A beta-1,3-glucanase mutant and its application

Abstract

The present invention provides a β-1,3-glucanase mutant, belonging to the field of biotechnology. The β-1,3-glucanase mutant comprises an amino acid sequence as shown in SEQ ID NO.1. The present invention also discloses the application of the β-1,3-glucanase mutant in degrading oat-derived glucan and budding short-stalked mold residue. The activity of the mutant β-1,3-glucanase encoded by this gene can reach 86.7IU / mg, and the enzyme activity when degrading budding short-stalked mold residue can reach 38.9IU / mg, which is about 50% and 68% higher than the wild-type enzyme, respectively, and is widely used in degrading the budding short-stalked mold residue produced in the production of pullulan.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a beta-1,3-glucanase mutant and application thereof. Background Art

[0002] β-Glucan is a type of non-starch polysaccharide formed by connecting glucose structural units with β-glycosidic bonds. It is widely found in higher plants, fungi, bacteria and other organisms. β-Glucanase can catalyze the decomposition of β-glucan into soluble oligosaccharides with prebiotic value, which has important application value in the fields of industry, agriculture and medicine. β-1,3-glucanase (EC 3.2.1.6) belongs to β-glucanase and can specifically hydrolyze β-1,3-glycosidic bonds in β-1,3-glucan. The green and high-value conversion of a large amount of β-glucan-rich Aureobasidium pullulans residue produced during the fermentation of pullulan by Aureobasidium pullulans has always been a difficult problem.

[0003] Using β-glucanase to degrade and convert it into prebiotic oligosaccharides is an economical and efficient means. The applicant previously isolated and screened a thermophilic actinomycete Streptomyces sp.F-3 in a high-temperature habitat (reference: Sun X, Meng J, Liu S, Zhang H, Wang L. 2016. Draft genome sequence of Streptomyces sp.F-3. Genome Announc 4 (4): e00780-16.). In the latest work, it was found that the whole genome sequencing analysis results of the bacterium showed that it contained multiple enzymes related to β-glucan degradation. Multiple β-glucanases and thermophilic characteristics make it have the potential to develop into an industrial bacterium that efficiently degrades β-glucan and budding short-stalked mold residue. However, the enzyme activity of the β-glucanase that the bacterium can provide is low, which limits its application in the transformation of budding short-stalked mold residue. Summary of the invention

[0004] In order to solve the above problems, the present invention aims to provide a β-1,3-glucanase mutant, wherein the β-1,3-glucanase mutant comprises an amino acid sequence as shown in SEQ ID NO.1.

[0005] Among them, the β-1,3-glucanase mutant provided in the present application can be obtained by mutating the asparagine N at position 286 in its wild-type amino acid sequence to aspartic acid D, or by mutating the codon AAC encoding asparagine N to the codon GAT encoding aspartic acid D in its wild-type nucleotide sequence.

[0006] On the other hand, the present application provides a biomaterial, wherein the biomaterial is any one of the following:

[0007] A1), a fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.1;

[0008] A2), a nucleotide sequence encoding the β-1,3-glucanase mutant;

[0009] A3), an expression cassette containing the nucleotide sequence described in A2);

[0010] A4), a recombinant vector containing the nucleotide sequence described in A2), or containing the expression cassette described in A3);

[0011] A5), a recombinant microorganism containing the nucleotide sequence described in A2), or containing the expression cassette described in A3), or containing the recombinant vector described in A4).

[0012] In one embodiment, the tag may be a His tag.

[0013] In one embodiment, the nucleotide sequence encoding the β-1,3-glucanase mutant is shown as SEQ ID NO.2.

[0014] In one embodiment, the expression cassette may further include functional elements such as a promoter, a terminator, and a marker gene.

[0015] In one embodiment, the recombinant vector comprises a plasmid, a phage or a viral vector, preferably a plasmid.

[0016] In one embodiment, the recombinant microorganism is selected from one or more of Escherichia coli, yeast, and Bacillus.

