A gene induced by sphaerotheca fuliginea, a promoter and application thereof

Abstract

The application discloses a gene, a promoter and application thereof induced by Sclerotinia sclerotiorum, and belongs to the field of plant genetic engineering. The application firstly screens a gene BnLLP which is strongly induced to express after Sclerotinia sclerotiorum infection, and clones a promoter pBnLLP, and verifies that the promoter pBnLLP is a new promoter strongly induced by Sclerotinia sclerotiorum through experiments. The gene regulated by the promoter has a small amount of expression in roots and hypocotyls only, and the promoter is strongly induced by Sclerotinia sclerotiorum, and is not induced by other defense hormones. The gene and the promoter cloned by the application can be applied to plant Sclerotinia sclerotiorum resistance molecular breeding, and the expression of a resistance gene is regulated by the promoter, so that the purpose of improving disease resistance is achieved on the premise of not affecting normal growth and development of rapeseed.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant genetic engineering, and relates to a gene induced by Sclerotinia sclerotiorum, a promoter and application thereof, in particular to cloning and identification of a Brassica napus promoter pBnLLP induced by Sclerotinia sclerotiorum infection and application thereof in plant resistance to Sclerotinia disease. BACKGROUND

[0002] Brassica napus is one of the most important oil crops in the world, and has high economic value and development potential. Rapeseed oil is not only the main source of edible oil but also the ideal raw material for biodiesel, and has a wide range of applications in many fields such as chemical industry and energy. Sclerotinia disease caused by Sclerotinia sclerotiorum is the most important disease in the main rapeseed production areas of China, causing an average annual loss of about 10-20% of rapeseed yield, and up to 80% in the Yangtze River Delta region. In addition, the disease also leads to a decrease in rapeseed oil content and changes in fatty acid composition, seriously affecting the quality of rapeseed oil. Although traditional chemical control has a certain effect, breeding new rapeseed varieties resistant to Sclerotinia disease is still the fundamental way to overcome the disease. At present, no germplasm resources with immunity or high resistance to Sclerotinia disease have been found in rapeseed and its close relatives, making it difficult to effectively solve the disease problem through conventional breeding.

[0003] With the deepening of the study of disease-resistant transcription profiles in some model plants such as Arabidopsis thaliana and rice, many plant defense genes or disease-resistant genes related to pathogen infection have been intensively studied and analyzed. By transforming these candidate genes into rapeseed through transgenic technology, the resistance of rapeseed to Sclerotinia disease can be improved. However, traditional genetic engineering mostly uses constitutive expression promoters such as CaMV35S and ubiquitin promoter. The biggest defect of this type of promoter is that it causes the continuous strong expression of foreign genes in all tissues of the plant throughout its life cycle, leading to the excessive consumption of intracellular substances and energy, interfering with the metabolic balance of the plant or producing toxic substances that hinder the growth of the plant. In addition, the high expression of some disease-resistant genes often causes changes in other agronomic traits while improving the resistance of rapeseed to Sclerotinia. In recent years, the use of inducible promoters or tissue-specific promoters has been increasingly valued in plant genetic engineering. Although some stress-induced promoters have been identified and utilized, there are few reports on Sclerotinia-induced promoters. Therefore, the development of Sclerotinia-induced promoters and the use of the promoters to construct expression vectors of Sclerotinia disease-resistant genes for genetic transformation have important practical significance and application prospects for high yield, stable yield and molecular breeding of Sclerotinia disease-resistant rapeseed. SUMMARY

[0004] The present application aims to overcome some defects in the prior art, and provides a gene induced by Sclerotinia sclerotiorum, a promoter and application thereof.

[0005] In order to achieve the above technical purposes, the present application adopts the following technical solutions.

[0006] The present application first provides a gene BnLLP induced by Sclerotinia sclerotiorum, and the nucleotide sequence of the gene is shown in SEQ ID No: 1.

[0007] In the present application, through transcriptomic analysis and quantitative PCR (qRT-PCR) verification before and after infection of Brassica napus resistant and susceptible materials, a gene BnLLP (BnaA05g24230D) induced by Sclerotinia sclerotiorum is screened, and the nucleotide sequence is shown in SEQ ID No: 1, and the gene is only expressed in a small amount in the root and hypocotyl of the oilseed rape.

[0008] The present application further provides a recombinant vector comprising the gene BnLLP.

[0009] The present application further provides a recombinant engineering bacterium comprising the gene BnLLP or the recombinant vector.

[0010] The present application further provides a promoter pBnLLP induced by Sclerotinia sclerotiorum, and the nucleotide sequence of the promoter pBnLLP is shown in SEQ ID No: 2.

