A Multiplex qPCR Detection Kit for Identifying Mycobacterium tuberculosis and NTM Bacteria and Its Application

Abstract

This invention discloses a multiplex qPCR detection kit for identifying Mycobacterium tuberculosis and NTM bacteria, and its application. The kit contains primers and probes for Mycobacterium tuberculosis and 11 NTM bacteria. The probes are modified with locked nucleic acids to improve detection specificity. This kit enables quadruple qPCR detection. Clinical sample nucleic acid testing showed a detection limit as low as 200 copies / mL. It exhibits no cross-reactivity with many strains with high homology or similar clinical symptoms. A single reaction can complete the detection of 11 NTM nucleic acids and Mycobacterium tuberculosis nucleic acids within 50 minutes, greatly improving detection efficiency and playing an auxiliary role in the diagnosis of tuberculosis.

Description

Technical Field

[0001] This invention relates to the field of gene diagnostics, and more specifically to a multiplex qPCR detection kit for identifying Mycobacterium tuberculosis and NTM bacteria and its application. Background Technology

[0002] Tuberculosis (TB) is a systemic chronic infectious disease caused by the Mycobacterium tuberculosis complex (MTC), including Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium volesii, and Mycobacterium africanum, transmitted through the respiratory tract. It is also known as the "white plague" and is widespread globally. Mycobacterium tuberculosis is highly pathogenic, often causing histiocytic lesions after infection, and long-term infection can lead to symptoms such as cough, low-grade fever, and difficulty breathing. Non-tuberculous mycobacteria (NTM), i.e., mycobacteria other than the Mycobacterium tuberculosis complex and Mycobacterium leprae, are widely present in the environment, and the pathogenicity varies among different species. Clinical sample strain isolation shows that more than ten NTM bacteria, including Mycobacterium abscessus, Mycobacterium kansasii, Mycobacterium intracellulare, Mycobacterium avium, Mycobacterium guildrums, and Mycobacterium occulta, can invade the human body through the respiratory tract, gastrointestinal tract, and skin, posing a public health hazard.

[0003] Tuberculosis is a chronic disease, usually treated with medication. First-line anti-tuberculosis drugs such as rifampin, isoniazid, and quinolones, combined with other antibiotics, have good therapeutic effects on most non-drug-resistant tuberculosis patients. When patients are infected with NTM bacteria, the clinical symptoms are similar to those of mycobacterial tuberculosis, easily leading to misdiagnosis. Incorrect medication may accelerate the development of bacterial resistance, resulting in treatment failure or even lifelong incurable consequences. Rapid identification of the pathogen can guide doctors in clinical medication and reduce the risk of bacterial resistance; therefore, MTC / NTM typing is of great importance.

[0004] Because most non-tumor diseases (NTMs) have similar symptoms to tuberculosis, they are difficult to distinguish using conventional diagnostic methods. In clinical practice, smear microscopy is commonly used, but this method requires high bacterial concentrations, and false negatives are frequently observed in clinical samples. Another method is bacterial isolation and culture. The advantage of this method is that it can enrich colonies through culture, resulting in relatively high detection sensitivity. However, this method also has drawbacks; slow-growing mycobacteria often require 2-3 weeks to form visible colonies, and the culture period for *Mycobacterium ulcerans* can be as long as 8 weeks. Furthermore, the lengthy experimental period increases the risk of infection for operators. To shorten diagnostic time, more new technologies are being applied to the detection of mycobacterial diseases.

[0005] Molecular diagnostic technology uses genes as detection targets. qPCR technology is a relatively mature molecular diagnostic technology. It adds a TaqMan probe to two primers. After binding to specific sites, it releases fluorescent groups using the cleavage activity of Taq enzyme. The machine collects the fluorescence signal in real time and presents the image results. The detection time is usually within 2 hours. It has the characteristics of rapid detection, high sensitivity and strong specificity. Summary of the Invention

[0006] Objective of this invention: The objective of this invention is to provide a sensitive detection kit for distinguishing Mycobacterium tuberculosis from various NTM bacteria (Intracellular Mycobacterium, Bufota, Mycobacterium Kansas, Mycobacterium avium, Mycobacterium scrofula, Mycobacterium occulta, Mycobacterium cypriniformis, Mycobacterium smegmatis, Mycobacterium marineum, Mycobacterium Gordonum, and Mycobacterium abscessum); another objective of this invention is to provide the application of this kit based on multiplex qPCR detection in the identification of Mycobacterium tuberculosis from various NTM bacteria.