[0017] On the other hand, the present application provides a composition comprising the β-1,3-glucanase mutant, or comprising an enzyme solution, fermentation solution and / or extracellular secretion containing the β-1,3-glucanase mutant produced using the biological material.

[0018] In one embodiment, the enzyme solution can be a crude enzyme solution obtained by crude extraction or a refined enzyme solution after purification, and the fermentation solution and / or extracellular secretions can be microbial fermentation solution and / or microbial extracellular secretions containing the β-1,3-glucanase mutant obtained by microorganisms, such as isolated strains or engineered bacteria.

[0019] On the other hand, the present application provides the use of the β-1,3-glucanase mutant, or the biological material, or the composition in degrading materials containing glucan, wherein the materials containing glucan include β-glucan and Aureobasidium pullulans residue.

[0020] In one embodiment, the β-glucan is derived from oats; and / or the Aureobasidium pullulans residue is the residue remaining after Aureobasidium pullulans is used to ferment and produce products.

[0021] Alternatively, the product produced by fermentation with Aureobasidium pullulans may be pullulan.

[0022] On the other hand, the present application provides a method for efficiently degrading β-glucan and / or Aureobasidium pullulans residue, the method comprising the step of treating the β-glucan and / or Aureobasidium pullulans residue with the β-1,3-glucanase mutant, or the biological material, or the composition.

[0023] On the other hand, the present application provides a method for hydrolyzing β-1,3-glycosidic bonds, comprising the step of using the β-1,3-glucanase mutant, or the biological material, or the composition to hydrolyze the β-1,3-glycosidic bonds.

[0024] This application has at least the following beneficial effects:

[0025] The present invention discloses a mutant gene gluB-1 of β-1,3-glucanase, wherein the mutation site of the gene is N286D. The present invention also discloses the application of the gene in degrading oat-derived glucan and budding short-stalked mold residue. Experiments have shown that the activity of the mutant β-1,3-glucanase encoded by the gene can reach 86.7 IU / mg, and the enzyme activity when degrading budding short-stalked mold residue can reach 38.9 IU / mg, which are respectively increased by about 50% and 68% compared with the wild-type enzyme, and are widely used in degrading budding short-stalked mold residue produced in the production of pullulan. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the prior art descriptions. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work. In the drawings:

[0028] Figure 1 is the SDS-PAGE image of the purified N286D protein;

[0029] Figure 2 is the SDS-PAGE image of the purified E95R protein;

[0030] Figure 3 is the histogram of glucanase activity of WT, N286D and E95R;

[0031] Figure 4 This is a bar graph showing the enzyme activity of WT, N286D and E95R in degrading the residue of Aureobasidium bracteata. DETAILED DESCRIPTION

[0032] In order to more clearly explain the overall concept of the application, the following is described in detail by way of embodiment. In the following description, a large amount of specific details are provided so as to provide a more thorough understanding of the application. However, it is obvious to those skilled in the art that the application can be implemented without one or more of these details. In other examples, in order to avoid confusion with the application, some technical features well known in the art are not described.

[0033] Unless otherwise specified, in the following embodiments, the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0034] If no specific conditions are specified in the examples, the experiments were carried out according to conventional conditions or conditions recommended by the manufacturer.

[0035] The amino acid names and their English abbreviations involved in the following embodiments are:

[0036] Asparagine - Asn, N; Aspartic acid - Asp, D; Glutamic acid - Glu, E; Arginine - Arg, R.

[0037] Example 1 Mutation of β-1,3-glucanase gene gluB and construction of recombinant vector

[0038] The gluB gene derived from actinomycete Streptomyces sp. F-3 (the wild-type nucleotide sequence can be found in uniprot number: A0A170ZBC1, EMBL number: GAT83047.1, DNA Data Bank of Japan (DDBJ) accession number: BDDR01000023.1, locus number: STXM2123_3747) and plasmid Blunt-E1 were ligated to obtain a Blunt-gluB plasmid, the nucleotide sequence of which is shown in SEQ ID No. 3.

