PagVQ13 gene and its application in resisting fungal infection in poplar

Abstract

The present invention belongs to the field of plant biotechnology, and in particular to a VQ13 gene and its application in resisting poplar fungal infection. The present invention, through bioinformatics analysis, finds that the PtMAPK3-1 gene is a member of the poplar MAPK cascade gene family, and the MAP K3-1 gene plays an important role in the resistance and disease resistance of poplars. The interaction protein PagVQ13 of PagMAPK3-1 is predicted by protein interaction database and expression pattern analysis, and the interaction relationship between pagMAPK 3-1 and VQ13 is verified by yeast two-hybridization and BiFC experiments. The present invention overexpresses VQ13 by constructing an expression vector and Agrobacterium tumefaciens transgenic overexpression, and the poplar overexpressing VQ13 accumulates ROS in the body after S.musiva infection, which provides nutrition for further infection and reproduction of pathogenic fungi in the plant body. The present invention finds that PagVQ13 in K8 poplar plays a negative regulatory role in the disease resistance reaction of poplars. The present invention provides a molecular marker for screening disease-resistant poplar varieties, and also provides a regulatory means for improving the disease resistance of poplars.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and in particular relates to a PagVQ13 gene and application thereof in resisting poplar fungal infection. Background Art

[0002] With the continuous growth of economy and population, the demand for wood product resources and bioenergy raw materials is increasing. However, the productivity of forests is limited by rising temperatures, limited available water resources and the increased probability of natural disasters. Poplars have the advantages of fast growth, strong adaptability and short rotation period, and are often widely planted as boards and pulpwood around the world. However, with the long-term and large-scale planting of poplars, poplars are also facing a large number of pests and diseases. Canker and leaf spot caused by Sphaerulina musiva can cause premature leaf fall, decreased photosynthesis area and stem breakage of poplars, which not only reduces the annual production of wood, but also leads to the death of poplars and the failure of afforestation. Poplar leaf spot is a disease caused by fungi, which mainly infects poplars and their relatives. Sphaerulina spp. fungi are a kind of leaf spot pathogens, which can cause leaf fall and decay of plants, resulting in a decrease in yield in mild cases and death of plants in severe cases. Sphaerulina musiva can cause leaf spot and cankers in poplars. It is native to the eastern American black poplar (Populus deltoides) and only causes leaf spot symptoms. On hybrid poplars that are susceptible to infection, S. musiva causes leaf necrosis, leading to early leaf drop, and causes cankers on stems and branches, which reduces growth and makes the trees susceptible to microbial colonization. There is currently no way to prevent the spread of S. musiva in poplar-growing areas. Once S. musiva spreads into an area, it is difficult to eliminate the fungus. At present, chemical and biological control measures can greatly reduce the incidence of poplars. In addition, creating disease-resistant transgenic poplars is another effective means of controlling poplar diseases. Chinese patent CN202210837131.X proposes to overexpress the PtoCXE06 gene in poplars to enhance poplar resistance to poplar bark rot. Chinese patent CN202211588272.9 discovered the effector protein SmCSEP3 of poplar in S. musiva infection, and proposed transient expression or overexpression of SmCSEP3 in poplar to enhance poplar's ability to resist S. musiva infection. Therefore, combining genetic engineering technology with plant disease resistance, conducting research on poplar disease resistance, and exploring the relevant regulatory mechanisms of disease resistance are of great significance to improving the survival rate of poplar plantations, increasing timber production, and protecting landscape ecology.

[0003] VQ proteins have been a research hotspot in recent years, and more and more studies have shown that VQ proteins are involved in plant disease resistance. AtVQ23 / SIB1 (sigma factor binding protein 1) is the first VQ protein discovered in Arabidopsis. Overexpression of SIB1 in Arabidopsis leads to activation of defense-related genes such as glutathione transferase after pathogen infection or SA and JA treatment, thereby enhancing resistance to Pseudomonas syringae infection; in rice, OsVQ14 and OsVQ32 can act as substrates of the OsMPKK6-OsMPK4 cascade, enhancing rice resistance to Xanthomonas or yzae pv.oryzae. Overexpression of SIVQ5 in tomatoes can enhance tomato resistance to Botrytis cinerea. Summary of the invention

[0004] At present, there are relatively few studies on the relevant disease infection, disease resistance genes, and internal signal pathways of poplars for S. musiva infection, and the use of genetic engineering to improve the antifungal ability of poplars, which needs further in-depth study. The purpose of the present invention is to explore the relevant mechanism and propose more means to improve the disease resistance of poplars.

