PacircPEX, a circular RNA from the golden-inlaid bamboo, and its applications

By overexpressing the circular RNA PacircPEX of Phyllostachys edulis in plants, the problem of insufficient drought resistance of Phyllostachys edulis was solved, and its growth performance and enzyme activity under drought conditions were significantly enhanced, the activity of peroxisomes was promoted, and the plant's stress resistance was improved.

CN117603989BActive Publication Date: 2026-04-21INT CENT FOR BAMBOO & RATTAN
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INT CENT FOR BAMBOO & RATTAN
Filing Date
2023-11-08
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Global warming has led to rising temperatures and reduced precipitation, severely impacting the growth of golden bamboo. Existing technologies are insufficient to effectively improve its drought resistance.

Method used

By using genetic engineering techniques, the circular RNA PacircPEX of Phyllostachys edulis was overexpressed to regulate the plant's drought resistance. This included methods such as introducing vectors containing PacircPEX, increasing its copy number on plant chromosomes, altering promoter sequences, or using enhancers to improve its expression level in plants.

Benefits of technology

It significantly enhanced the drought resistance of plants, improved their growth performance and enzyme activity under drought conditions, promoted the activity of peroxisomes, and enhanced the stress resistance of plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004537884860000011
    Figure HDA0004537884860000011
  • Figure HDA0004537884860000012
    Figure HDA0004537884860000012
  • Figure HDA0004537884860000013
    Figure HDA0004537884860000013
Patent Text Reader

Abstract

This invention relates to the field of plant genetic engineering technology, and particularly to the circular RNA PacircPEX of *Phyllostachys edulis* and its applications. The cDNA nucleotide sequence of the circular RNA PacircPEX of *Phyllostachys edulis* is shown in SEQ ID NO.1 or SEQ ID NO.2. This invention discovers the role of the circular RNA PacircPEX of *Phyllostachys edulis* in plant drought resistance, providing a theoretical basis and gene resource for resistance breeding of *Phyllostachys edulis*, a powerful tool for transgenic research of *Phyllostachys edulis*, and valuable circular RNA for molecular breeding of stress resistance in *Phyllostachys edulis*. It is of great significance for revealing the molecular mechanism of bamboo stress resistance, overcoming the limitations of conventional breeding, and accelerating the bamboo breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to PacircPEX, a circular RNA from Phyllostachys edulis, and its applications. Background Technology

[0002] Golden-striped bamboo (Phyllostachys aureosulcata f. spectabilis CDChu et C.S.Chao) is a species of bamboo in the genus Phyllostachys of the Poaceae family. Unlike most other landscaping bamboos, Golden-striped bamboo has pale yellow culms in its youth, gradually turning golden yellow as it matures, while naturally developing vertical, irregular bluish-green stripes on its culms. In most parts of southern my country, North China, and southern Henan, Golden-striped bamboo can remain evergreen year-round under natural growing conditions and can overwinter outdoors, thus it is widely used as a common ornamental bamboo species.

[0003] Under natural conditions, the growth of *Phyllostachys edulis* is influenced by many factors, among which water is the most important factor affecting its normal growth and development. In particular, global warming leading to rising temperatures and reduced precipitation, with high summer temperatures often causing drought, severely impacts the growth of *Phyllostachys edulis* under natural conditions.

[0004] Therefore, under these circumstances, we should promote the improvement of Phyllostachys edulis species, explore new genes, and cultivate more new Phyllostachys edulis varieties that are more drought-resistant. Summary of the Invention

[0005] In a first aspect, the present invention provides a circular RNA PacircPEX, the cDNA nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] Preferably, the cDNA nucleotide sequence of the circular RNA PacircPEX is shown in SEQ ID NO.2.

[0007] The structure of the circular RNA of *Phyllostachys edulis* is a circular structure formed by transcription and splicing of the nucleotide sequence shown in SEQ ID NO.1, with the end-to-end connection. The Circ Based ID of the circular RNA PacircPEX is hic_scaffold_22:10652336|10653429. The circular RNA PacircPEX consists of exons 2 to 5 of the gene PH02Gene45872 on chromosome 22 of *Phyllostachys edulis*, and the nucleotide sequence after intron removal is shown in SEQ ID NO.2.