[0011] The present application clones the promoter of the gene BnLLP in Brassica napus, and the promoter is named as pBnLLP, and according to the embodiment of the present application, the driving GFP reporter gene (pBnLLP::GFP) of the promoter is transiently expressed in tobacco leaves, and it is found that the GFP can be induced and expressed by Sclerotinia sclerotiorum.

[0012] In order to further verify the Sclerotinia sclerotiorum inducible promoter, the present application constructs a recombinant vector in which the promoter is fused with a GUS gene and is stably expressed in Arabidopsis thaliana. The staining result shows that GUS is only displayed in blue in the root and hypocotyl, which is consistent with the quantitative PCR expression result of the BnLLP gene in each tissue of the oilseed rape, and is significantly induced and expressed after being treated by Sclerotinia sclerotiorum, and is not obviously induced and expressed after being treated by defense hormones such as salicylic acid (SA), ethylene precursor (aminocyclopropane carboxylic acid, ACC), methyl jasmonate (MeJA), auxin (IAA) and hydrogen peroxide (H2O2). Therefore, it is verified by the experiment that the pBnLLP belongs to the Sclerotinia sclerotiorum inducible promoter.

[0013] The application further provides a recombinant vector, wherein the vector comprises the promoter, and the vector comprises pCAMBIA1302-pBnLLP-GFP-NOS or pCAMBIA1301-pBnLLP-GUS-NOS.

[0014] The application further provides a recombinant engineering bacterium, wherein the recombinant engineering bacterium comprises the promoter or the recombinant vector.

[0015] The application further provides application of the gene BnLLP, the promoter pBnLLP, the recombinant vector and the recombinant engineering bacterium in improving resistance of a plant to sclerotinia.

[0016] Further, the application is that: an expression vector comprising the Sclerotinia-induced Brassica napus promoter pBnLLP is transformed into a target plant, so that the plant is controlled against the sclerotinia.

[0017] The application further provides a method for identifying the Sclerotinia-induced Brassica napus promoter pBnLLP, and the method comprises the following steps:

[0018] The tissue-specific expression of the promoter BnLLP gene in Brassica napus and the expression under treatment of Sclerotinia is analyzed by qRT-PCR; it is found in the application that the expression amount of BnLLP is slightly high in a hypocotyl and a root, and the expression amount of BnLLP is low in other tissues such as a leaf, a silique, a fruit pod and a stem, and the expression of the BnLLP gene is significantly up-regulated after being infected by Sclerotinia.

[0019] The Brassica napus promoter pBnLLP is cloned, and the promoter is used to drive transient expression of a GFP reporter gene in tobacco, so that whether the GFP reporter gene controlled by pBnLLP can respond to Sclerotinia infection is detected; it is found in the application that the fluorescence signal of GFP can be detected after Sclerotinia infection, and no green fluorescence signal can be detected without Sclerotinia infection, Figure 5 ), which indicates that pBnLLP is a Sclerotinia-induced promoter.

[0020] A recombinant vector in which the promoter pBnLLP is fused with a GUS gene is constructed and stably expressed in Arabidopsis thaliana, and expression of the GUS gene in each tissue of the Arabidopsis thaliana and induced expression after treatment of Sclerotinia, hormones and the like are analyzed; it is found in the application that the GUS gene basically has no expression without Sclerotinia infection, but with the increase of Sclerotinia infection time, the leaf of the pBnLLP::GUS Arabidopsis thaliana transformation strain is deepened in blue, and the expression amount of GUS continuously increases. However, basically no blue color is generated after treatment of hormones and hydrogen peroxide. These results indicate that the pBnLLP promoter is strongly induced by Sclerotinia, and the downstream gene of the gene controlled by the promoter can respond to Sclerotinia infection.

[0021] The application has the following beneficial effects:

[0022] The application identifies a gene BnLLP (BnaA05g24230D) strongly induced by S. sclerotiorum through transcriptome analysis and quantitative PCR (qRT-PCR) verification before and after infection of Brassica napus resistant and susceptible materials, and finds that the gene is only expressed in a small amount in the roots and hypocotyls of Brassica napus. The promoter of the gene is cloned in Brassica napus variety Zhongshuang 11 and named as pBnLLP, and the obtained promoter is induced by S. sclerotiorum through the identification method of the application.

[0023] The promoter of the application is a S. sclerotiorum inducible promoter, which can control the expression of disease resistance related genes, so that the genes are highly expressed only when infected by S. sclerotiorum, and the genes controlled by the promoter are not expressed or have a background expression when not infected by S. sclerotiorum, so that the growth and development of Brassica napus under normal conditions are not affected, and the disease resistance is improved.

[0024] The tobacco transient expression system used in the application utilizes the driving of the promoter pBnLLP to efficiently express the reporter gene GFP in tobacco, so that the S. sclerotiorum inducible promoter can be quickly screened and judged under the treatment of S. sclerotiorum, and compared with the current method of transforming plants with promoters, the time for screening and identifying the inducible promoter in the early stage is greatly shortened.