[0039] Using the above recombinant plasmid as a template, mutant primers of N286D (gluB-1) and E95R (gluB-2) were designed for site-directed mutagenesis. The primer sequences are as follows:

[0040] N286D-sense: atcatcctggatgtggccatgggcggcgg

[0041] N286D-antisense:atggccacatccaggatgatgaagta

[0042] E95R-sense: gcaccggccgagtcgagacgatgacctcg

[0043] E95R-antisense:tctcgactcggccggtgccccagttggga

[0044] Example 2 Construction of recombinant engineering bacteria

[0045] Recombinant engineering bacteria containing the above mutant genes gluB-1 and gluB-2 were constructed respectively, and the specific steps were as follows:

[0046] The above mutant plasmids Blunt-gluB-N286D and Blunt-gluB-E95R with correct sequencing were added to 50 μL of E. coli BL-21 competent cells, ice bathed for 30 minutes; heat shock at 42°C for 90 seconds; ice bathed for 2 minutes, added 1mL of liquid LB, cultured in a shaker at 37°C for 1-1.5 hours; centrifuged at 8000rpm for 2 minutes, and the supernatant was discarded (leaving a little bottom liquid). The remaining solution was spread on an LB plate containing 50 μg / mL kanamycin, spread evenly until dry, and cultured inverted at 37°C overnight; the next day, a single clone was picked and inoculated in 5mL of LB culture medium containing antibiotics, and cultured at 37°C 200rpm overnight, and recombinant engineered bacteria containing mutant genes gluB-1 and mutant genes gluB-2 were obtained respectively.

[0047] Example 3 Recombinant expression of mutant genes

[0048] The obtained recombinant engineered bacteria were fermented in LB medium (containing 50 μg / mL ampicillin) at 37°C and 200 rpm until OD 600 =0.6-0.8; add IPTG with a final concentration of 0.5mM, and induce culture at 16℃ for 20h; centrifuge at 8000rpm, 4℃ for 10min to obtain bacterial sediment, resuspend, and ultrasonically disrupt cells; centrifuge to obtain supernatant (crude enzyme solution), filter the supernatant with a 0.22μm filter head; combine the filler of the affinity column with the filtrate to prepare for affinity purification. Use GE Healthcare's NiSepharose6Fast Flow affinity column to affinity purify the target protein containing 6×His tag. The purified protein is added with NaH at pH 5.0 2 PO 4 -Citrate buffer, ultrafiltration at 4900 rpm at 4°C until the pH of the filtered buffer is 5.0; the concentration of the purified protein is measured using the Coomassie Brilliant Blue staining method.

[0049] Figure 1 and Figure 2 These are the SDS-PAGE images of the mutant gluB-N286D and gluB-E95R proteins after purification, the markers are 10, 15, 25, 35, 45, 60, 75, and 100 kDa, respectively, and the lanes are marker, crude enzyme (CE), sediment (SE), effluent (EE), 5 mM imidazole eluent, 5 mM imidazole eluent, 10 mM imidazole eluent, 10 mM imidazole eluent, 20 mM imidazole eluent, 20 mM imidazole eluent, 20 mM imidazole eluent, 20 mM imidazole eluent, 100 mM imidazole eluent, and 100 mM imidazole eluent. Figure 1 and Figure 2 It can be seen that the target protein band is located between 45kDa and 60kDa, which is consistent with the size of the target protein.

[0050] Example 4 Comparison of enzymatic properties of mutant glucanase and wild-type enzyme gluB

[0051] (1) Determination of glucanase activity

[0052] Mutant glucanase N286D, E95R and wild-type enzyme WT were diluted to 1 mg / mL respectively; 35 μL of pH 5.0 NaH 2 PO 4-citrate buffer, add 35 μL of diluted enzyme solution to each tube of the experimental group, and then add 35 μL of 10 mg / mL dextran (dissolved in 50 mM NaH 2 PO 4 -citrate buffer), react at 60℃ for 30min; add 230μL DNS to each tube, boil in water for 10min; cool quickly, shake well, centrifuge, take the supernatant, and measure OD 540 ; Repeat the experiment three times for each enzyme; Calculate the amount of reducing sugar according to the standard curve, and then calculate the specific enzyme activity according to the formula; Compare the enzyme activities of the two proteins. Definition of enzyme activity unit (IU / mg): Under the corresponding temperature and pH conditions, the amount of reducing sugar equivalent to 1μmol of glucose produced by hydrolyzing the glucan substrate for 1h is one enzyme activity unit.

