepare other peptides.

[0012] Small peptides are suitable for organic synthesis, while the yield of organic synthesis of long-chain peptides is relatively low. Enzymatic synthesis, on the other hand, has strict requirements on the enzyme and its corresponding structure, such as specific enzymes and specific structures. The advantage of enzymatic synthesis is the specificity of the enzyme. Not all peptide bonds can be synthesized, and the various factors and conditions affecting the yield of peptide bond synthesis may change depending on the reactants. This invention has obtained a method for preparing highly bioactive cyclic peptides through extensive synthetic experiments.

[0013] The preparation route is shown in formula (2). All steps before the cyclization reaction are carried out by organic synthesis. The amide cyclase used in the cyclization reaction is one or more of L-glutamate ligase EC 6.3.2.60 and mutants of L-glutamate ligase EC 6.3.2.60. The nucleotide sequence of the mutant L-glutamate ligase EC 6.3.2.60 is any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4. In formula (2), the R group of the ring (Gly-Pro-Gln-Gly-Pro-Gln) is (CH2)2CONH2.

[0014]

[0015] This invention provides a class of cyclic peptides containing 3-6 amide bonds within their rings, specifically the sequences (Gly-Pro-Gln), (Gly-Pro-Gln-Gly), (Gly-Pro-Gln-Gly-Pro), and (Gly-Pro-Gln-Gly-Pro-Gln). The corresponding cyclic peptide products are obtained by high-yield cyclization of these amide bonds under the action of adenosine triphosphate (ATP) and its corresponding ligase. The resulting cyclic structure contains amide bonds; the number of ring members indicates the number of amide bonds in the cyclic structure, such as a six-membered ring indicating six amide bonds.

[0016] The cyclic peptides and their derivatives or salts of the present invention can exist as stereoisomers or mixtures of stereoisomers; for example, the amino acids comprising them can have L-, D-configurations, or be racemic independently of each other. Therefore, it is possible to obtain isomeric mixtures and racemic mixtures or diastereomeric mixtures, or pure diastereomeric or enantiomers, depending on the number of asymmetric carbons and the presence of any isomers or isomeric mixtures. The preferred structures of the peptides of the present invention are pure isomers, i.e., enantiomers or diastereomerics.

[0017] The preparation method provided by this invention can also prepare cyclic peptide derivatives or their salts; the cyclic peptide derivatives include: cyclic (Gly-Pro-Gln-Gly-Pro-Gln) in formula (2), wherein the R group is selected from H, (CH2) n CH3, (CH2) m NH2, (CH2) x COOA1, (CH2) m Any one of CONA2; where n, m, and x are independently selected from 0 or natural numbers; A1 and A2 are independently selected from one or more of H2, OH, NH2, COOH, C1-18 alkyl, phenyl, and heteroaryl.

[0018] The salts of the cyclic peptide derivatives include metal salts of the cyclic peptide derivatives, wherein the metals include: lithium, sodium, potassium, calcium, magnesium, manganese, copper, zinc or aluminum.

[0019] The salts of the cyclic peptide derivatives include salts formed by the cyclic peptide derivatives and organic bases, wherein the organic bases include: ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, arginine, lysine, histidine, or piperazine.

[0020] The salts of the cyclic peptide derivatives include salts formed by the cyclic peptide derivatives and inorganic or organic acids, wherein the organic acids include: acetic acid, citric acid, lactic acid, malonic acid, maleic acid, tartaric acid, fumaric acid, benzoic acid, aspartic acid, glutamic acid, succinic acid, oleic acid, trifluoroacetic acid, oxalic acid, pyric acid, or gluconic acid; and the inorganic acids include: hydrochloric acid, sulfuric acid, boric acid, or carbonic acid.

[0021] The preparation method provided by this invention is not limited to the three amino acids Gln, Gly, and Pro. Other natural and non-natural amino acids can also be prepared into cyclic peptides by this method. However, the preparation yield, purity, and bioactivity depend on the activity and selectivity of the ligase. It is possible that other cyclic peptides can be prepared with high yield, high purity, and high bioactivity after ligase mutation.

[0022] On one hand, the present invention provides a method for preparing cyclic peptides, which firstly involves organically synthesizing a short peptide sequence or its fragment, and then cyclizing it with an enzyme to obtain the corresponding cyclic peptide product; the enzyme includes one or more of L-glutamate ligase EC 6.3.2.60 and mutants of L-glutamate ligase EC 6.3.2.60; the nucleotide sequence of the mutant of L-glutamate ligase EC 6.3.2.60 is any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0023] Furthermore, the nucleotide sequence of the mutant L-glutamate ligase EC 6.3.2.60 may be deleted, substituted, inserted, or added by 1 to 10 amino acid residues as shown in any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0024] Furthermore, the nucleotide sequence of the mutant L-glutamate ligase EC 6.3.2.60 is 85% or more identical to the sequence shown in any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0025] The identity of the above sequences can be determined by known means such as FASTA search, BLAST search, etc. Sequences with identity belong to the mutants of this invention.

[0026] Preferably, the nucleotide sequence of the mutant L-glutamate ligase EC 6.3.2.60 is the sequence shown in SEQ ID NO:4.

[0027] The cyclic peptide yield was highest and the purity was highest under the catalytic cyclization of the mutant enzyme with the sequence SEQ ID NO:4. The prepared cyclic peptide had the best effect in anti-photoaging and anti-wrinkle efficacy, and had the highest resistance to enzymatic hydrolysis and skin penetration.