[0005] Based on this, the present invention proposes the following technical solutions:

[0006] In one aspect of the present invention, a negative regulatory gene for disease resistance of poplar is provided, wherein the gene is PagVQ13, and the nucleic acid sequence thereof is shown in SEQ ID NO.6; or the nucleic acid sequence has a consistency of more than 97% with SEQ ID NO.6.

[0007] In one aspect of the present invention, the present invention provides an expression vector, wherein the expression vector contains a PagVQ13 gene, the sequence of the PagVQ13 gene is shown in SEQ ID NO. 6, or the nucleic acid sequence has a consistency of more than 97% with SEQ ID NO. 6. The expression vector can be a prokaryotic expression vector or a eukaryotic expression vector.

[0008] In one aspect of the present invention, the present invention provides a genetically engineered bacterium, wherein the engineered bacterium contains the expression vector of the present invention. Preferably, the engineered bacterium is one of Escherichia coli and Agrobacterium tumefaciens.

[0009] In one aspect of the present invention, the present invention provides the use of the PagVQ13 gene as a screening marker for poplar resistance to S. musiva infection. Preferably, the poplar is Populus trichocarpa or 84K Populus.

[0010] When the expression of the PagVQ13 gene of the test variety is significantly higher than that of the wild-type poplar K8, the variety has poor disease resistance to S. musiva infection; when the expression of the PagVQ13 gene of the test variety is significantly lower than that of the wild-type poplar K8, the variety has good disease resistance to S. musiva infection.

[0011] In one aspect of the present invention, a method is provided for improving the resistance of poplars to S. musiva infection, wherein the expression of the PagVQ13 gene in the poplars is reduced by transient transfection or stable transfection.

[0012] Beneficial Effects

[0013] Through genomic analysis, the present invention discovered that under salt, drought and M. brunnea fungal stresses, the transcription levels of PtMAPK3-1, PtMKK7, PtMKK9 and PtRaf23-1 under various biotic and abiotic stresses changed significantly, especially PtMAPK3-1 was a new MAPK family member that could respond to a variety of adverse influences, and the interacting protein PagVQ13 of PagMAPK3-1 was predicted through protein interaction database and expression pattern analysis, and the interaction relationship between MAPK3-1 and VQ13 was verified through yeast two-hybrid and BiFC experiments, and PtVQ13 interacted with PtMAPK3-1 and jointly participated in the defense response of poplar after infection with Subcoccidioides fungi.

[0014] After the transgenic poplars overexpressing PagVQ13 were inoculated with S. musiva, the transgenic poplars showed more necrotic lesions. The detection of physiological and biochemical indicators such as DAB staining, PAL activity, CAT activity, POD activity and MDA content further showed that PagVQ13 plays a negative regulatory role in the disease resistance response of poplars, providing a molecular marker for screening disease-resistant poplar varieties and a regulatory means for improving the disease resistance of poplars. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Gel electrophoresis analysis of PagMAPK3-1 gene after PCR amplification.

[0016] Figure 2 :Prediction of interacting proteins of PtMAPK3-1.

[0017] Figure 3 : Analysis of the expression patterns of PtMAPK3-1 and PtVQs after pathogen infection, including expression pattern analysis on days 0, 1, 4, and 15 after infection with (a) S. musiva and (b) S. populicola.

[0018] Figure 4: Yeast two-hybrid analysis of PagMAPK3-1 and PagVQ13.

[0019] Figure 5 : PCR electrophoresis detection of PagVQ13 transgenic poplar genome.

[0020] Figure 6 :Detection of gene expression level in PagVQ13 overexpressing transgenic poplar.