[0007] Technical Solution: To achieve the above-mentioned objectives, the present invention provides a detection kit comprising specific probes and internal standard gene primers for quadruple qPCR detection. The specific probes include probes for Mycobacterium tuberculosis, Mycobacterium abscessus, Mycobacterium kansas, Mycobacterium toadense, Mycobacterium avium, Mycobacterium guilloché, Mycobacterium smegmatis, Mycobacterium marinum, Mycobacterium Gordonum, Mycobacterium intracellularis, and Mycobacterium scrofula.

[0008] Further, the specific probes include: a Mycobacterium tuberculosis probe having the nucleotide sequence shown in SEQ ID NO:1; a Mycobacterium abscessus probe having the nucleotide sequence shown in SEQ ID NO:2; a Mycobacterium kansasus probe having the nucleotide sequence shown in SEQ ID NO:3; a Mycobacterium toadense probe having the nucleotide sequence shown in SEQ ID NO:4; a Mycobacterium avium probe having the nucleotide sequence shown in SEQ ID NO:5; a Mycobacterium guillochénia probe having the nucleotide sequence shown in SEQ ID NO:6; a Mycobacterium sporadicum probe having the nucleotide sequence shown in SEQ ID NO:7; a Mycobacterium smegmatis probe having the nucleotide sequence shown in SEQ ID NO:8; a Mycobacterium marineum probe having the nucleotide sequence shown in SEQ ID NO:9; a Mycobacterium Gordonii probe having the nucleotide sequence shown in SEQ ID NO:10; an intracellular Mycobacterium probe having the nucleotide sequence shown in SEQ ID NO:11; and a Mycobacterium scrofula probe having the nucleotide sequence shown in SEQ ID NO:1. The nucleotide sequence shown in NO:12; wherein any number of the specific probes have a 5' fluorescent group modification and / or a 3' quencher group modification.

[0009] Furthermore, the fluorescent group is selected from any one of, including but not limited to, FAM, VIC, ROX, and CY5; the quenching group is selected from any one of, including but not limited to, BHQ1 and BHQ2.

[0010] As a preferred embodiment of the present invention, the specific probe includes:

[0011] Mycobacterium tuberculosis probe: AAAGACGTCACAAGCGAGCCGTA

[0012] Mycobacterium abscessus probe: ROX-GCGGGCGACCAGT+CCATCG-BHQ2

[0013] Mycobacterium Kansas probe: FAM-TGT+TTGAG+AATTGGAT-BHQ1

[0014] Mycobacterium bufotae probe: ROX-TGG+TGGTGTTGTGC+TCC-BHQ2

[0015] Mycobacterium avium probe: VIC-CACCG+AGGTCGCGGC+CTTC-BHQ1

[0016] Mycobacterium guildrums probe: VIC-TCGAGAAGGC+CGTGGAGGCC-BHQ1

[0017] Occasional mycobacterial probe: FAM-TAGTGGGC+ACGGT+TTGGT-BHQ1,

[0018] Mycobacterium smegmaeella probe: ROX-CATCTAGT+TCGTAAGAGTG-BHQ2

[0019] Marine mycobacterium probe: FAM-ACC+AGCTC+CGCGACA+AGA-BHQ1

[0020] Gordon's Mycobacterium probe: VIC-ACAC+CCTCGGGTG+CTGTC-BHQ1,

[0021] Intracellular mycobacterial probe: VIC-TGGTGT+TTGAGT+ATTG-BHQ1

[0022] Mycobacterium scrofula probe: ROX-ACGATCAGGTTC+TGGGCGGA-BHQ2;

[0023] In this sequence, the "+" indicates that the base on its right side has locked nucleic acid modification.