[0028] Furthermore, the cyclic peptide contains Gln, which is located at the beginning or end of the short peptide sequence or a fragment thereof during the cyclization reaction.

[0029] The mutant enzyme designed and mutated in this invention exhibits high specificity for linking Gln to other amino acids. By selectively choosing mutants, performing targeted mutations, and screening, existing mutants and their expressed enzymes can efficiently synthesize the target product. In the synthesis of the target molecule, L-glutamate ligase, acting as an amide bond ligase, catalyzes the coupling of glutamate / glutamine with any amino acid to form a peptide bond, subsequently leading to cyclization.

[0030] Furthermore, the cyclic peptide contains 3-6 amide bonds within its ring.

[0031] Furthermore, the cyclic peptide is prepared by amide bond synthesis and enzyme-catalyzed cyclization of three amino acids, Gln, Gly, and Pro.

[0032]

[0033] On the other hand, the present invention provides a cyclic peptide prepared by the above-described method for preparing cyclic peptides.

[0034] The cyclic peptides prepared by the method of the present invention have better anti-photoaging and anti-wrinkle effects, as well as higher anti-enzymatic and skin penetration properties, which are not found in cyclic peptides prepared by other methods.

[0035] The present invention also compared the efficacy of cyclic peptides prepared by different methods and found that the cyclic peptides obtained by the chemical-enzyme synthesis method provided by the present invention were significantly superior to those prepared by conventional methods (all-chemical synthesis, all-enzyme synthesis, and chemical-natural enzyme synthesis) in terms of promoting Collagen I gene expression, resisting protease hydrolysis, and transdermal penetration. This shows that the cyclic peptides prepared by the method provided by the present invention have higher biological activity.

[0036] The above phenomena may be due to two main reasons: Firstly, differences in product purity and content. The chemical-enzymatic synthesis method provided by this invention yields high-quality products that are easy to purify, resulting in high-purity and high-content cyclic peptides, thus achieving better results. Secondly, the different production process introduces other beneficial factors, such as more stable conformation of the cyclic peptides and the absence of impurities that antagonize the efficacy of the cyclic peptides. These beneficial factors all contribute to the higher bioactivity of the cyclic peptides prepared by this invention. The fragment synthesis-enzymatic cyclization method provided by this invention is not only significant for manufacturing but also more beneficial for applications.

[0037] Furthermore, the cyclic peptide comprises specific amino acids and / or specific sequence loops (Gln-Gly-Pro-x); at least one Gln, Gly, or Pro; and / or at least two glutamine Gln, one Gly, and one proline Pro; and / or at least two Gln, one Gly, and one Pro; and / or at least two Gln, Gly, and Pro sequences; or enantiomers thereof;

[0038] On the other hand, the present invention provides an enzyme for preparing cyclic peptides, the enzyme being derived from L-glutamate ligase EC6.3.2.60 by directed mutation; the nucleotide sequence of the enzyme is any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0039] Preferably, the nucleotide sequence of the enzyme is as shown in SEQ ID NO:4.

[0040] Furthermore, the nucleotide sequence of the mutant L-glutamate ligase EC 6.3.2.60 may be deleted, substituted, inserted, or added by 1 to 10 amino acid residues as shown in any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0041] Furthermore, the nucleotide sequence of the mutant L-glutamate ligase EC 6.3.2.60 is 85% or more identical to the sequence shown in any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0042] The identity of the above sequences can be determined by known means such as FASTA search, BLAST search, etc. Sequences with identity belong to the mutants of this invention.

[0043] On the other hand, the present invention provides the use of the above-mentioned enzyme for the high-conversion preparation of high-purity cyclic peptides, wherein the preparation of the cyclic peptides first involves the organic synthesis of short peptide sequences or fragments thereof, and then the cyclic peptide products are obtained by cyclization catalyzed by the enzyme.

[0044] On the other hand, the present invention provides the use of the cyclic peptide prepared by the above preparation method for preparing an anti-photoaging formulation. The cyclic peptide prepared by the preparation method can promote Collagen I gene expression and resist the reduction of Collagen I collagen under UV irradiation.

[0045] On the other hand, the present invention provides the use of the cyclic peptide prepared by the above preparation method for preparing an anti-wrinkle formulation. The cyclic peptide prepared by the preparation method can promote the expression of Collagen I gene and increase the content of Collagen I, thereby achieving the effect of resisting the formation of wrinkles.

[0046] Collagen is mainly produced by fibroblasts in the dermis and is an important element supporting the skin. Collagen I accounts for approximately 80% of the dermis, making the skin plump and full. Increasing Collagen I content can help resist wrinkles. UV-exposed skin shows a significant reduction in Collagen I. The cyclic peptide provided in this invention promotes Collagen I gene expression and increases Collagen I content, achieving anti-photoaging and anti-wrinkle effects.

[0047] On the other hand, the present invention provides the use of the cyclic peptide prepared by the above preparation method for preparing a formulation that is not easily degraded, characterized in that the cyclic peptide prepared by the preparation method has anti-protease enzymatic hydrolysis properties.

[0048] On the other hand, the present invention provides the use of the cyclic peptide prepared by the above preparation method for preparing a formulation that improves skin penetration, characterized in that the enzyme in the preparation method can improve the permeability of the product cyclic peptide.

[0049] The beneficial effects of this invention include:

[0050] 1. The series of collagen small molecule cyclic peptides and their derivatives described in this invention are obtained by chemical synthesis-bioenzyme catalytic linkage synthesis method, which is convenient to synthesize and safe and non-irritating to the human body, and can be applied in the field of cosmetics.