[0021] Figure 7 :Phenotypic analysis of PagVQ13 transgenic poplars after inoculation with S. musiva, including (a) lesion growth after inoculation with S. musiva; (b) lesion area statistical bar graph

[0022] Figure 8 : Detection of physiological and biochemical indices of PagVQ13 transgenic poplars two days after inoculation with S. musiva, including (a) DAB staining, (b) PAL activity, CAT activity, POD activity and MDA content detection. DETAILED DESCRIPTION

[0023] The plant material hybrid poplar 84K (Populus alba×Populus glandulosa) in the present invention was donated by Mr. Wang Liuqiang of the Chinese Academy of Forestry; other molecular biological reagents were conventional reagents from biological reagent companies on the market unless otherwise specified, and related biological operation methods were all referred to "Molecular Cloning Experiment Guide" (edited by J. Sambrook and DW Russell, Science Press) unless otherwise specified.

[0024] Example 1: Identification of Poplar MAPK Cascade Gene Family Members

[0025] The genome data of Populus trichocarpa genome assembly versions v1.0 and v3.0 were obtained from the PhycoCosm database (http: / / genome.jgi-psf.org / Poptr1 / Poptr1.home.html) and the Phytozome database (https: / / phytozome.jgi.doe.gov / pz / portal.html). According to previous studies, the protein sequences of 21 PtMAPKs and 11 PtMAPKKs in the poplar genome v1.0 were obtained (Hamel LP, Nicole MC, Sritubtim S, et al. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families [J]. Trends in plant science, 2006, 11 (4): 192-198.); using these 32 protein sequences as query sequences, the PtMAPKs (i.e., MAPKs of Populus trichocarpa) and PtMAPKKs gene IDs were obtained in the protein library of Populus trichocarpa v3.0 using the BLAST tool in TBtools. In order to identify potential members of the PtMAPKKK gene family, the genome sequence and protein sequence of Populus trichocarpa were downloaded from the Plant Genome Database (https: / / phytozome.jgi.doe.gov / pz / portal.html). The protein sequences of MAPKKKs of Arabidopsis, jujube, Jatropha curcas, and Actinidia chinensis were used as query sequences to perform BLAST search on the Populus trichocarpa protein database. Subsequently, the Hidden Markov Model (HMM) was used to search for genes containing serine / threonine protein kinase domains (PF00069) in Populus trichocarpa. The genes obtained by BLAST search and HMM search were compared, genes that could not meet both conditions were removed, and redundant transcripts were removed. Finally, the gene numbers of 21 PtMAPKs and 11 PtMAPKKs in the new version were obtained. In order to better understand the gene expression levels of MAPK cascade genes in response to adversity, the present invention obtained transcriptome data related to poplar and abiotic stress (drought and salt) and biotic effects (Marssonina brunnea infection) from the GEO database of NCBI. The results showed that after infection with pathogens, PtMPK3-1, PtMKK9, PtMKK7, and PtRaf23-1 were significantly upregulated, and PtMAPK3-1 responded to multiple stresses. Based on this, the MAPK3-1 gene is considered an important candidate gene for poplar's stress and disease resistance.

[0026] Example 2 Cloning and analysis of the poplar MAPK cascade gene family member PagMAPK3-1 gene

[0027] Populus trichocarpa is mainly a foreign poplar variety. Based on the results of the genome analysis of Populus trichocarpa in Example 1, the inventors studied the relevant situation of the MAPK3-1 gene in the Chinese poplar variety 84K Populus.

[0028] The full-length cDNA of 84K poplar was used as a template to clone PagMAPK3-1. The relevant primers used in the PCR experiment are as follows:

[0029] PagMAPK3-1-F:ATGGCGAATTATGCACAGGGAAATG (SEQ ID NO.1)

[0030] PagMAPK3-1-R: CTAGCATGCATATTCTGGATTAAGTGC (SEQ ID NO. 2)

[0031] The PCR product was recovered from gel, connected to the cloning vector pEasy-BluntSimple, and transformed into Escherichia coli.

[0032] Result analysis: The PCR product was purified and separated by 1% agarose gel electrophoresis. The results showed that there was a bright and single band between 2000 bp and 1000 bp (such as Figure 1 ). The genome sequence annotation shows that the PagMAPK3-1 gene size is 1116bp, which preliminarily indicates that the PagMAPK3-1 gene was successfully amplified. The bright gel block was cut off for gel recovery and then connected to the cloning vector and sent to a sequencing company for sequencing. The sequencing results were compared using DNAMAN software, and the results showed that the sequences were consistent, proving that the target gene was successfully cloned. After comparing the PagMAPK3-1 and PtMAPK3-1 sequences, it was found that the CDS sequences of MAPK3-1 in Populus trichocarpa and 84K Populus differed by 8 bases, and there were 3 amino acids differences after translation into protein.