[0025] The application first applies the technical system and method of transcriptome, tobacco transient expression system and Arabidopsis stable transformation system to screen a plant promoter pBnLLP strongly induced by S. sclerotiorum. The promoter is used to regulate the expression of disease resistance genes for genetic transformation, so that the expression of resistance genes is strongly induced only when infected by S. sclerotiorum, which provides a new strategy and idea for crop breeding against Sclerotinia disease, and has a good application prospect in crop resistance improvement. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 BnLLP (BnaA05g24230D) is a gene induced and expressed in resistant and susceptible materials after infection by S. sclerotiorum; figure a is a heat map of the induced and expressed genes identified by cluster analysis of transcriptome, the horizontal axis represents 0h and 24h of S. sclerotiorum infection of the susceptible variety 888-5 and the resistant variety M083, respectively; the vertical coordinate represents gene ID; the double-peak cluster analysis of the heat map shows that the log2 relative expression amount changes from blue (low expression) to red (high expression). Figure b is the expression of BnLLP (BnaA05g24230D) induced by S. sclerotiorum, wherein the relative expression amount is from transcriptome data.

[0027] Figure 2Figure 6 shows the expression of BnLLP in different tissues of Brassica napus. The expression level was normalized by the expression of Actin gene and the relative expression was compared with the expression in leaves. Standard error was from triplicate (t-test: *, P < 0.05, **, P < 0.01, ***, P < 0.001, ****, P < 0.0001).

[0028] Figure 3 Figure 7 shows the time-course expression of BnLLP in Zhongshuang 11 (resistant material) and Ningyou 12 (susceptible material) after S. sclerotiorum infection. The expression level was normalized by the expression of Actin gene and the relative expression was compared with the value at 0 h. Standard error was from triplicate (t-test: *, P < 0.05, **, P < 0.01, ***, P < 0.001, ****, P < 0.0001).

[0029] Figure 4 Figure 8 shows the structure of recombinant expression vectors pCAMBIA1302-pBnLLP-GFP-NOS and pCAMBIA1301-pBnLLP-GUS-NOS containing pBnLLP.

[0030] Figure 5 Figure 9 shows the results of transient expression in tobacco for identifying the S. sclerotiorum inducible promoter pBnLLP. In the figure, Mock and Ss represent water and S. sclerotiorum treated leaves, respectively, 35S::GFP represents tobacco leaves injected with 35S::GFP recombinant vector, and pBnLLP::GFP represents tobacco leaves transformed with pCAMBIA1302-pBnLLP-GFP-NOS vector. Tobacco epidermal cells were observed under a fluorescence microscope 24 h after S. sclerotiorum treatment. The magnification in the figure is 0.5x, and Bar = 1000 μm.

[0031] Figure 6 Figure 10 shows the results of PCR identification of positive lines of Arabidopsis thaliana containing recombinant vector pBnLLP::GUS. In the figure, M is DL5,000 DNA Marker, + is positive plasmid control, col is wild type control, - is water control, and 1-6 are independent Arabidopsis thaliana transformed lines containing recombinant vector.

[0032] Figure 7Figure 1 is the expression of pBnLLP promoter and GUS fusion gene in different tissues of Arabidopsis seedlings (a-g) and seedlings (h-j); Figure a-g: GUS staining results of whole seedlings, apical meristem, leaf 1, leaf 2, hypocotyl, root, root tip of seedlings, respectively; Figure h-j: GUS staining results of root, flower, silique of seedlings, respectively, arrows 1, 2 represent leaf 1 (c figure), leaf 2 (d figure).

[0033] Figure 8 Figure 2 is the expression of pBnLLP promoter and GUS fusion gene under different stress induction of Arabidopsis; Figure a: GUS staining results at different time periods (12h and 24h) after Sclerotinia infection, 0h (i.e. before infection) as a control; Figure b: GUS staining results after 24h treatment of salicylic acid (SA), ethylene (aminocyclopropane carboxylic acid, ACC), methyl jasmonate (MeJA), auxin (IAA), hydrogen peroxide (H2O2), water (Mock) treatment as a control. Bar = 4mm. DETAILED DESCRIPTION

[0034] In order to make the technical personnel in the art better understand the technical solutions of the present application, the preferred embodiments of the present application are described in detail below, but the following embodiments do not limit the protection scope of the present application.

[0035] In the embodiments of the present application, those not described in detail are completed by using conventional experimental methods, and those not described in detail in the embodiments are understood and easily realized by the technical personnel in the art according to the product manual or the basic knowledge in the art, so they are not described in detail.