[0051] 2. It should be noted that this method uses two sequences to be synthesized separately, followed by a specific enzyme-catalyzed cyclization. This step can significantly improve the synthesis rate of the peptide. A further objective of this invention is to improve the purity of the crude product in order to provide a final peptide product with higher purity (>95%).

[0052] 3. In addition, in solid-phase peptide synthesis, the formation of certain secondary structures can embed reaction sites, which increases the difficulty of synthesis. This fragment enzymatic condensation method can prevent the formation of these secondary structures, thereby significantly reducing the difficulty of synthesis. This is an important advantage that traditional methods do not have.

[0053] 4. The application of the cyclic peptides and their derivatives or salts described in this invention can resist enzymatic hydrolysis, improve stability and bioavailability, enhance fibroblast activity, promote fibroblast proliferation, promote collagen production, repair the skin barrier (photodamage repair, scratch repair), increase skin elasticity, improve skin firmness, prevent or even treat skin laxity, and treat, prevent or repair skin aging or photoaging. It has good skin repair and firming effects and can be applied to products for skin repair, firming and anti-wrinkle. Attached Figure Description

[0054] Figure 1 Schematic diagram of peptide cyclization

[0055] Figure 2 Promotion rate of Collagen I gene by various cyclic peptide samples Detailed Implementation

[0056] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0057] In this specification, a peptide cyclase is an enzyme that cyclizes a peptide by combining an amino group located at one part of the peptide (e.g., one amino acid residue) with a carboxyl group located at another part (e.g., another amino acid residue) to form a peptide bond. The peptide cyclase of the present invention can cyclize peptides in a head-to-tail manner, thereby producing large cyclic peptides, such as... Figure 1 As shown.

[0058] Example 1: Preparation of mutant enzyme

[0059] In some embodiments of the present invention, the ligase 1 (EC 6.3.2.60, 849NT seq) mother plate is derived from the archaea *Sulfolobus*, characterized by calcium darius. The cyclized amino acid ligase sequences of L-glutamate ligase (EC 6.3.2.60) and its mutants 1 (SEQ ID NO:1), 2 (SEQ ID NO:2), 3 (SEQ ID NO:3), and 4 (SEQ ID NO:4) are shown below:

[0060] L-glutamate ligase (EC 6.3.2.60) nucleotide sequence:

[0061] atgagagtagcacttgtcgttgacatagtaagacaagaggaaaaactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgatactattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaaaaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataagggacattttcgaaggtaaaaccataattgaacatagggagttgatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagagcaaatattgctttaggcggttatccatcgcagatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaccaatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

[0062] The nucleotide sequence of mutant 1 (SEQ ID NO:1) is as follows: mutant 1 is formed by mutations at the following sites: K15R, T80N, K120E, I150M, E151G, H152Q, R153K, R200S, S210P, Q211P, H241Q, Q242P.

[0063] The nucleotide sequence of mutant 2 (SEQ ID NO:2) is as follows: mutant 2 is formed by mutations at the following sites: K15R, T80N, K120E, I149K, I150M, E151G, H152Q, R200S, S210P, Q211P, H241Q, Q242P

[0064] The nucleotide sequence of mutant 3 (SEQ ID NO:3) is as follows: mutant 3 is formed by mutations at the following sites: K15R, T80N, K120E, E151G, H152Q, R153K, E154Q, R200S, A201E, N202S, H241Q, Q242P.

[0065] The nucleotide sequence of mutant 4 (SEQ ID NO:4) is as follows: mutant 4 is formed by mutations at the following sites: K15R, T80N, K120E, I149M, I150M, E151G, H152Q, R153K, L155F, R200S, A201E, N202S, S210P, Q211P, H241Q, Q242P

[0066] In the embodiments of this invention involving mutants of SEQ ID NO:1-4, the required enzymes were all synthesized by a commissioned company, constructed into specific expression vectors, and then produced by fermentation with *E. coli*. All raw materials and reagents used were commercially available, including those related to enzyme fermentation production:

[0067] Specifically, it includes the following steps:

[0068] (1) Preparation of mutant gene: The gene corresponding to amidase ligase 1 is directionally mutated, and the sequence is optimized as shown in SEQ ID NO:1-4. The corresponding mutant gene is obtained by synthesis.

[0069] (2) Preparation of recombinant plasmids: The nucleic acid sequences of the mutant genes 1-4 above are introduced into the linearized expression vector pET 28a (pET-28a(+) vector) after being digested by NdeI / XhoIA (NdeI restriction endonuclease / XhoI endonuclease) to form recombinant plasmids with mutant gene sequences.

[0070] (3) Cell culture and enzyme expression with recombinant plasmids: Plasmids with confirmed correct sequences were transfected into E. coli (BL21) competent cells for plate culture and small-scale monoclonal liquid culture. E. coli cells with correct protein expression were then subjected to stepwise scale-up liquid culture. Examples of preferred cells for this method include (but are not limited to) microorganisms such as Escherichia coli and Bacillus subtilis cells. Once cells reached the logarithmic growth phase, they were inoculated into LB medium and subsequently transferred to a 5L fermenter for culture and final protein expression. When the cell OD reached 20, 0.5 mM isopropyl β-D-thiogalactopyranoside (IPTG) was added at 25°C to induce protein expression for 4-6 hours.