[0008] Secondly, the present invention provides biological materials containing the above-mentioned circular RNA PacircPEX.

[0009] Preferably, the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria, or non-renewable plant parts.

[0010] In some embodiments, the non-renewable plant part is a plant cell or tissue; the plant cell or tissue cannot develop into a complete plant individual.

[0011] Thirdly, the present invention provides the application of the circular RNA PacircPEX or the biological material described herein in regulating plant drought resistance.

[0012] Fourthly, the present invention provides the application of the circular RNA PacircPEX or the biological materials described herein in plant breeding and germplasm resource improvement.

[0013] Preferably, the plant breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

[0014] In this invention, the plants include, but are not limited to, plants of the genus Arabidopsis in the family Brassicaceae or the genus Phyllostachys in the family Poaceae; preferably, the plants are Arabidopsis or Phyllostachys edulis; more preferably, the plants are Arabidopsis or Phyllostachys edulis.

[0015] Fifthly, the present invention provides a method for regulating the drought resistance of plants, comprising: regulating the expression level of the circular RNA PacircPEX in plants through genetic engineering methods.

[0016] Preferably, the present invention provides a method for improving the drought resistance of plants, comprising: overexpressing the circular RNA PacircPEX in plants by means of genetic engineering.

[0017] Preferably, the overexpression mode is selected from at least one of the following 1) to 5):

[0018] 1) Introduce a vector containing cDNA of the circular RNA PacircPEX;

[0019] 2) Increase the copy number of cDNA of the circular RNA PacircPEX on plant chromosomes;

[0020] 3) Alter the promoter sequence of the cDNA of the circular RNA PacircPEX on plant chromosomes;

[0021] 4) The strong promoter is operatively ligated to the cDNA of the circular RNA PacircPEX;

[0022] 5) Import enhancers.

[0023] Preferably, the method for improving plant drought resistance includes: transferring the cDNA of the circular RNA PacircPEX into Arabidopsis thaliana plants using Agrobacterium-mediated transformation to obtain transgenic Arabidopsis thaliana plants overexpressing the circular RNA PacircPEX.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] This invention, through the design of forward and backward primers combined with RNase R, verified the objective existence and confirmed that the circular RNA PacircPEX of *Phyllostachys edulis* is indeed a closed ring. It also discovered the role of PacircPEX in plant drought resistance, providing a theoretical basis and gene resources for resistance breeding of *Phyllostachys edulis*, offering a powerful tool for transgenic research, and providing valuable circular RNA for stress-resistant molecular breeding. This is of great significance for revealing the molecular mechanisms of bamboo stress resistance, overcoming the limitations of conventional breeding, and accelerating the bamboo breeding process. Attached Figure Description

[0026] Figure 1 The image shows an electrophoresis diagram of the PCR products of the circular RNA PacircPEX cDNA, its flanking structures, and introns in this example. Lane 1 contains the PCR products of the circular RNA PacircPEX cDNA and its flanking structures, lane 2 contains the PCR products of the introns, and lane M contains the DNA marker.

[0027] Figure 2 This is a diagram illustrating the enzyme digestion verification of the expression vector in this example. Lane M represents the DL 15000 DNA Marker, lane 1 represents the plasmid pCAMBIAsuper1300-GFP, lane 2 represents the linearized plasmid after double digestion with Hind III and Spe I, lane 3 represents the plasmid after successful insertion of PacircPEX and other elements, and lane 4 represents the linearized plasmid after double digestion with Xba I and Spe I in lane 3.

[0028] Figure 3 This is a PCR verification diagram of the transgenic Arabidopsis thaliana using the back primer in the example. Lane M is the DL 500 DNA Marker, lanes 1-3 are the amplified bands of PacircPEX transgenic Arabidopsis thaliana OE1-3 using the back primer, and lane 4 is the wild-type Arabidopsis thaliana PacircPEX back primer control.