[0024] Locked nucleoside (LNA) modifications are bicyclic nucleotide derivatives with structures similar to nucleotides. They exhibit good affinity activity for both DNA and RNA. Due to the strong thermostability of LNA with complementary DNA or RNA double strands, incorporating an LNA base into an oligonucleotide can raise the dissolution temperature by 4°C to 9°C. Compared to conventional TaqMan probes, this method offers better specificity, reduces the probability of false positives, and further improves detection accuracy. Specific probes obtained using this method have a specificity of at least 90%, preferably at least 95%.

[0025] As a preferred embodiment of the present invention, the specific probe includes:

[0026] Mycobacterium tuberculosis probe: AAAGACGTCACAAGCGAGCCGTA, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:13, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:14;

[0027] Mycobacterium abscessus probe: ROX-GCGGGCGACCAGT+CCATCG-BHQ2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:15, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:16;

[0028] Mycobacterium Kansas probe: FAM-TGT+TTGAG+AATTGGAT-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:17, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:18;

[0029] Mycobacterium bufossa probe: ROX-TGG+TGGTGTTGTGC+TCC-BHQ2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:19, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:20;

[0030] Mycobacterium avium probe: VIC-CACCG+AGGTCGCGGC+CTTC-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:21, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:22;

[0031] Mycobacterium guildrums probe: VIC-TCGAGAAGGC+CGTGGAGGCC-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:23, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:24;

[0032] Occasionally occurring mycobacterial probe: FAM-TAGTGGGC+ACGGT+TTGGT-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:25, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:26;

[0033] Mycobacterium smegmatis probe: ROX-CATCTAGT+TCGTAAGAGTG-BHQ2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:27, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:28;

[0034] Mycobacterium marineis probe: FAM-ACC+AGCTC+CGCGACA+AGA-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:29, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:30;

[0035] Mycobacterium Gordon probe: VIC-ACAC+CCTCGGGTG+CTGTC-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:31, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:32;

[0036] Intracellular mycobacterial probe: VIC-TGGTGT+TTGAGT+ATTG-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:33, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:34;

[0037] Mycobacterium scrofula probe: ROX-ACGATCAGGTTC+TGGGCGGA-BHQ2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:35, and the nucleotide sequence of the upstream primer is shown in SEQ ID NO:36;

[0038] In this sequence, the "+" indicates that the base on its right side has locked nucleic acid modification.

[0039] The above-mentioned detection kit can be used to distinguish Mycobacterium tuberculosis from various NTM bacteria. A quadruple qPCR reaction system is constructed based on different fluorescent groups. The reaction system includes one pair of primers and probes for the internal standard gene *Bacillus subtilis* and three pairs of primers and probes for mycobacteria, and pathogen nucleic acid detection is completed through four reaction wells. Preferred primer and probe combinations for the multiplex reaction system include:

[0040] Group 1 (Reaction Well 1): Internal standard gene primers and probes, Mycobacterium tuberculosis primers and probes, intracellular mycobacterium primers and probes, Mycobacterium bufotae primers and probes;

[0041] Group 2 (Reaction Well 2): ​​Internal standard gene primers and probes, Mycobacterium Kansas primers and probes, Mycobacterium avium primers and probes, Mycobacterium scrofula primers and probes;

[0042] Group 3 (Reaction Well 3): Internal standard gene primers and probes, occasional mycobacteria primers and probes, turtle mycobacteria primers and probes, smegma mycobacteria primers and probes;

[0043] Group 4 (Reaction Well 4): Internal standard gene primers and probes, Mycobacterium marinum primers and probes, Mycobacterium gordonii primers and probes, Mycobacterium abscessii primers and probes.