[0033] The sequence of the 84K poplar PagMAPK3-1 gene was sequenced as shown in SEQ ID NO.3, and the size of the PagMAPK3-1 gene was 1116 bp.

[0034] Example 3 Screening and verification of poplar MAPK3-1 interacting proteins

[0035] 3.1 Acquisition and analysis of transcriptome data

[0036] The transcriptome data of poplars infected with leaf spot pathogens Sphaerulina musiva and Sphaerulina populicola were obtained from the GEO database of the NCBI website. The original Counts values ​​were converted into FPKM values ​​using R language, and the FPKM values ​​of the target genes were extracted using Excel. Finally, the FPKM values ​​were transformed into Log2 using TBtools and displayed in the form of a heat map.

[0037] 3.2 Protein interaction prediction

[0038] Submit the protein sequence of the target gene through the STRING protein interaction prediction website (https: / / cn.string-db.org / ) to obtain the protein interaction network diagram.

[0039] Studies have shown that MAPK proteins can interact with VQ proteins to participate in plant growth and development, and biotic and abiotic stress responses. Since the 84K poplar genome sequence has not yet been entered into the protein interaction database, and the sequence similarity of MAPK3-1 in Populus trichocarpa and 84K poplar is very high, the present invention submitted the protein sequences of PtMAPK3-1 and 51 PtVQ in Populus trichocarpa to the STRING protein interaction prediction website. The results showed that PtMAPK3-1 may interact with 7 PtVQ proteins, namely PtVQ1, PtVQ13, PtVQ14, PtVQ17, PtVQ32, PtVQ35 and PtVQ47 (see Figure 2 )

[0040] Transcriptome data on poplars infected with Sphaerulina spp. were downloaded from the GEO database of the NCBI website. The expression patterns of PtMAPK3-1 and 51 PtVQ genes were clustered in the form of heat maps. The results showed that after infection with S. musiva and Sphaerulina populicola, PtMAPK3-1, Potri.003G194700 (PtVQ13) and Potri.006G032300 (PtVQ24) were clustered in the same evolutionary branch in both treatments, and the expression levels of these three genes increased ( Figure 3 ). In addition, it can be found from the heat map that the gene expression level of PtVQ13 on the 15th day after infection with pathogens is significantly higher than that of other genes. Based on this, the present invention speculates that PtVQ13 interacts with PtMAPK3-1 and jointly participates in the defense response of poplar after infection with Subsphaeroides fungi.

[0041] 3.3 Yeast two-hybrid verification of the interaction between MAPK3-1 and VQ13:

[0042] (1) Gene cloning and cloning vector construction of PagVQ13: The PagVQ13 gene was cloned using PagVQ13 cloning primers and connected to the cloning vector pEasy-Blunt Simple, transformed into E. coli, and the recombinant plasmid was obtained by steps such as plaque picking, shaking, testing, and plasmid extraction. The cloning primers are:

[0043] PagVQ13-F:ATGGATGTACTTGGGGCTAACATGAA SEQ ID NO.4

[0044] PagVQ13-R:TTAATTAAGCACATCTAACTGAAAAGATTCATGAAAAAG SEQ ID NO.5

[0045] The sequence of the PagVQ13 gene is shown in SEQ ID NO.6.

[0046] According to the pGBKT7 vector map, primers for constructing the VQ13 transcriptional active vector were designed as shown in the following table:

[0047]

[0048] Using the plasmid extracted from transformed Escherichia coli as a template, primers PagVQ13-BD-F and PagVQ13-BD-R were used for amplification, and PCR primers were collected. Subsequently, the PCR product and pGBKT7 were digested and ligated, and transformed into Escherichia coli. The recombinant plasmid was obtained by steps such as plaque picking, shaking, testing, and plasmid extraction.