[0029] Figure 4 This is a graph showing the activity of Arabidopsis roots overexpressing the circular RNA PacircPEX under mannitol treatment in the examples.

[0030] Figure 5 This is a graph showing the root viability of Arabidopsis thaliana treated with PEG6000 and overexpressing the circular RNA PacircPEX in the example.

[0031] Figure 6 A represents the POD enzyme activity of two Arabidopsis thaliana genotypes under drought stress in the example. Figure 6 B represents the SOD enzyme activity of two genotypes of Arabidopsis thaliana under drought stress in the examples.

[0032] Figure 7 The image shows the root growth of Arabidopsis thaliana after 10 days of drought stress in the example.

[0033] Figure 8 The expression level of the PEX gene family in PacircPEX transgenic Arabidopsis thaliana in the examples is shown. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0035] Unless otherwise specified, all examples were conducted under standard experimental conditions, such as those described in Sambrook J & Russell DW, *Molecular Cloning: A Laboratory Manual* (2001), or according to the manufacturer's instructions. Reagents and instruments not explicitly named were all readily available products from reputable suppliers.

[0036] In the following examples, when constructing the overexpression vector of circular RNA, according to the "flanking intron-assisted circularization strategy", when cloning circular RNA, flanking introns of about 125 bp are extended at both ends of the circularization region to assist in circularization; the cDNA nucleotide sequence of the circular RNA and its flanking sequence are shown in SEQ ID NO.3; at the same time, a meaningless, non-expressed, and reverse complementary intron from *Phyllostachys edulis* is added to both ends of the circularization region and its flanking region to assist in circularization, and the nucleotide sequence of the intron is shown in SEQ ID NO.4.

[0037] Example 1: Cloning of cDNA and introns of PacircPEX, a circular RNA from *Phyllostachys edulis*.

[0038] Total RNA was extracted from leaves of *Phyllostachys edulis*, and then RNase R was used to remove linear RNA, leaving only circRNAs. Finally, the delinearized RNA was reverse transcribed into delinearized cDNA. Plant-specific kits were used for all these procedures. For the DNA polymerase chain reaction (PCR), a high-fidelity enzyme was selected. The specific procedures were strictly followed according to the manufacturer's instructions. In this example, total RNA extraction used the TRIZOL method combined with a small-volume total RNA extraction kit (Beijing Tianmo, TR251-200); RNA delinearization used a Ribonuclease R RNase R delinearization kit; reverse transcription used reverse transcriptase (Takara Bio); and the DNA polymerase used was a novel blue dye high-fidelity Taq polymerase mix (Beijing Jumei, 2×M5 HiPer plus Taq HiFi PCR mix).

[0039] The specific method is as follows:

[0040] (1) RNA delinearization:

[0041] Prepare the following reaction system according to the specific concentration of total RNA: RNA 2 μg; 10×Reaction Buffer 2 μL; RNase R 6 U; ddH2O to 20 μL. After the reaction system is prepared, place it in a 37°C water bath for 15 min, and then transfer it to a 70°C water bath for 10 min.

[0042] (2) RNA reverse transcription:

[0043] Prepare the following reaction mixture: 4 μL of 5×Primer Script RT Master Mix; 1 μg of RNA; and RNase-free water to a final volume of 20 μL. After preparation, heat the mixture in a 37°C water bath for 15 min, then immediately place it in an 85°C water bath for 5 s, and finally cool it in a 4°C refrigerator. Once the reaction mixture has completely cooled, add 80 μL of ultrapure water, mix well, and store at -20°C.

[0044] (3) Cloning of the helper circular intron, the circular region of the circular RNA PacircPEX and its flanking regions (flanking length 140 / 113 bp), primer sequences are as follows:

[0045] PacircPEX A:GGCACTGGGTTTCTTATTAAAG(SEQ ID NO.5)

[0046] PacircPEX S:ATTGAACTTGTTTCTAGGAGGC(SEQ ID NO.6)

[0047] Intron A: CTGCAGCAATTGCATAGAAG (SEQ ID NO.7)

[0048] Intron S: GTGAGTGCTTGCCTGCTT (SEQ ID NO.8)

[0049] The specific parameters for the polymerase chain reaction are as follows:

[0050] Reaction system: HiFi mix 10μL; upstream primer (10μM / L) 1μL; downstream primer (10μM / L) 1μL; DNA substrate (80ng / μL) 3μL; ultrapure water (sterilized by high temperature and high pressure) 5μL.