[0071] (4) Screening for protease expression: Cells were collected by high-speed centrifugation (4000 rpm, 20 min) to obtain 25-50 g of wet cells with overexpressed enzyme. A small amount of cells was taken and mixed evenly with Tris-HCl buffer (50 mM, pH 8.0) on an ice basin. Then, the cells were lysed by freeze-thaw method, and the cell walls were removed by high-speed centrifugation. The supernatant was then subjected to SDS-PAGE gel electrophoresis (sodium dodecyl sulfonate polyacrylamide gel electrophoresis) to determine protein expression.

[0072] (5) Enzyme extraction: Specifically, the remaining cells were mixed thoroughly with Tris HCl buffer (50mM, pH 8.0) at low temperature (approximately 10g wet cells to 200mL buffer). The cell walls were then disrupted by low-temperature high-pressure centrifugation, followed by high-speed centrifugation to remove the cell walls and obtain the enzyme-containing supernatant for later use (the resulting enzyme activity was 250–500 U / mL, where U is the amount of enzyme required to convert 1 μmol of substrate per minute at room temperature). The LB medium consisted of 1% peptone, 0.5% yeast extract, 1% NaCl, 1% dipotassium hydrogen phosphate, 1% dipotassium hydrogen phosphate, and 5% glycerol.

[0073] Example 2: Preparation of Cyclic Peptides

[0074] Method 1: Solid-phase synthesis (total chemical synthesis)

[0075] The full chemical synthesis includes the following steps: (1) under the coupling reagent, Fmoc-Gly-OH is coupled to a resin solid support to obtain Fmoc-Gly-OH resin; (2) under the action of condensing agent and activating agent, amino acids with N-terminal Fmoc protection are coupled to the resin; wherein, the amino acids with N-terminal Fmoc protection are Fmoc-Pro-OH, Fmoc-Gln(Trt)-OH, Fmoc-Gly-OH, Fmoc-Pro-OH and Fmoc-Gln(Trt)-OH in sequence to obtain a full peptide resin; (5) the peptide chain is removed from the peptide resin by using a cleavage reagent to precipitate the crude linear peptide; (6) the linear peptide is taken and cyclized by using a condensing agent; (7) the linear peptide is separated and purified to obtain the relevant cyclic hexapeptide and its derivatives.

[0076] Specific steps 1: Take Fmoc Gly OH (4.46g, 15mmol) and HOBt (2.03g, 15mmol) in a 100mL beaker, cool to 4℃, add 25mL of DMF solution and DIC (2.3mL, 15mmol), let stand for 20 minutes, and then add the solution from the 100mL beaker to a 125mL solid-phase synthesis reactor. Stir and react for 1.5 hours until the reaction is complete. Wash the resin three times with 65mL of DMF solution each time. After washing, add 65mL of 20% Pip / DMF solution, stir and react for 30min, filter to remove the protective solution, and then wash 6 times with 65mL of DMF solution. Dry and set aside for later use.

[0077] Step 2: Take Fmoc Pro OH (5.06g, 15mmol) and HOBt (2.03g, 15mmol) in a 100mL beaker, cool to 4℃, add 25mL of DMF solution and DIC (2.3mL, 15mmol), let stand for 20 minutes, and then add the solution from the 100mL beaker to a 125mL solid-phase synthesis reactor. Stir and react for 1.5 hours until the reaction is complete. Wash the resin three times with 65mL of DMF solution each time. After washing, add 65mL of 20% Pip / DMF solution, stir and react for 30 minutes, filter to remove the protective solution, and then wash 6 times with 65mL of DMF solution, 2 times with 65mL of methanol, 2 times with 65mL of DCM solution, and 2 times with 65mL of methanol.

[0078] Step 3: Take Fmoc Gln(Trt)OH and HOBt (2.03g, 15mmol) in a 100mL beaker, cool to 4℃, add 25mL of DMF solution and DIC (2.3mL, 15mmol), let stand for 20 minutes, and then add the solution from the 100mL beaker to a 125mL solid-phase synthesis reactor. Stir and react for 1.5 hours until the reaction is complete. Wash the resin three times with 65mL of DMF solution each time. After washing, proceed to the next step. Add 65mL of 20% Pip / DMF solution, stir and react for 30min, filter to remove the protective solution, then wash 6 times with 65mL of DMF solution, and dry before proceeding to the next step.

[0079] Step 4: Vacuum drying, add 200 mL of 1% TFA / DCM solution, stir and react at 30°C for 30 minutes, filter to remove resin, and obtain filtrate; dry the filtrate to obtain fully protected peptides.

[0080] H Gly Pro Gln(Trt)Gly Pro Gln(Trt)OH;

[0081] Step 5: Dissolve the fully protected peptide in 1.4 L of dichloromethane (DCM), add DIC (1.54 mL, 10 mmol), HOBt (1.35 g, 10 mmol), and DIEA (1.74 mL, 10 mmol), and stir at 30 °C for 14 hours to form Cyclo(GlyPro Gln(Trt)GlyPro Gln(Trt)). Concentrate to remove DCM and proceed to the next step.