[0036] The technical personnel in the art can make various modifications to the present application according to the basic features of the present application without deviating from the spirit and use range of the present application, so as to adapt to various uses and conditions.

[0037] Example 1: Transcriptional genomics screening and identification of genes BnLLP strongly induced by Sclerotinia

[0038] Rape M083 (highly resistant to Sclerotinia) and rape 888-5 (highly susceptible to Sclerotinia) (provided by Mr. Liu Shengyi, Institute of Oil Crops, Chinese Academy of Agricultural Sciences, as a known material, and the transcriptional genome analysis was completed by Mr. Liu Shengyi's research group, Institute of Oil Crops, Chinese Academy of Agricultural Sciences) were used as materials. The two kinds of rape plants were grown in a culture room, and the growth conditions were as follows: temperature was 20 + 2℃; day light cycle was 8h light and 16h dark; light intensity was 44μmol m -2 s -1 ; relative humidity was 60%-90%.

[0039] Fresh sclerotia of Sclerotinia sclerotiorum (collected from the rape stem in Jiangsu University, identified as known strain, also can be purchased commercially) were inoculated with mycelium on PDA medium for activation. The activated new edge mycelium of Sclerotinia sclerotiorum (7 mm in diameter) was inoculated in the upper part of the rape leaf near the main vein, and the whole rape plant was placed in a turnover box, and the turnover box was covered with a fresh film to keep the humidity. The leaves were taken 24 hours after inoculation, and the leaves inoculated with PDA blocks without mycelium were used as controls. Each material of control and treatment was set with three biological replicates.

[0040] RNA extraction used RNeasy Plant Mini Kit (Qiagen, Cat. # 74904), and then mRNA-Seq sample preparation kit (Cat# RS-930-1001, Illumina Inc., San Diego, CA) was used to construct cDNA library, according to the manufacturer's instructions.

[0041] Illumina HiSeqTM 2000 system was used for sequencing.

[0042] RPKM (Reads Per Kilobase per Million mapped reads) method was used to calculate the expression of genes.

[0043] FDR (false discovery rate) control method was used to determine the threshold of P value in multiple tests to calculate the significance of expression abundance difference. According to the screening threshold FDR < 0.05, log2 FC >2 or log2 FC <-2 to screen differentially expressed genes (FC represents fold change).

[0044] The above methods are all conventional biological methods in the technical field.

[0045] In this embodiment, through the transcriptomic analysis of the resistant and susceptible materials (referring to the aforementioned rape M083 and rape 888-5 materials) before and after Sclerotinia sclerotiorum infection, 36 genes significantly up-regulated in resistant and susceptible materials were found, among which BnaA05g24230D (the gene is named as BnLLP) gene was strongly induced by Sclerotinia sclerotiorum infection, and the gene was basically not expressed without Sclerotinia sclerotiorum infection, as shown in Figure 1 Figure 1 ​Fig. 8 is the result of transcriptomic analysis of genes induced to express after S. sclerotiorum infection in resistant and susceptible materials, wherein Fig. a is a cluster analysis of the induced genes identified by transcriptomic analysis; the horizontal axis represents 0h and 24h after S. sclerotiorum infection of the susceptible variety 888-5 and the resistant variety M083, respectively, and the vertical axis represents gene ID, and the bimodal cluster analysis of the heat map shows the log2 relative expression from blue (low expression) to red (high expression). Fig. b is the result of BnLLP (BnaA05g24230D) induced expression after S. sclerotiorum infection. The relative expression is from transcriptomic data.

[0046] The nucleotide sequence of BnaA05g24230D (the gene is named as BnLLP) is shown as SEQ ID NO. 1:

[0047] SEQ ID NO. 1:

[0048] ATGCAGATTCACAAACTCTGTTTCCTTGCTCTGTTCTTAGCTCAAGCAGCCTTTGCCGTCAAGTTCAACTTCAAAACCTTTAATGGAGACAACTTGTTCTTCCTCGGAGACGCAGAGCTTGGTCCTTCCTCCGACGGTTTAGACCGATCCGGAGCTTGGTCCATGACCCGTGACGAAACCCCATTCTCTCACGGTCAAGGTCTCTACATCAACCCCATCCCATTCAAACCCTCCAACGATTCTGCTCCTTACTCATTCCAGACCTCTTTCACTTTCTCCATCACTCCCCGCACCAAGCCAAACTCCGGCCAAGGCCTCGCCTTCATCGTCGTCCCCACCGTCGACAACTCCGGCGCTTCCGGCGGCGGGTTCCTCGGAATCCTCAACAAAACCAACAACGGTAAACCGGAGAACAACCTCTTTGCCGTTGAGTTCGACACTTTCCAGAACAAGGAGTTCCAAGACATAAGTGGTAACCACGTCGGGCTCAACATCAACTCCATGACTTCGAACGTAGCGGAGAAAGCTGGTTACTGGGTTCAGACAAGAGTCGGGAAGAGGAAGGTTTGGTCGTTCAAAGATGTGAACCTGAGCAGTGGAGAGAGGTTCACGGCTTGGATTGAGTTTAGAAACAAAGACAATAGGATTACCATTACGCTCGCGCCTGAGAACGTGAAGAAGCCTAAGAGACCTTTGATACAAGGTCCGAGAGAGCTCAATGATGTTATTCTACAAAACAGTTACGTCGGTTTTGCTGGTTCCATGGGACGTGCCGCTGAGCGTCACGATATCTGGAGCTGGTCTTTCGAAAATGCCGCCAAGAACAACTAA