[0051] Reaction time: 95℃ for 3 min; 94℃ for 25 s, 55-64℃ for 25 s, 72℃ for 10-15 s / 1kb DNA, 37 cycles; 72℃ for 5 min, store the product at 4℃.

[0052] The recovered products were ligated into the pGEM-T Easy vector, transformed into DH5α competent cells, and positive clones were selected for plaque PCR detection. The positive clones were then subjected to Sanger sequencing, and the sequencing results were accurate. Figure 1 ).

[0053] Example 2: Construction of the plant expression vector PCAMBIAsuper1300-GFP-PacircPEX

[0054] After cloning the target fragment, the intron fragment, the circular region cDNA of circRNAs (with flanking wings), and the reverse complementary sequence of the intron fragment are inserted into the empty vector in sequence according to the "flanking intron reverse complementation strategy".

[0055] The specific steps are as follows:

[0056] First, the circular region of circRNAs and the intron fragment were amplified and spliced ​​by PCR. Then, the empty vector PCAMBIAsuper1300-GFP was linearized by double digestion with Hind III-Spe I. Finally, the spliced ​​PCR product and the vector were ligated using a plant-compatible seamless cloning and recombination kit, strictly following the instructions. After successful transformation, the vector was plated, and positive clones were selected for sequencing verification. For vectors that were correctly sequenced and verified, plasmids were extracted and linearized by single digestion with Xba I. The linearized vector and the inverse complementary fragment of the intron were then ligated using a seamless cloning and recombination kit. After transformation, the vector was plated, and positive clones were selected for double digestion with Hind III-Spe I. Figure 2 After successful verification, Sanger sequencing is performed for further verification. Once successful verification, the desired overexpression vector can be obtained.

[0057] The specific steps of the double enzyme digestion experiment are as follows: Prepare the reaction system: 5 μL of 10×NEB rCutSmart buffer, 15 μL of the vector after two transformations, 1 μL of Spe I, 1 μL of Hind III, and 28 μL of sterile ultrapure water. After preparation, heat in a water bath at 37℃ for 4 h, and then detect the product bands using agarose gel electrophoresis.

[0058] The primers used in the process are as follows:

[0059] (1) PacircPEX amplification primers:

[0060] A: (SEQ ID NO.9)

[0061] GGTTTTAGTTCTTCTATGCAATTGCTGCAGATTGAACTTGTTTCTAGGAGGCCTTG

[0062] S:(SEQ ID NO.10)

[0063] ATACACCAAATCGACTCTAGAAAGCTTGGCACTGGGTTTCTTATTAAAGAATATGT

[0064] (2) Primers for intron fragment amplification:

[0065] A:CTGCAGCAATTGCATAGAAGAACTAAAACC(SEQ ID NO.11)

[0066] S:(SEQ ID NO.12)

[0067] CTCACCATGGTACCGGATCCACTAGTGGTGAGTGCTTGCCTGCTTGGTA

[0068] (3) Primers for amplifying intron fragment reverse complementary sequences:

[0069] A:(SEQ ID NO.13)

[0070] ATACACCAAATCGACTCTAGAAAGCTTGTGAGTGCTTGCCTGCTTGG

[0071] S:(SEQ ID NO.14)

[0072] TCTTTAATAAGAAACCCAGTGCCCTGCAGCAATTGCATAGAAG

[0073] Example 3: Transformation of Arabidopsis thaliana with the plant expression vector PCAMBIAsuper1300-GFP-PacircPEX

[0074] (1) Thaw Agrobacterium competent cells in ice water. After thawing completely, add 1 μg of the constructed overexpression vector plasmid DNA to the Agrobacterium competent cells under aseptic conditions, gently mix with a pipette tip, and place back into ice water for 5 min. Place centrifuge tubes in liquid nitrogen and freeze for 5 min. Then immediately transfer the centrifuge tubes to a 37°C water bath and heat for 5 min. Finally, place the centrifuge tubes back into ice water for 5 min.