[0082] Step 6: Cyclo(Gly-Pro-Gln(Trt)-Gly-Pro-Gln(Trt)) was cleaved for 2.5 hours using TFA / TIS / H2O = 90 / 5 / 5 (70 mL). The cleavage solution was added to 700 mL of tert-butyl methyl ether (4 °C) solution, and a white solid precipitated. After centrifugation, a white solid crude peptide was obtained. The white solid crude peptide was dried under vacuum to obtain crude peptide powder Cyclo(Gly Pro GlnGly Pro Gln). After purification by reversed-phase C18 preparative chromatography and lyophilization, a refined Cyclo(Gly Pro GlnGly ProGln) was obtained with a yield of only 10-15%. Its chemical structure is shown in formula (2). 1 HNMR (400MHz, D2O), δppm: 8.65 (s, 4H), δ7.03 (s, 4H), δ4.40-4.44 (m, 4H), δ4.08-4.10 (d, 4H), δ3.41-3.51 (m, 4H), δ1.92-2.33 (m, 16H).C 24 H 36N8O8, [M+H] + =565.20.

[0083] Method 2: Synthesis of Natural Enzymes

[0084] The tripeptide Gly-Pro-Gln was prepared using crude enzyme solutions of natural ligases (GPSynA0 and GPHSynB0). 12.4 g L-glycine (165 mM), 17.3 g L-proline (150 mM), and 83.0 g adenosine triphosphate monosodium salt (ATP, 157 mM) were added to 1 L of 100 mM, pH 8.0 tris(hydroxymethyl)aminomethane hydrochloride (Tris.HCl) solution. The pH of the reaction system was then adjusted to 8.0 using NaOH aqueous solution. 3000 U of GPSynA0 ligase was added to initiate the reaction. The mixture was gently stirred at 30 °C while maintaining the pH between 7.0 and 9.0. After 3 hours, HPLC detected the formation of the target product, but the conversion rate of the starting material was relatively low. The pH was then adjusted to 1.0 with an aqueous HCl solution to denature and precipitate the enzyme in the reaction system, which was then removed by centrifugation. The pH of the reaction solution was then adjusted to 7.0, and the sample was directly loaded onto a D201 anion exchange resin to remove adenosine diphosphate and free phosphate impurities. Finally, the crude product was desalted, concentrated, and crystallized using a reverse osmosis membrane (ethanol:water, 2:1, v:v) to obtain approximately 11.7–13.9 g of L-glycine-L-proline (Gly-Pro) dipeptide (yield 40%–45%). Due to the small proportion of the product, crystallization purification was difficult. (2) Similar to the preparation method in step (1) above, 17.2g of L-glycine-L-proline (100mM), 14.4g of trans-4-OH-L-proline (110mM), and 55.5g of monosodium ATP (105mM) were added to 1L of 100mM Tris-HCl solution at pH 7.5. Then, the pH of the reaction system was adjusted to 7.5 with NaOH aqueous solution, and 3000U of ligase GPHSynB0 was added to start the reaction. The reaction system was gently stirred at 30℃ and the pH of the reaction system was maintained between 7.0 and 9.0. After 2 hours, the target product was detected by HPLC. The pH was then adjusted to 1.0 with an aqueous HCl solution to denature and precipitate the enzyme in the reaction system, which was then removed by centrifugation. The pH of the reaction solution was then adjusted to 7.0 before being directly loaded onto a D201 anion exchange resin to remove adenosine diphosphate and free phosphate impurities. Finally, the crude product was desalted, concentrated, and crystallized using a reverse osmosis membrane (ethanol:water, 3:1, v:v), yielding only 8.6–9.9 g of tripeptide (yield only 30%–35%). As described in the previous step, this crystallization purification step is more difficult.(3) Similar to the preparation method in step (1) above, 17.2 g of L-glycine-L-proline-L-glutamine (200 mM) and 55.5 g of monosodium ATP (ATP, 105 mM) were added to 1 L of 100 mM Tris(hydroxymethyl)aminomethane hydrochloric acid (Tris.HCl) solution at pH 7.5. Then, the pH of the reaction system was adjusted to 7.5 with NaOH aqueous solution, and ligase (EC 6.3.2.60) was added to start the reaction. The reaction system was gently stirred at 30 °C and the pH of the reaction system was maintained between 7.0 and 9.0. After 2 hours, the target product was detected by HPLC. Then, the pH was adjusted to 1.0 with HCl aqueous solution to denature and precipitate the enzyme in the reaction system, which was then removed by centrifugation. After adjusting the pH of the reaction solution to 7.0, it was directly loaded onto D201 anion exchange resin to remove adenosine diphosphate and free phosphate impurities. Finally, the crude product was desalted, concentrated and crystallized using a reverse osmosis membrane (ethanol:water, 3:1, v:v), yielding only 8.6-9.9g of collagen cyclic hexapeptide and collagen cyclic tripeptide (yield less than 10%), which were difficult to purify.

[0085] Method 3: Chemical Synthesis + Natural Enzyme Synthesis 1

[0086] The preparation method in this embodiment is basically the same as that in Method 1, except that step 4 is changed to the amino acid ligase method. The preparation route is shown in formula (2). The amidase is selected from L-glutamate ligase (EC 6.3.2.60). In the cyclization process, L-glutamate ligase (EC 6.3.2.60) is used to cyclize the amino acid ligase solution to prepare collagen cyclic peptides. 17.2g of L-glycine-L-proline-L-glutamine (200mM) and 55.5g of adenosine triphosphate monosodium salt (ATP, 105mM) are added to 1L of 100mM Tris.HCl solution at pH 7.5. Then, the pH of the reaction system is adjusted to 7.5 with NaOH aqueous solution. The ligase (EC 6.3.2.60) is added to start the reaction. The reaction system is stirred gently at 30℃ and the pH is maintained between 7.0 and 9.0. After 2 hours, the target product is detected by HPLC. Then, the pH was adjusted to 1.0 with HCl aqueous solution to denature and precipitate the enzyme in the reaction system and remove it by centrifugation. The pH of the reaction solution was then adjusted to 7.0 and directly loaded onto D201 anion exchange resin to remove adenosine diphosphate and free phosphate impurities. Finally, the crude product was desalted, concentrated and crystallized using a reverse osmosis membrane (ethanol:water, 3:1, v:v) to obtain cyclic hexapeptide and cyclic tripeptide. The products are complex and difficult to purify (yield 25-30%).