[0044] This invention provides real-time quantitative PCR primers and locked nucleic acid modified probes, primer-probe combinations, and their applications for distinguishing between Mycobacterium tuberculosis and non-tuberculous mycobacteria. These primers and probes are characterized by high sensitivity and high specificity, and can accurately distinguish between 12 pathogenic bacteria, including Mycobacterium tuberculosis, intracellular mycobacteria, Mycobacterium bufotae, Mycobacterium kansasii, Mycobacterium avium, Mycobacterium scrofula, Mycobacterium occulta, Mycobacterium cypriniformis, Mycobacterium smegmatis, Mycobacterium marinum, Mycobacterium Gordonii, and Mycobacterium abscessum. The primers and probes in each component can be combined as needed, and 12 nucleic acids can be detected simultaneously in a single reaction.

[0045] Meanwhile, this invention aims to improve detection performance and shorten detection time by optimizing the reagent reaction system, providing a fast, wide-coverage, highly specific, and sensitive solution for nucleic acid detection of tuberculous / non-tuberculous mycobacteria.

[0046] This invention further optimizes the reagent reaction system. Twelve sets of primers and probes for detecting mycobacteria were designed, using four different fluorescent groups to modify the probes. This enables the detection of four target genes in a single reaction well. With the addition of internal standard gene primers and probes, four reaction tubes can be used to simultaneously detect 11 non-tuberculous and tuberculous mycobacterial nucleic acids in a single reaction. Compared to similar probe-based semi-nested qPCR and melting curve methods, this method significantly reduces the detection time from approximately 2 hours to less than 50 minutes, thus reducing patient waiting time.

[0047] Compared to commonly used immunological methods, this invention improves detection sensitivity and adds the ability to genotype the nucleic acids of 11 common NTM bacteria, resulting in more clinically valuable test reports. Furthermore, this invention uses LNA-modified nucleic acid probes, which have better specificity than conventional TaqMan probes, reducing the probability of false positives and further improving detection accuracy. Attached Figure Description

[0048] Figure 1 The example shows the qPCR amplification curve of the Mycobacterium tuberculosis probe;

[0049] Figure 2 The example shows the qPCR amplification curve of the Mycobacterium abscessus probe;

[0050] Figure 3 The example shows the qPCR amplification curve of the Mycobacterium Kansas probe;

[0051] Figure 4 The example shows the qPCR amplification curve of the Mycobacterium bufo probe;

[0052] Figure 5 The example shows the qPCR amplification curve of the Mycobacterium avium probe;

[0053] Figure 6 The example shows the qPCR amplification curve of the Mycobacterium guildrums probe;

[0054] Figure 7 The example shows the qPCR amplification curve of the occasional mycobacterial probe;

[0055] Figure 8 The example shows the qPCR amplification curve of the Mycobacterium smegma probe;

[0056] Figure 9 The example shows the qPCR amplification curve of the Mycobacterium marineis probe;

[0057] Figure 10 The qPCR amplification curve of the Mycobacterium Gordon probe is shown in the example.

[0058] Figure 11 The example shows the qPCR amplification curve of the intracellular mycobacterial probe;

[0059] Figure 12 The example shows the qPCR amplification curve of the Mycobacterium scrofula probe;

[0060] Figure 13 The qPCR amplification curves for cross-reaction testing of reaction well 1 with 22 nucleic acids are shown in the example.

[0061] Figure 14 The qPCR amplification curves for cross-reaction testing of reaction well 2 with 22 nucleic acids are shown in the example.

[0062] Figure 15 The qPCR amplification curves for cross-reaction testing of reaction well 3 with 22 nucleic acids are shown in the example.

[0063] Figure 16 The qPCR amplification curves for cross-reaction testing of reaction well 4 with 22 kinds of nucleic acids are shown in the example. Detailed Implementation

[0064] Example

[0065] This embodiment provides a detection kit for identifying Mycobacterium tuberculosis and 11 non-tuberculous mycobacteria (Intracellular Mycobacterium, Mycobacterium bufotae, Mycobacterium kansasae, Mycobacterium avium, Mycobacterium scrofula, Mycobacterium occultae, Mycobacterium cypriniformis, Mycobacterium smegmatis, Mycobacterium marinum, Mycobacterium Gordonum, and Mycobacterium abscessum). The primer and probe sequences are shown in Table 1.