[0075] (2) Under aseptic conditions, add 800 μL of antibiotic-free YEP medium and incubate in a shaker at 28°C and 200 rpm for 2-3 hours. For solid YEP medium, add 100 μL of kanamycin sulfate (Kan) and 50 μL of rifampicin solution to every 100 mL of medium. Under aseptic conditions, take 20-60 μL of bacterial suspension and spread it onto the solid YEP medium containing antibiotics. After the bacterial suspension is completely dried, invert it in an incubator at 28°C and incubate for 2-3 days until colonies grow. For liquid YEP medium, after sterilization, add the antibiotics Kan and rifampicin. Pick colonies from the plate and place them into YEP medium, then incubate in a shaker at 28°C and 200 rpm for about 12-14 hours.

[0076] (3) PCR amplification and Sanger sequencing were performed using Agrobacterium bacterial culture as a substrate to ensure that the target gene and introns were completely transferred into Agrobacterium. The correctly tested Agrobacterium culture was transferred to YEP medium with antibiotics and cultured until the OD value reached 1.0-1.2. The culture with the target OD value was transferred to a 50 mL enzyme-free centrifuge tube and centrifuged at 4000 rpm for 15 min at 4℃. After centrifugation, the precipitate was collected, and an invasion dye was added to the precipitate. Silwet L-77 adsorbent was added to the invasion dye at a rate of 250 μL per 50 mL of invasion dye.

[0077] The formulation of the inoculum solution is as follows (per 100 mL): MS powder 0.43 g; sucrose 20 g. Adjust the pH to 5.8-6.0, sterilize in a high-temperature autoclave for 20 minutes, and then cool to room temperature before use.

[0078] (4) Treatment of Arabidopsis thaliana plants used for infection:

[0079] The Arabidopsis plants were cultivated until they produced several flower stalks, and watered thoroughly one day in advance. During infection, the opened flowers and pods were removed, leaving only the unopened flower buds. The Arabidopsis flower stalks were immersed in the infection solution for 45 seconds, and then the infected Arabidopsis were placed in the dark for 24 hours. Finally, they were placed in a constant temperature incubator for normal cultivation.

[0080] (5) Screening of positive plants:

[0081] After infecting Arabidopsis thaliana, place the Arabidopsis thaliana in a constant temperature incubator and culture normally until pods form. After the seeds are fully mature and completely dried, collect the seeds and screen them.

[0082] Hygromycin B solution was added to solid 1 / 2 MS medium, with 75 μL of hygromycin B solution added per 100 mL of MS medium. Sterilized seeds were sown in the medium in a clean bench and vernalized at 4°C for 48 h. Then, the seeds were transferred to a tissue culture room for further cultivation. After approximately 10 days, positive Arabidopsis seedlings showed normal growth, while wild-type Arabidopsis only exhibited simple germination and failed to grow and leaf out normally. Total RNA was extracted from the positive Arabidopsis plants and reverse transcribed to obtain cDNA. PCR amplification was performed using the reverse primer of the circular RNA, and the bands were detected by agarose gel electrophoresis. Sanger sequencing was also used to ensure the presence of the introduced DNA fragment in the transgenic plants. Figure 3 Successfully transferred positive Arabidopsis seedlings were selected as the T1 generation, and further screening and culture were carried out until the T3 generation of positive transgenic Arabidopsis lines were obtained.

[0083] The primer sequences used to verify positive plants are as follows:

[0084] divergent F:CTTTGAGATCTGCCCCAATG(SEQ ID NO.15)

[0085] divergent R:AGGGAGCAGCTGTGCTAAAA(SEQ ID NO.16)

[0086] Example 4: Detection of growth morphological indicators of transgenic Arabidopsis thaliana seedlings at 7 days old under drought stress.