[0087]

[0088] Method 4: Chemical synthesis + natural enzyme synthesis 2

[0089] The preparation method in this embodiment is basically the same as that in Method 3, except that in the cyclization process, the amidase L-glutamate ligase (EC 6.3.2.B19) is used. The other steps are the same as in Method 3, but there is almost no cyclic peptide product.

[0090] Method 5: Modified Enzyme Total Synthesis

[0091] The preparation method in this embodiment is basically the same as that in Method 2. Sequence SEQ ID NO:1-4 was selected as the synthase. It was found that there was a corresponding yield in Gln-Pro, but the modified enzyme had high specificity and could not be synthesized in the tripeptide Gln-Pro-Gly synthesis.

[0092] Method Six: Chemical Synthesis + Mutant Enzyme (Sequences 1-4) Synthesis

[0093] The preparation method in this embodiment is basically the same as that in Method 3, and the preparation route is the same as formula (2). The difference is that in the cyclization reaction, the amide cyclase uses mutants of L-glutamate ligase (EC 6.3.2.60), including mutant 1 (SEQ ID NO:1), mutant 2 (SEQ ID NO:2), mutant 3 (SEQ ID NO:3), and mutant 4 (SEQ ID NO:4). The above mutant enzymes are synthesized separately. Collagen cyclic hexapeptide and collagen cyclic tripeptide (the catalytic yield of the four mutant enzymes all reached 80-90%), the purification steps are the same as those described in Method 3, the purification process is simple, and the catalytic purity of the four mutant enzymes all reached more than 95%.

[0094] In formula (2), the R group on the ring (Gly-Pro-Gln-Gly-Pro-Gln) is (CH2)2CONH2.

[0095] This method can also be used to prepare derivatives of cyclic peptides. By adjusting the reactants, the R group on the ring (Gly-Pro-Gln-Gly-Pro-Gln) in the final product (2) is selected from H, (CH2). n CH3, (CH2) m NH2, (CH2) x COOA1, (CH2) m Any one of CONA2; where n, m, and x are independently selected from 0 or natural numbers; A1 and A2 are independently selected from one or more of H2, OH, NH2, COOH, C1-18 alkyl, phenyl, and heteroaryl.

[0096] Table 1: Comparison of yields from different preparation methods

[0097]

[0098] The above six methods cover total chemical synthesis, total enzyme synthesis, chemical synthesis + natural enzyme synthesis, chemical synthesis + modified enzyme synthesis, and total synthesis with modified enzymes. A comparison of the methods is shown in Table 1.

[0099] Total chemical synthesis is a common synthetic method, but it is evident that the yield is relatively low, and the product is difficult to purify completely. The purification process is complex, and the purity is not high, thus limiting practical production. Natural enzymes have strong selectivity for long peptide chains, but cyclization of cyclic peptides is difficult. Total enzyme synthesis involves many side reactions and is difficult to purify. When using natural enzymes to cyclize short chain fragments after chemical synthesis, EC6.3.2.60 has low cyclization efficiency, and EC 6.3.2.B19 has almost no cyclization catalytic activity. Modified enzymes are specific and cannot catalyze other steps, making total synthesis of modified enzymes impossible. Modified enzymes have selectivity and specificity, so after synthesizing the target polypeptide containing the fragment, cyclization using the corresponding enzyme is highly efficient, produces few byproducts, and is simple to purify, making them highly valuable for production applications.

[0100] In the cyclic peptide synthesis, the corresponding multi-component cyclic peptides are synthesized in a directed manner: during the feeding process, the corresponding tripeptide is first synthesized, and the tripeptide is cyclized to convert into a cyclic hexapeptide or a small amount of cyclic tripeptide; tripeptide + corresponding amino acid generates cyclic tetrapeptide; tripeptide + dipeptide generates cyclic pentapeptide; this belongs to the fragment linking cyclization method.

[0101] The catalytic effects of the enzyme sequences SEQ ID NO:1-4 were compared based on cyclization activity, which can be measured using known methods. The amount of cyclic peptide produced per unit of enzyme and per unit time can be used as an indicator of cyclization activity. Using mg product peptide / u unit enzyme / hour as the unit, the cyclization activity of SEQ ID NO:1 was 330, SEQ ID NO:2 was 350, SEQ ID NO:3 was 335, and SEQ ID NO:4 was 450. The catalytic yield of SEQ ID NO:1-3 was 80%-85%, while SEQ ID NO:4 was significantly superior, achieving the highest yield of 90% under its catalysis. Furthermore, the purity of the cyclic peptides prepared by SEQ ID NO:1-3 after purification was 95%-98%, higher than the purity of products prepared by other methods. The cyclic peptides prepared by SEQ ID NO:4 achieved the highest purity after purification, reaching 99%. This demonstrates that the mutant enzyme SEQ ID NO:4 exhibits high reaction efficiency and few side reactions, demonstrating the best catalytic effect.