[0049] Example 2: Specific expression of BnLLP gene in different tissues of Brassica napus

[0050] The Brassica napus Zhongshuang 11 (from Jiangsu Academy of Agricultural Sciences, as a known material) was used as the experimental material, and the growth conditions were as described in Example 1. The leaf, stem, stem tip, young root, mature root, young siliques, mature siliques, silique wall and hypocotyl were sampled, respectively. The fresh samples were quickly frozen with liquid nitrogen and stored in a -70°C ultra-low temperature refrigerator for standby. Three replicates were set for each sample. The total RNA of each tissue of Brassica napus was extracted by Trizol reagent kit rapid extraction method. The cDNA synthesis was performed by using total RNA as template and reverse transcription kit (Q RT SuperMix for Q-PCR, purchased from Nanjing Novozyme Biotech Co., Ltd.) according to the instruction manual. Q RT SuperMix for Q-PCR, purchased from Nanjing Novozyme Biotech Co., Ltd.) according to the instruction manual.

[0051] The real-time fluorescent quantitative PCR primer was designed according to the non-conserved region of BnLLP gene (BnaA05g24230D) sequence, and the primer sequence was as follows:

[0052] BnLLP-F (SEQ ID No: 3): 5'-CAGTGGAGAGAGGTTCACGG-3'

[0053] and BnLLP-R (SEQ ID No: 4): 5'-TGAGCTCTCTCGGACCTTGT-3'.

[0054] The Brassica napus Actin gene (GenBank: AF111812.1) was selected as the internal reference gene, and the internal reference primer sequence was as follows:

[0055] Actin-F (SEQ ID No: 5): 5'-TGTTGCTATCCAGGCTGTTCTTTC-3'

[0056] and Actin-R (SEQ ID No: 6): 5'-GATAGCGTGAGGAAGAGCATAACC-3'. The specific operation method of qRT-PCR was performed according to the instruction manual of Green Master Mix kit

[0057] The experimental data was plotted by using GraphPad Prism 7 software. Taking the expression level of Brassica napus leaf as the control, it was found that the expression level of BnLLP was slightly high in hypocotyl and root, and was low in other tissues such as leaf, silique, fruit pod and stem (the results were shown in Figure 2 .

[0058] Example 3: Induced expression of BnLLP gene in Brassica napus after infection of Sclerotinia sclerotiorum

[0059] ​In order to explore whether BnLLP is induced by S. sclerotium, two test materials were selected in this embodiment, one is the resistant variety Zhongshuang 11, and the other is the susceptible variety Ningyou 12 (seeds were purchased from Wuhan Zhongyou Seed Industry Technology Co., Ltd.). The leaf inoculation method and strain in Example 1 were adopted, and the same size of S. sclerotium blocks were inoculated on the rape leaves. In order to reduce experimental errors, the inoculation positions should be as same as possible. The leaves were collected at 0 h, 24 h, 36 h and 48 h after S. sclerotium infection, and 0 h (i.e. before inoculation) was used as a control. Each time period treatment was set with 3 biological replicates. The operation methods of RNA extraction, reverse transcription, quantitative PCR primer and qRT-PCR were consistent with those in Example 2.

[0060] By analyzing the expression trend of BnLLP gene in resistant and susceptible materials, it was found that whether in the resistant variety Zhongshuang 11 or in the susceptible variety Ningyou 12, BnLLP gene was significantly up-regulated after S. sclerotium infection, and the induction amount in the resistant variety Zhongshuang 11 was significantly higher than that in the susceptible variety Ningyou 12 (results are shown in FIG. 1, where ZS11 represents the variety Zhongshuang 11, and NY12 represents the variety Ningyou 12). Figure 3

[0061] Example 4: Cloning of pBnLLP promoter

[0062] The promoter sequence of BnLLP gene (BnaA05g24230D) was obtained by searching and analyzing in Brassica napus Genome Brows database (https: / / www.genoscope.cns.fr / brassicanapus), and the sequence is shown as SEQ ID No: 2.