[0066] Table 1. Kit Primers and Probes

[0067]

[0068]

[0069] 1. Nucleic acid extraction from samples

[0070] The inactivated bacterial solution of the standard strain was obtained, treated with a nucleic acid extraction kit, and then the nucleic acid of the sample was eluted with 30 μL of TE solution and stored for use in subsequent steps.

[0071] 2. Preparation of the reaction system

[0072] Prepare 2x reaction buffer: Prepare a 20 μL reaction system, including Taq enzyme, magnesium chloride, UNG enzyme, and dNTPs. After preparing the reaction buffer, aliquot it into four centrifuge tubes, labeling the wells 1-4. The specific amounts added are as follows: Taq enzyme (5 U / μL): 0.5 μL, magnesium chloride solution (100 mM): 1.4 μL, dNTPs (10 mM each): 1 μL, TaKaRa-10×PCRBuffer (Mg2+ plus): 2 μL, UNG enzyme 0.5 μL, and add 4.6 μL of water to make up to 10 μL.

[0073] Referring to Table 1, prepare the multiplex primer-probe mixture as follows: Add internal control gene primers, Mycobacterium tuberculosis primers, intracellular Mycobacterium primers, and Mycobacterium bufotae primers to reaction well 1; add internal control gene primers, Mycobacterium kansasae primers, Mycobacterium avium primers, and Mycobacterium scrofula primers to reaction well 2; add internal control gene primers, Mycobacterium occultae primers, Mycobacterium turtleii primers, and Mycobacterium smegmatis primers to reaction well 3; add internal control gene primers, Mycobacterium marinum primers, Mycobacterium Gordonii primers, and Mycobacterium abscessii primers to reaction well 4.

[0074] The upstream and downstream primers in the mixture had the same concentration, and their corresponding probes had the concentrations shown in Table 2. After adding the primers and probes, water was added to each reaction group to make up to 5 μL.

[0075] Table 2. Mixture reaction system and primer / probe concentrations

[0076]

[0077] Select the primer-probe mixture for wells 1-4 according to the detection purpose. Take 5 μL of the multiplex primer-probe mixture and 10 μL of multiplex reaction buffer, place them in a new centrifuge tube, vortex to mix, and briefly centrifuge. Aliquot into 8-tube qPCR tubes. Add 5 μL of sample nucleic acid to each tube, seal the tubes, and briefly centrifuge again before placing them into a qPCR instrument for amplification and fluorescence detection. For each detection, use sterile water as template for the negative control reaction wells and use a positive mixed plasmid as template for the positive control reaction wells. The control reaction solution should be amplified and detected simultaneously with the test sample in the same reaction plate.

[0078] The above reaction solution is compatible with various real-time PCR instruments. This example uses QuantStudio. TMTaking -5 as an example, the reaction program was as follows: 25℃: 5min to activate UNG enzyme; 95℃: 30s pre-denaturation; 95℃: 5s denaturation; 65℃: 30s annealing and fluorescence signal acquisition, for 40 cycles. The heating and cooling rate was set to 1.6℃ / s.

[0079] 3. Interpretation of reaction results

[0080] (1) Result Interpretation

[0081] The instrument acquires fluorescently labeled probe signals at different wavelengths, and after software processing, presents amplification curves for four fluorescence channels: FAM, VIC, ROX, and CY5. The corresponding primers and probes can be located based on different well positions and fluorescence signals. Results are as follows: Figures 1 to 12 As shown. A positive result is defined as the appearance of an amplification curve and an upward trend in the fluorescence curve. The distinction between strong and weak positive results is based on a Ct value of 35. For a strong positive result (Ct≤35), one test is sufficient to indicate a positive result for the nucleic acid of this strain; for a weak positive result (Ct>35), a retest is required. If the retest is positive, it is considered positive. If the retest result is negative, the result needs to be interpreted by a doctor in conjunction with clinical symptoms.