[0049] (2) According to the pGADT7 vector map, primers for constructing the PagMAPK3-1 transcriptional activity vector were designed. The primers are shown in the following table:

[0050]

[0051] The transformed E. coli in Example 2 was used as a template for PCR amplification to obtain the PagMAPK3-1 gene amplification product, the PCR product was collected, and the pGADT7 was digested separately, connected to construct an expression vector, and the transformed E. coli was transformed, and the steps of plaque picking, shaking, testing, plasmid extraction, etc. were performed to obtain the recombinant plasmid.

[0052] (3)① Add 4μl pGADT7 and 6μl pGBKT7-PagVQ13 plasmid (negative control) into 50μl Y2HGold competent cells; add 6μl pGBKT7-53 and 4μl pGADT7-T plasmid (positive control) into 50μl Y2HGold competent cells; add 6μl pGBKT7-PagVQ13 and 4μl pGADT7-PagMAPK3-1 (experimental group) into 50μl Y2HGold competent cells. Then, 5 μl of Carrier DNA and 250 μl of PEG / LiAc were added to the tube in sequence, and the reagents were mixed by blowing; the tube was placed in a 30°C metal bath for reaction for 30 min, and the centrifuge tube was taken out and flipped 10 times at the 15th minute, and then placed in a 42°C metal bath for reaction for 15 min, and flipped 10 times at the 7.5th minute; centrifuged at 5000 rpm for 1 min, the supernatant was discarded, and the plaques were resuspended with 400 μl ddH2O, and then centrifuged at 5000 rpm for 1 min, the supernatant was discarded, and the plaques were resuspended with 50 μl ddH2O; the transformed bacterial solution was spread on two-deficient plates (SD / -Leu / -Trp) and cultured in a 30°C yeast incubator for 2 to 3 days;

[0053] ②Pick a single colony in 3ml YPDA liquid culture medium, incubate in a shaker at 30℃, 250rpm for 12h, and make sure the yeast solution is not too turbid; take 1ml yeast solution in a 1.5ml centrifuge tube, centrifuge at 500rpm for 5min, discard the supernatant, resuspend the plaque with 0.9% saline, repeat once, and finally add 500μl 0.9% saline to resuspend;

[0054] ③ Take 10μl of yeast solution in a 1.5ml centrifuge tube and add 90μl ddH2O, which is a 10-fold diluted bacterial solution. Then take 10μl of the yeast solution diluted 10 times and add 90μl ddH2O, which is a 100-fold diluted bacterial solution. According to this operation, dilute the bacterial solution to 1000 times. In the clean bench, take 5μl of the original concentration bacterial solution, 10-fold, 100-fold, and 1000-fold diluted bacterial solution in turn and spot them on the two-deficient plate (SD / -Leu / -Trp) and the four-deficient plate (SD / -Trp / -His / -Leu / -Ade). After spotting, seal the plate. The four-deficient plate needs to be wrapped with tin foil and placed in a 30℃ yeast incubator for 2-3 days to observe the growth of bacterial plaques.

[0055] Results: The present invention verifies the interaction between PagMAPK3-1 and PagVQ13 by yeast two-hybrid system. The experimental group (pGBKT7-PagVQ13+pGADT7-PagMAPK3-1), positive control (pGBKT7-53+pGADT7-T) and negative control (pGADT7+pGBKT7-PagVQ13) were transferred to Y2HGold yeast and cultured on two-deficient plates (SD / -Leu / -Trp) and four-deficient plates (SD / -Leu / -Trp / -His / -Ade / X-α-Gal). The four-deficient plates were cultured in the dark. Results: (see Figure 4 ), both the experimental group and the control group can grow normally on the two-deficient plate, indicating that the plasmids of each group were successfully co-transformed into yeast. On the four-deficient plate, the positive control and the experimental group grew normally and turned blue, while the negative control did not grow and remained consistent with the control after being diluted 10, 100 and 1000 times. This indicates that PagMAPK3-1 and PagVQ13 interact in the yeast system.