[0063] SEQ ID NO. 2:

[0064] ​

[0065] The primer was designed by using Primer Premier 5 software to analyze the promoter sequence

[0066] pBnLLP-F: 5'-GTCGACAGCCAAAGCA-3' (SEQ ID No: 7);

[0067] pBnLLP-R: 5'-CATGGTGTGTGTTTT-3' (SEQ ID No: 8).

[0068] The CTAB method was used to extract the Zhongshuang 11 genomic DNA, and 1 μL of the genomic sample was used to determine the concentration by One-Drop 1000. If the OD260 / 280 was about 1.8, it indicated that the DNA had good purity and could be used as a template for PCR reaction. The PCR reaction system and reaction program are shown in Table 3 and Table 4, respectively.

[0069] Table 3. PCR reaction system for promoter amplification

[0070]

[0071] Table 4. PCR reaction program for promoter amplification

[0072]

[0073] The above PCR amplified product was subjected to agarose gel electrophoresis at 120V for 35 min. The recovered BnLLP gene promoter fragment was ligated with pMD19-T vector (purchased from Baori Medical Biotechnology (Beijing) Co., Ltd.), and the E. coli DH5a competent cells (purchased from Nanjing Novozyme Biotech Co., Ltd.) were transformed and positive clones were picked and sent to Genechem Biotech (Shanghai) Co., Ltd. for sequencing. The plasmid was named pMD19-pBnLLP.

[0074] Sequence analysis found that the promoter sequence was located about 2300 bp upstream of the start codon ATG, and the nucleotide sequence was shown in SEQ ID NO: 2, which was the pBnLLP promoter sequence.

[0075] Example 5: Construction of recombinant vector of pBnLLP and GFP gene fusion and transient expression in tobacco

[0076] The pMD19-pBnLLP was used as a template to amplify the BnLLP promoter sequence by PCR, and the PCR product was digested with Ncol and BamHI, and then ligated with the pCAMBIA1300 vector (purchased from Beijing Transgenomics Biotechnology Co., Ltd.) which had been digested with Ncol and BamHI to construct the pBnLLP vector. The IIOne Step Cloning Kit works by adding SalⅠ and NcoⅠ restriction sites and homologous arm sequences (underlined) to the 5' ends of pBnLLP-F (SEQ ID No:7) and pBnLLP-R (SEQ ID No:8), respectively. The upstream and downstream primer sequences are designed as follows:

[0077] pBnLLP::GFP-F:5'- CGGGGATCCTCTAGA GTCGACAGCCAAA-3'(SEQ ID No:9);

[0078] pBnLLP::GFP-R:5'- TTACTAGTCAGATCTACCATGG TGTGTGTT-3' (SEQ ID No: 10).

[0079] The pMD19-pBnLLP plasmid successfully constructed in Example 4 was used as a template for PCR amplification using primers pBnLLP::GFP-F / R. The PCR reaction system and procedure are shown in Tables 5 and 6, respectively.

[0080] Table 5. PCR reaction system for promoter amplification using primer pBnLLP::GFP-F / R

[0081]

[0082] Table 5. PCR reaction procedure for promoter amplification using primers pBnLLP::GFP-F / R

[0083]

[0084] Meanwhile, the pCAMBIA1302-GFP-NOS vector (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) was double-digested with SalⅠ and NcoⅠ to remove the 35S strong promoter of the vector, thereby obtaining the sticky ends after SalⅠ and NcoⅠ digestion for ligation.

[0085] The empty pCAMBIA1302-GFP-NOS vector was digested at 37℃ for 2 hours. The sample was then run on a 1% agarose gel, and the target band (the pCAMBIA1302-GFP-NOS vector sequence after 35S excision, with sticky ends after SalⅠ and NcoⅠ digestion) was recovered from the gel.

[0086] according to The target fragment (pBnLLP promoter sequence of the application) required by the One Step Cloning Kit (one-step) instruction manual was connected with the linearized vector fragment (pCAMBIA1302-GFP-NOS vector sequence after double digestion and 35S removal) at a ratio, and the reaction was carried out at 37°C for 2h, and then quickly cooled on ice after the reaction was completed. Next, 10μL of the ligation product was transferred to E. coli DH5α, and the correct bacterial liquid was selected for sequencing, and the plasmid pCAMBIA1302-pBnLLP-GFP-NOS vector was extracted and the recombinant vector was transformed into Agrobacterium GV3101 (the structure of the recombinant vector is shown in Figure 4 a).