[0082] 4. Reagent performance verification

[0083] (1) Sensitivity test

[0084] To test the sensitivity of the aforementioned primers, probes, and corresponding reaction systems, nucleic acids were extracted using Mycobacterium tuberculosis inactivated bacterial solution and 11 NTM inactivated bacterial solutions, and then quantified using digital PCR. After calculation, the nucleic acid was diluted to 200 copies / μL with nuclease-free purified water, and the template was diluted to 100 copies / μL, 40 copies / μL, 20 copies / μL, 2 copies / μL, and 0.2 copies / μL with nuclease-free purified water. Following the reaction solution prepared in Example 1, 5 μL of template was loaded and amplified from each well using the diluted nucleic acid as template.

[0085] (2) Specificity test

[0086] Considering that this invention involves multiple primers and probes, non-specific amplification or cross-reaction may occur when forming a multiplex reaction system. To verify the specificity of this invention, nucleic acids from Streptococcus pneumoniae, Haemophilus influenzae, Escherichia coli, Staphylococcus epidermidis, Staphylococcus aureus, Nocardia, Candida albicans, human influenza virus, and human parainfluenza virus were collected based on gene sequence homology, similarity of clinical symptoms, and proximity of infection sites. In addition, to prevent cross-reaction between primers, nucleic acids from the following pathogens were also collected: Mycobacterium Kansas, Mycobacterium marineum, Mycobacterium ulcerans, Mycobacterium Gordonum, Mycobacterium bufotatum, Mycobacterium avium, Mycobacterium scrofula, Mycobacterium sugatum, Mycobacterium guilloché, Mycobacterium occulta, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium intracellularis, and Mycobacterium chrysogenum were all sequenced and verified for accuracy. Digital PCR was then used for quantification, and the samples were diluted to 2000 copies / μL for later use. Subsequently, 5 μL of this concentration of nucleic acid was added as a template to the multiplex reaction system of Example 1 for specificity testing. The results are shown in [link to results]. Figures 13 to 16 Verification revealed that none of the four reaction wells involved in this invention exhibited nonspecific amplification or cross-reaction. After testing each nucleic acid in 20 replicates, the specificity was found to be >95%, demonstrating excellent specificity.

[0087] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A test kit, characterized in that: This includes specific primers and probes for quadruple qPCR detection and primers and probes for the Bacillus subtilis internal control gene. The specific primers and probes are divided into four groups, each used for detection through four reaction wells: Group 1: Mycobacterium tuberculosis probe: AAAGACGTCACAAGCGAGCCGTA, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

14. Intracellular mycobacterial probe: VIC-TGGTGT+TTGAGT+ATTG-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:33, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

34. Mycobacterium bufotae probe: ROX-TGG+TGGTGTTGTGC+TCC-BHQ2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:19, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

20. Primers and probes for the Bacillus subtilis internal control gene; Group 2: Mycobacterium Kansas probe: FAM-TGT+TTGAG+AATTGGAT-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:17, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

18. Mycobacterium avium probe: VIC-CACCG+AGGTCGCGGC+CTTC-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:21, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

22. Mycobacterium scrofula probe: ROX-ACGATCAGGTTC+TGGGCGGA-BHQ2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:35, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

36. Primers and probes for the Bacillus subtilis internal control gene; Group 3: Occasionally occurring mycobacterial probe: FAM-TAGTGGGC+ACGGT+TTGGT-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:25, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

26. Mycobacterium guildrums probe: VIC-TCGAGAAGGC+CGTGGAGGCC-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:23, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

24. Mycobacterium smegma probe: ROX-CATCTATGT+TCGTAAGAGTG-BHQ2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:27, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

28. Primers and probes for the Bacillus subtilis internal control gene; Group 4: Mycobacterium marineis probe: FAM-ACC+AGCTC+CGCGACA+AGA-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:29, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

30. Mycobacterium Gordon's probe: VIC-ACAC+CCTCGGGTG+CTGTC-BHQ1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:31, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

32. Mycobacterium abscessus probe: ROX-GCGGCGACCAGT+CCATCG-BHQ2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:15, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

16. Primers and probes for the Bacillus subtilis internal control gene; In this sequence, the "+" indicates that the base on its right side has locked nucleic acid modification.

2. The application of the detection kit according to claim 1 in the preparation of molecular diagnostic products for differentiating Mycobacterium tuberculosis from various NTM bacteria.

Images