[0102] Example 3: In vitro anti-wrinkle efficacy test of peptide application

[0103] This embodiment evaluates the anti-wrinkle efficacy of the test sample by detecting the expression of the Collage I gene after UVA irradiation of fibroblasts.

[0104] The cells used in this embodiment and the main reagents used in this test were fibroblasts, and all were commercially available. The routine operations in the operation steps of this invention are well known to those skilled in the art. For specific experimental operations, please refer to David C. Ireland, Michelle L. Colgrave, David J. Craik; A novel suite of cyclotides from Violaodorata: sequence variation and the implications for structure, function and stability. Biochem J 15 November 2006; 400(1):1–12. doi:https: / / doi.org / 10.1042 / BJ20060627.

[0105] Experimental Procedure: The sample was evenly distributed on the model surface and incubated in a CO2 incubator (37℃, 5% CO2) for 24 hours. After incubation, the surface of the model was cleaned with sterile PBS solution to remove any remaining test material, and residual liquid inside and outside the model was wiped away with sterile cotton swabs. The test scheme is shown in the table. Samples 1-3 correspond to the products of methods 1-3, respectively. Samples 4-7 correspond to the products obtained by chemical synthesis + preparation catalyzed by the modified enzymes of sequences 1-4, respectively.

[0106]

[0107] The experimental results are shown in Table 2 and Figure 2 Bar chart showing the effect of cyclic peptides on Collagen I gene expression;

[0108] From Table 2 and Figure 2 It can be seen that the promotion rate (%) of collagen I expression varied among the samples. Figure 1 It is evident that cyclic peptides or their combinations obtained by different cyclization methods all exhibit corresponding improvements in promoting Collagen I gene expression. However, the fragment synthesis-enzymatic cyclization method provided by this invention has advantages in terms of significant promotion: the conventional preparation method of cyclic peptides is all-chemical synthesis, which is also the preparation method of commercially available cyclic peptides, with a promotion rate of 153% for Collagen I gene expression; the cyclic peptides obtained by all-enzyme synthesis and chemical + natural enzyme synthesis only have a promotion rate of about 100% for Collagen I gene expression; the cyclic peptides obtained by chemical + modified enzyme synthesis all have a promotion rate of more than 200% for Collagen I gene expression, and the cyclic peptides obtained by the modified enzyme with sequence SEQ ID NO:4 have the highest promotion rate of Collagen I gene expression, at 220%.

[0109] Table 2. Collagen I promotion rate (%) for each sample

[0110] Group Collagen I promotion rate (%) Sample 1 153 Sample 2 110 Sample 3 105 Sample 4 (Sequence 1) 200 Sample 5 (Sequence 2) 210 Sample 6 (Sequence 3) 203 Sample 7 (Sequence 4) 220

[0111] In terms of applications, the cyclic peptides prepared by this invention have higher bioactivity and can more effectively resist the loss of Collagen I caused by UV radiation, thus having an anti-photoaging effect. They can be applied to daily chemical products such as sunscreens and skincare products, achieving better results than similar products. On the other hand, the cyclic peptides prepared by this invention promote the increase of Collagen I content, making the skin plump and full, and can achieve a certain effect in resisting the formation of wrinkles. They can be applied to anti-wrinkle and anti-aging daily chemical products, achieving better results than similar products.

[0112] Example 4: In vitro enzyme resistance test of peptides

[0113] This embodiment is based on in vitro combined enzyme culture. By culturing different peptide samples with multiple proteases, the residual peptide content before and after the reaction is detected to evaluate the in vitro anti-enzymatic ability of the corresponding samples.

[0114] The enzymes, culture media, and other main reagents used in this embodiment were all commercially available (Type I, Type III, and Type IV collagenase: Adamas Life; trifluoroacetic acid: Anage Chemicals; acetonitrile: TEDIA, USA). The routine operations in the operation steps of this invention are well known to those skilled in the art. For specific experimental operations, please refer to David C. Ireland, Michelle L. Colgrave, David J. Craik; A novel suite of cyclotides from Viola odorata: sequence variation and the implications for structure, function and stability. Biochem J 15 November 2006; 400(1):1–12. doi:https: / / doi.org / 10.1042 / BJ20060627.

[0115] Specifically, collagenases I, III, and IV from Clostridium histolyticum were selected as target protein / peptide hydrolases, and corresponding linear peptides were selected as controls. The enzyme digestion concentrations were set from 10u:mg (peptide) to 500u:mg (peptide), and the sample composition was the same as in Example 3.

[0116] According to the experimental results, the corresponding positive controls (linear peptides) were completely degraded in 4 hours at an enzyme activity concentration of 20 U: mg (peptide). Samples 1-3 showed more than 10% degradation in 24 hours at an enzyme activity concentration of 200 U / mL. Samples 4-7 showed no significant degradation in 48 hours at an enzyme activity concentration of 500 U / mL. This fully demonstrates that samples 4-7 can inhibit protease degradation. The cyclic peptides prepared by the method of this invention have stronger anti-enzymatic properties, with sample 7 showing the best effect. That is, the peptides obtained by cyclization catalyzed by the modified enzyme with the sequence SEQ ID NO:4 have the best anti-enzymatic properties.

[0117] In terms of applications, the cyclic peptides prepared by the method of this invention have better resistance to protease hydrolysis. On the one hand, they can be combined with their own anti-photoaging and anti-wrinkle effects to achieve a longer-lasting effect; on the other hand, they can be combined with other existing products to improve the duration of action of existing products.