[0087] N. benthamiana has a short culture period, and the tobacco transient expression system has been relatively mature in the inventors' laboratory. For specific methods, refer to the inventors' published paper (Ding et al., Arabidopsis GDSL1 overexpression enhances rapeseed Sclerotinia sclerotiorum resistance and the functional identification of its homolog in Brassica napus. Plant Biotechnol Journal, 2020, 18(5): 1255-1270). Tobacco plants injected with 35S::GFP recombinant vector (N. benthamiana, a known material) were used as positive controls, and empty Agrobacterium GV3101 induced suspension was used as negative control (blank leaf Mock, blank leaf + Ss), and GFP was transiently expressed in tobacco driven by the pBnLLP promoter. After 24h of S. sclerotiorum treatment, the tobacco lower epidermal cells were observed using an upright fluorescence microscope. It was found that GFP fluorescence signal could be detected after S. sclerotiorum infection, but no green fluorescence signal could be detected without S. sclerotiorum infection Figure 5 ), indicating that pBnLLP is likely a S. sclerotiorum inducible promoter.

[0088] Figure 5 Results of tobacco transient expression for identifying S. sclerotiorum inducible promoter pBnLLP. In the figure, Mock and Ss represent water and S. sclerotiorum treated leaves, respectively, 35S::GFP represents tobacco leaves injected with 35S::GFP recombinant vector, and pBnLLP::GFP represents tobacco leaves transformed with pCAMBIA1302-pBnLLP-GFP-NOS vector. After 24h of S. sclerotiorum treatment, the tobacco lower epidermal cells were observed using an upright fluorescence microscope; the magnification in the figure is 0.5x, and Bar = 1000μm.

[0089] Example 6: Construction of recombinant vector of pBnLLP fused with GUS gene and stable expression in Arabidopsis thaliana

[0090] Similarly, the principle of One Step Cloning Kit was adopted, and the pBnLLP amplification primer sequences were designed as follows: pBnLLP::GUS-F: 5'-GTCGACAGCCAAA-3' (sequence information is the same as SEQ ID No: 9);

[0091] CGGGGATCCTCTAGA pBnLLP::GUS-R: 5'-TGTGTGT-3' (SEQ ID No: 11).

[0092] According to the operation steps in Example 5, the pBnLLP promoter was connected with the pCAMBIA1301-GUS-NOS vector (purchased from Beijing Dingguochangsheng Biotechnology Co., Ltd.) and the recombinant vector pCAMBIA1301-pBnLLP-GUS-NOS was transformed into Agrobacterium GV3101 (the structure of the recombinant vector is shown in TTACCCTCAGATCTACCATGG b).

[0093] The pCAMBIA1301-pBnLLP-GUS-NOS vector was introduced into the Columbia type Arabidopsis thaliana (publicly known material, inventor's experimental retention) by the Agrobacterium flower dipping method, and after the seeds were harvested, they were sown in 1 / 2MS solid medium with 30 mg / L Hyg resistance for screening. The extracted genome of the screened seedlings was subjected to PCR identification of positive plants Figure 4 ), and the positive transgenic seeds were harvested.

[0094] The PCR identification results of the positive Arabidopsis thaliana lines containing the recombinant vector pBnLLP::GUS are shown in the figure. In the figure, M is DL5,000 DNA Marker, + is a positive plasmid control, col is a wild type control, - is a water control, 1-6 are independent Arabidopsis thaliana transformation lines containing the recombinant vector, and the transformation is successful, which is a positive plant. Figure 6

[0095] Figure 6 The PCR identification results of the positive Arabidopsis thaliana lines containing the recombinant vector pBnLLP::GUS are shown in the figure. In the figure, M is DL5,000 DNA Marker, + is a positive plasmid control, col is a wild type control, - is a water control, 1-6 are independent Arabidopsis thaliana transformation lines containing the recombinant vector, and the transformation is successful, which is a positive plant.

[0096] Example 7: Analysis of GUS expression level in each tissue of pBnLLP::GUS transgenic Arabidopsis thaliana

[0097] ​​Take 1 / 2MS medium grown for 12 days of whole seedlings (Arabidopsis thaliana positive transformation, positive seed obtained from Example 6 is planted to get), apical meristem, leaf, hypocotyl, root; In addition, take 1 / 2MS medium grown for 12 days, light incubator (16h light 8h dark temperature 20±2℃) soil culture for about 20 days of Arabidopsis thaliana root, leaf and silique (Arabidopsis thaliana positive transformation, positive seed obtained from Example 6 is planted to get), the obtained material sample is GUS staining (GUS staining solution is purchased from Wuhan Boyuan Biotechnology Co., Ltd.). After 12h of 37℃ dark staining, decolorizing solution is prepared by ethanol and acetic acid with a volume ratio of 1:1, the material is added to the decolorizing solution and replaced every 3-4h until the chlorophyll in the material is completely washed out, a camera or inverted fluorescence microscope can be used to observe the material after GUS staining. The GUS staining results show that the expression of GUS gene in the apical meristem, root and hypocotyl of Arabidopsis thaliana seedling stage is slightly high, and the expression in other tissues is relatively low Figure 7 ), which is consistent with the expression pattern of BnLLP gene in each tissue of Brassica napus in Example 2.