[0056] Example 4 Identification of disease resistance function of overexpressed transgenic poplars

[0057] 4.1 Obtaining overexpression transgenic lines

[0058] (1) Vector construction

[0059] Construction of PagVQ13 overexpression vector using Gateway technology:

[0060] a. Add gateway adapters to the F and R ends of the PagVQ13 gene cloning primers, respectively. Use the PagVQ13 cloning vector constructed in Example 3 as a template for cloning, and add the adapter primer sequences as follows:

[0061]

[0062] Then the PCR product gel recovery was performed;

[0063] b. The above PCR product was cloned into the intermediate vector pDONR207 by BP reaction. The reaction system is as follows:

[0064] Reagents Dosage PCR products 150ng Carrier 75ng BP enzyme 0.8μl

[0065] At 25°C, the cells were connected for 6 h, and then the PCR products were recovered by gel, transformed, and sequenced.

[0066] c. After the sequencing of the intermediate vector in the previous step is correct, the two genes are constructed into the overexpression vector pMDC32 using the LR reaction. The reaction system is as follows:

[0067] Reagents Dosage PCR products 150ng Carrier 75ng LR enzyme 0.8μl

[0068] At 25°C, connect for 6 hours, then perform gel recovery of PCR products, transformation, sequencing, plasmid extraction, and finally introduce into Agrobacterium competent cells GV3101.

[0069] (2) Poplar genetic transformation:

[0070] a. The Agrobacterium obtained in (1) above was added to LB medium containing the corresponding Kan and Rif for amplification so that the OD600 value reached about 0.6;

[0071] b. In a clean bench, place the cut 84K poplar leaves with wounds into the bacterial solution from the previous step and shake horizontally at a low speed for about 20 minutes;

[0072] c. Drain the infected leaves of excess bacterial solution and place them in differentiation medium, incubate in the dark at 24℃ for 2 days;

[0073] d. After 2 days of dark culture, transfer the leaves to the screening medium containing hygromycin and timentin for screening. Generally, resistant buds will appear in about 20 days.

[0074] e. Cut the resistant seedlings and transfer them to the rooting medium containing the same resistance. After rooting, expand the culture medium and detect the expression level.

[0075] Differentiation medium system 1L:

[0076]

[0077] Screening medium system 1L: Differentiation medium 1L, after sterilization, cool to 50°C and add hygromycin (0.0003g / L) and timentin (0.2g / L) under a clean bench.

[0078] Rooting medium system 1L:

[0079]

[0080] After sterilization, cool to 50°C and add hygromycin (0.0003 g / L) and timentin (0.2 g / L) under a clean bench.

[0081] (3) Genomic PCR verification:

[0082] The poplar genome was extracted by CTAB method, and then the extracted genome was used as a template for PCR experiment to detect PagVQ13 gene. The overexpression vector plasmid was used as positive control group. After the PCR reaction, gel electrophoresis was performed. Plants with PCR bands at the position corresponding to the positive control were likely to be positive plants (see Figure 5 ).

[0083] (4) Analysis of relative expression levels of positive strains:

[0084] RNA was extracted from positive plants and reverse transcribed, and the obtained cDNA was used as a template for qRT-PCR experiments. The relative expression of the target gene in each strain was detected by qRT-PCR experiments.

[0085] The results showed that the expression level of PagVQ13 gene in OE-4 and OE-5 overexpressing transgenic lines was more than 20 times that of WT (see Figure 6 ), so these two strains were selected for subsequent analysis.

[0086] Example 5 Study on disease resistance of PagVQ13 transgenic poplar

[0087] 5.1 S. musiva infection

[0088] S. musiva was isolated from leaves of white poplar with leaf spot disease and cultured in PDA medium. The mycelium was scraped off with a gun tip or inoculation needle and dissolved with a sterile 0.05% Tween 80 aqueous solution. The number of spores in the spore suspension was adjusted. Healthy leaves of poplar transplant seedlings were taken and placed in a culture dish covered with moist gauze, with the back of the leaves facing up. 25 μl of the prepared spore suspension was dripped on both sides of the leaves, avoiding the veins. The culture dish was placed in a dark incubator at 25°C and the disease was observed daily.