[0053] The enzyme activities of wild-type glucanase WT and mutants N286D and E95R under optimal conditions (60°C) are shown in Tables 1 and Figure 3 :

[0054] Table 1

[0055]

[0056]

[0057] As shown in Table 1 and Figure 3 As shown in the results, the wild-type gluB enzyme has an optimum temperature of 60°C and has good thermophilic characteristics, but its enzyme activity is low, which limits its application. The enzyme activity of its two mutants, E95R, is significantly reduced compared with WT, while the enzyme activity of N286D is increased by about 50% compared with WT, indicating that the mutant glucanase N286D has strong enzyme activity for glucan and has potential application value.

[0058] (2) Determination of enzyme activity in the degradation of Aureobasidium spp. residue

[0059] Mutant glucanase N286D, E95R and wild-type enzyme WT were diluted to 1 mg / mL; 50 μL of diluted enzyme solution was added to the experimental group tube, and then 0.04 mg of budding short-stalked mold residue dissolved in 150 μL buffer was added, reacted at 60℃ for 1 hour, 100 μL of sample was added, 80 μL of DNS was added, and the mixture was heated in a boiling water bath for 10 minutes, cooled to room temperature, and 820 μL of HO was added. 2 O, shake well, centrifuge, take the supernatant, and measure OD 540 ; Repeat the experiment three times for each enzyme; calculate the amount of reducing sugar based on the standard curve, and then calculate the specific enzyme activity based on the formula; compare the enzyme activities of the two proteins.

[0060] The enzyme activities of mutant glucanase N286D, E95R and wild-type glucanase WT in degrading the residue of budding short-stalked mold are shown in Table 2 and Figure 4 As shown:

[0061] Table 2

[0062] Enzymes Enzyme activity (IU / mg) WT 23.2 N286D 38.9 E95R 5.1

[0063] From Table 2 and Figure 4 The results show that the enzyme activity of the mutant glucanase N286D is about 1.68 times that of the wild-type glucanase WT, which proves that the mutant glucanase N286D has a strong enzyme activity against the residue of Aureobasidium sphaeroides and has potential application value.

[0064] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. A method for efficiently degrading budding short-stalked mold residue, characterized in that: The method comprises treating Aureobasidium pullulans ( Aureobasidium pullulans ) the step of removing the fungus residue, wherein the fungus residue is obtained by using Aureobasidium pullulans ( Aureobasidium pullulans ) The residue remaining after fermentation to produce pullulan; The amino acid sequence of the β-1,3-glucanase mutant is shown in SEQ ID NO.1; The biological material is any one of the following: A1), a fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.1; A2), a nucleotide sequence encoding the β-1,3-glucanase mutant according to claim 1; A3), an expression cassette containing the nucleotide sequence described in A2); A4), a recombinant vector containing the nucleotide sequence described in A2), or containing the expression cassette described in A3); A5), a recombinant microorganism containing the nucleotide sequence described in A2), or containing the expression cassette described in A3), or containing the recombinant vector described in A4); The composition comprises the β-1,3-glucanase mutant, or is an enzyme liquid, fermentation liquid and / or extracellular secretion containing the β-1,3-glucanase mutant produced by using the biological material.

2. The method according to claim 1, characterized in that The nucleotide sequence encoding the β-1,3-glucanase mutant is shown in SEQ ID NO.

2.

3. The method according to claim 1, characterized in that The recombinant vector includes a plasmid, a phage or a virus vector.

4. The method according to claim 1, characterized in that: The recombinant microorganism is selected from one or more of Escherichia coli, yeast, and Bacillus.

Images