[0098] Figure 7 The expression of pBnLLP promoter and GUS fusion gene in different tissues of Arabidopsis thaliana seedlings (a-g) and seedlings (h-j); Figures a-g represent the GUS staining results of whole seedlings, apical meristem, leaf 1, leaf 2, hypocotyl, root and root tip of seedlings, respectively; Figures h-j represent the GUS staining results of root, flower and silique of seedlings, respectively, and arrows 1,2 represent leaf 1 (c) and leaf 2 (d), respectively.

[0099] Example 8: Analysis of GUS expression level of pBnLLP::GUS transgenic Arabidopsis thaliana after S. sclerotiorum inoculation and hormone stress treatment

[0100] Take pBnLLP::GUS Arabidopsis thaliana transformation strain (Arabidopsis thaliana positive transformation, positive seed obtained from Example 6 is planted to get) grown for about 35 days, and inoculate the mycelial block of the same size of S. sclerotiorum (the same strain as in Example 1) on one side of the main leaf vein of the leaf, and place it in a foam box covered with plastic wrap for light protection and moisture preservation. Take the leaves inoculated for 12h and 24h for GUS staining analysis and photograph observation, and take the PDA medium block without S. sclerotiorum as a control (Mock) with three biological replicates. The GUS staining method is referred to Example 7.

[0101] The leaves of pBnLLP::GUS Arabidopsis thaliana transformation plants grown for about 35 days were evenly sprayed with hormones and H2O2 in vivo, and the degree of leaf dripping water was used as a standard. Distilled water was used as a control. The treatment concentrations were: 1 mM SA (salicylic acid), 1 μM ACC (ethylene precursor, aminocyclopropane carboxylic acid), 0.1 mM MeJA (methyl jasmonate), 5 mM H2O2, and 1 μM IAA (auxin). After spraying, the leaves were kept moist using plastic wrap. Sampling and GUS staining analysis were performed 12 h after treatment, and three biological replicates were set. The GUS staining method is described in Example 7.

[0102] The GUS staining results after treatment with S. sclerotiorum and different abiotic stresses showed that the GUS gene was not expressed when the plants were not infected with S. sclerotiorum. However, as the infection time of S. sclerotiorum increased, the blue color of the leaves of pBnLLP::GUS Arabidopsis thaliana transformation plants deepened, and the expression of GUS also increased continuously, which was significantly different from the control Figure 8 a). However, after treatment with hormones and hydrogen peroxide, there was basically no blue color Figure 8 b). These results showed that the pBnLLP promoter was strongly induced by S. sclerotiorum, and the downstream genes of the genes regulated by the promoter could respond to S. sclerotiorum infection. In addition, the promoter was not induced by SA, JA, ethylene, H2O2, etc.

Claims

1. A S. sclerotiorum-induced Brassica napus promoter p BnLLP, characterized in that the nucleotide sequence of said promoter p BnLLP is represented by SEQ ID No:

2.

2. A recombinant vector, characterized in that, The recombinant vector comprises the promoter of claim 1.

3. The recombinant vector of claim 2, comprising pCAMBIA1302-pBnLLP-GFP-NOS or pCAMBIA1301-pBnLLP-GUS-NOS.

4. Recombinant engineering bacteria, comprising the promoter of claim 1, or comprising the recombinant vector of claim 2 or 3.

5. The promoter p of claim 1 BnLLP, or the recombinant vector of claim 2 or 3, or the recombinant engineering bacteria of claim 4 for use in improving the resistance of plants to sclerotinia disease.

6. Use according to claim 5, characterized in that, The recombinant vector comprising the Sclerotinia-induced Brassica napus promoter p BnLLP is transformed into the target plant.

7. The Sclerotinia-induced Brassica oleracea promoter p BnLLP method for identifying a compound, characterized in that, The method comprises using any one or any combination of the following: (1) Analysis by qRT-PCR BnLLP Tissue-specific expression of genes in Brassica napus and expression upon S. sclerotiorum treatment; (2) Cloning of Brassica napus promoter p BnLLP and using this promoter to drive the transient expression of GFP reporter gene in tobacco, detecting whether the GFP reporter gene regulated by p BnLLP can respond to the infection of S. sclerotiorum. (3) Constructing promoter p BnLLP The recombinant vector fused with GUS gene was stably expressed in Arabidopsis, and the expression of GUS gene in different tissues of Arabidopsis and the induced expression after S. sclerotiorum and hormone treatment were analyzed.

Images