[0089] Results: The lesions of 84K poplar (wild type control WT) and PagVQ13 transgenic poplar leaves were observed 4 days after inoculation with S. musiva spore suspension. Figure 7 As shown in the figure, WT 84K poplar leaves showed slight lesions on the sixth day after inoculation with S. musiva, while PagVQ13 transgenic poplar leaves had more necrotic areas than WT. Statistical analysis of the lesion size on the sixth day after inoculation with the pathogen showed that the lesion size of OE-4 and OE-5 was significantly higher than that of WT. The above results indicate that overexpression of PagVQ13 reduces poplar resistance to S. musiva.

[0090] 5.2 Determination of physiological and biochemical indicators

[0091] Plants will rapidly accumulate reactive oxygen species (ROS) when they are stressed by pathogens. The accumulation of reactive oxygen species can lead to the death of plant cells. Therefore, in order to remove excessive ROS, plants will activate antioxidant enzymes such as catalase (CAT), peroxidase (POD) and PAL (phenylalanase) in their bodies. Malondialdehyde (MDA) is one of the commonly used indicators to measure the degree of oxidative stress in plants, which can reflect the degree of plant membrane lipid peroxidation. DAB staining of leaves of WT, OE-4 and OE-5 plants on the second day after inoculation with S. musiva can detect the accumulation of ROS, i.e. H2O2, in plants.

[0092] (1) CAT (catalase), POD (peroxidase) activity assay, PAL (phenylalanase). The POD and CAT assay methods are referenced to: Maehly AC, Chance B. The assay of catalases and peroxidases [J]. Methods of Biochemical Analysis, 1954, 1: 357-424. The PAL assay method is referenced to: Beaudoin-Eag an LD, Thorpe TA. Tyrosine and phenylalanine Ammonia Lyase activities during shoot initiation in tobacco callus cultures. Plant Physiol. 1985; 78: 438–41.

[0093] (2) Determination of MDA content: The malondialdehyde content was determined using the thiobarbituric acid method. For the specific experimental method, refer to the Plant Physiology Experimental Course edited by Wang Sangen and published by Science Press in 2017.

[0094] (3) DAB staining: Place poplar leaves from the diseased area in a 50 ml centrifuge tube and add DAB dye solution to immerse the leaves. Shake on a shaker (25-28°C, 80 r / min) for 4-7 hours in a dark environment. Discard the dye solution and add decolorizing solution (decolorizing solution preparation: ethanol: acetic acid: glycerol = 3:1:1). Move the centrifuge tube to a constant temperature water bath (95°C) for decolorization for 15 minutes. The decolorizing solution can be replaced 1-2 times during this period.

[0095] All the above indicators were collected from poplar leaves in the diseased area, with 3 replicates for each sample, and GraphPad Prism 5 software was used to present histograms and ANOVA significant difference analysis (*p<0.05; **p<0.01).

[0096] result:

[0097] See also Figure 8 As shown in (b), the determination of PAL, CAT and POD activities showed that the PAL, CAT and POD activities of wild-type poplar (WT) were increased, while the PAL and POD activities of transgenic poplar overexpressing PagMAPK3-1 were decreased and significantly lower than WT.

[0098] See also Figure 8 As shown in (b), after pathogen treatment, the MDA content of the transgenic lines was significantly higher than that of the WT plants.

[0099] See also Figure 8 As shown in (a), on the second day after inoculation with S. musiva, yellow-brown precipitates were produced in the leaves of WT, OE-4 and OE-5 plants, indicating that S. musiva can induce the accumulation of reactive oxygen species in poplar plants after infecting poplars. The precipitates in WT leaves were less than those in the two transgenic plants, indicating that transgenic poplars overexpressing PagMAPK3-1 caused more cell death and H2O2 accumulation after S. musiva invasion, providing nutrients for the further infection and reproduction of pathogenic fungi in the plants.

[0100] The above content is a further detailed description of the present invention in combination with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the scope of protection determined by the claims submitted for the present invention.

Claims

1. The use of the PagVQ13 gene as a screening marker for poplar resistance to S. musiva infection, characterized in that: The PagVQ13 gene is shown in SEQ ID NO.6; the poplar is 84K poplar.

2. A method for improving poplar's resistance to S. musiva infection, characterized in that: The expression of PagVQ13 gene in poplar is reduced by transient transfection or stable transfection, wherein the PagVQ13 gene is as shown in SEQ ID NO.6; and the poplar is 84K poplar.

Images