[0118] Example 5: Permeability of Cyclic Peptides

[0119] This embodiment analyzes the transdermal absorption of peptides containing free amino groups in vitro using a Franzcell diffusion cell. Pig skin is used as the research model. The content of the target substance in the receiving fluid is detected by quantitative detection method to calculate the cumulative permeation and obtain the diffusion percentage. The transdermal absorption of the test sample is quantified, and the in vitro transdermal absorption of peptides containing free amino groups is analyzed.

[0120] This test was based on a pigskin system. The concentration of samples in the receiving solution at different time points was determined by high-performance liquid chromatography (HPLC) to evaluate the skin permeation behavior of samples 1-7. Sample grouping details are provided in Example 3. The routine procedures in this invention are well-known to those skilled in the art. Specific experimental procedures are referenced in David C. Ireland, Michelle L. Colgrave, David J. Craik; A novel suite of cyclotides from Viola odorata: sequence variation and the implications for structure, function and stability. Biochem J 15 November 2006; 400(1):1-12. doi:https: / / doi.org / 10.1042 / BJ20060627. The results are shown in Table 3.

[0121] Table 3. Results of transdermal penetration rate test of samples

[0122] Test sample 24-hour diffusion percentage (100%) linear peptide 0.08％ Sample 1 3.6％ Sample 2 2.1％ Sample 3 3.0％ Sample 4 4.0％ Sample 5 4.1％ Sample 6 4.4％ Sample 7 5.0％

[0123] The results showed that the transdermal permeability of samples 1-3 (prepared by all-chemical synthesis, all-enzyme synthesis, and chemical + natural enzyme synthesis, respectively) was less than 4% within 24 hours, while the transdermal permeability of the cyclic peptides prepared by the method of the present invention was higher than 4% within 24 hours. The transdermal permeability of the peptide prepared by the mutant enzyme with the sequence SEQ ID NO:4 was the highest, at 5.0%, within 24 hours.

[0124] At the application level, the cyclic peptides prepared by the method of the present invention have better transdermal penetration. On the one hand, they can combine with their own anti-photoaging and anti-wrinkle effects to produce better results. On the other hand, they can be combined with other existing products to enhance the corresponding effects by promoting skin penetration.

[0125] The embodiments described above provide a detailed explanation of the technical solution of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, or similar substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.

[0126] sequence list

[0127] SEQ ID NO:1

[0128] atgagagtagcacttgtcgttgacatagtaagacaagaggaaagactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgataatattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaagaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataaggg acattttcgaaggtaaaaccataatgggacaaaaggagttgatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagcgcaaatattgctttaggcggttatccaccgccgatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaaccatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

[0129] SEQ ID NO:2

[0130] atgagagtagcacttgtcgttgacatagtaagacaagaggaaagactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgataatattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaagaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataaggg acattttcgaaggtaaaaccagaatggggacaaaaggagttgatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagcgcaaatattgctttaggcggttatccaccgccgatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaaccatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

[0131] SEQ ID NO:3

[0132] atgagagtagcacttgtcgttgacatagtaagacaagaggaaagactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgataatattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaagaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataaggg acattttcgaaggtaaaaccataattggacaaaagcagttgatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagcgaaagtattgctttaggcggttatccatcgccgatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaaccatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

[0133] SEQ ID NO:4

[0134] atgagagtagcacttgtcgttgacatagtaagacaagaggaaagactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgataatattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaagaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataaggg acattttcgaaggtaaaaccagaatgggacaaaaggagttcatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagcgaaagtattgctttaggcggttatccaccgccgatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaaccatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

Claims

1. A method for preparing a cyclic peptide, characterized in that, First, a short peptide sequence or its fragment is organically synthesized, and then cyclized by an enzyme to obtain the corresponding cyclic peptide product; the enzyme includes a mutant of L-glutamate ligase EC 6.3.2.60; the nucleotide sequence of the mutant L-glutamate ligase EC 6.3.2.60 is any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4; the cyclic peptide contains Gln, which is located at the beginning or end of the short peptide sequence or its fragment during the cyclization reaction.

2. The method for preparing the cyclic peptide as described in claim 1, characterized in that, The nucleotide sequence of the mutant L-glutamate ligase EC 6.3.2.60 is the sequence shown in SEQ ID NO:

4.

3. The method for preparing the cyclic peptide as described in claim 2, characterized in that, The cyclic peptide contains 3-6 amide bonds within its ring.

4. The method for preparing the cyclic peptide as described in claim 3, characterized in that, The cyclic peptide was prepared by amide bond synthesis and enzyme-catalyzed cyclization of three amino acids, Gln, Gly, and Pro. Equation (1).

5. An enzyme for preparing cyclic peptides, characterized in that, The enzyme is derived from L-glutamate ligase EC 6.3.2.60 through directed mutation; the nucleotide sequence of the enzyme is any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

6. The enzyme as described in claim 5, characterized in that, The nucleotide sequence of the enzyme is as shown in SEQ ID NO:

4.

7. The use of the enzyme according to any one of claims 5-6 for the high-conversion preparation of high-purity cyclic peptides, characterized in that, The preparation of the cyclic peptide first involves the organic synthesis of a short peptide sequence or its fragment, followed by cyclization catalyzed by the enzyme described in any one of claims 5-6 to obtain the cyclic peptide product; the cyclic peptide contains Gln, which is located at the beginning or end of the short peptide sequence or its fragment during the cyclization reaction.

Images