[0087] (1) Types and gradients of drought stress treatments

[0088] Several gradients of simulated drought stress culture media were prepared using PEG6000 (polyethylene glycol) and mannitol respectively to test the root development of Arabidopsis thaliana under drought stress. This experiment used solid 1 / 2 MS medium, with PEG6000 and mannitol added to simulate drought stress, with the specific concentration gradients as follows:

[0089] PEG simulated drought: 0% PEG6000; 2% PEG6000; 4% PEG6000; 6% PEG6000.

[0090] Mannitol simulated drought: 0 mmol / L mannitol; 100 mmol / L mannitol; 200 mmol / L mannitol; 300 mmol / L mannitol; 400 mmol / L mannitol.

[0091] (2) Transplanting Arabidopsis thaliana seedlings

[0092] Wild-type Arabidopsis thaliana seedlings (7 days old) growing on standard 1 / 2 MS medium and T3 generation transgenic Arabidopsis thaliana seedlings were placed on the surface of a gradient-simulated culture medium, ensuring the growth points of the seedlings were aligned horizontally as much as possible. Each drought gradient included one group of wild-type Arabidopsis thaliana seedlings and three groups of transgenic Arabidopsis thaliana seedlings from different strains. Each group contained three Arabidopsis thaliana seedlings from the same strain with approximately the same root length and growth status. After the Arabidopsis thaliana seedlings were placed, the culture medium was placed vertically in a tissue culture room for incubation. After 7 days of continued incubation, the root length, number of lateral roots, and true leaf growth status, size, and color of the transgenic and wild-type Arabidopsis thaliana seedlings were observed under different drought gradients.

[0093] (3) Drought resistance of transgenic Arabidopsis thaliana

[0094] After 7 days of drought stress, root elongation in wild-type Arabidopsis thaliana was significantly inhibited in the high-concentration drought medium, and the number of lateral roots was also significantly reduced. In contrast, the roots of transgenic Arabidopsis thaliana were significantly longer than those of wild-type, with more lateral roots, and were less affected. Their root activity was also greater in the drought medium than that of wild-type roots. Furthermore, the leaves of transgenic Arabidopsis thaliana were larger, had more true leaves, and showed less yellowing and drying than those of wild-type. Figure 4 , Figure 5 ).

[0095] Example 5: Drought resistance test of transgenic Arabidopsis thaliana seedlings at 20 days old.

[0096] When the transgenic Arabidopsis T3 generation reached 20 days of age, healthy and well-grown Arabidopsis seedlings were selected for subsequent drought resistance testing.

[0097] Transgenic Arabidopsis thaliana plants in good growth condition and wild-type Arabidopsis thaliana plants were thoroughly watered the night before. Water was then withheld to allow for natural drought. The control group was not subjected to water withholding and was watered normally throughout the process. Simultaneously, samples were collected on days 0, 2, 4, 6, and 8. Arabidopsis thaliana leaves were immediately flash-frozen in liquid nitrogen for dehydration and then stored at -80°C. The activities of peroxidase (POD) and superoxide dismutase (SOD) in Arabidopsis thaliana leaves under each drought treatment gradient were measured using ultraviolet spectrophotometry.

[0098] Without drought treatment, the POD and SOD activities of the PacircPEX transgenic Arabidopsis were slightly higher than those of the wild type, and the two enzyme activities were basically the same in both genotypes with no significant differences. However, with the increase of drought duration, the POD and SOD activities of the transgenic were higher than those of the wild type. Specifically, when the drought duration reached 8 days, the POD enzyme activity of the wild-type Arabidopsis began to decrease significantly, but the POD enzyme activity of the PacircPEX transgenic remained high, significantly higher than that of the wild type. This indicates that the circRNA does indeed regulate the PEX gene family, promote peroxisome activity, and increase the peroxisome activity of Arabidopsis under drought conditions. Figure 6 A, 6B).

[0099] Furthermore, after ten days of drought, Arabidopsis thaliana was dug up from the soil, the roots were washed clean, and the root growth was observed. It was clearly visible that the roots of the PacircPEX transgenic Arabidopsis thaliana were longer than those of the wild-type Arabidopsis thaliana. Figure 7 ).

[0100] Note: Soil moisture content for each drought gradient is as follows: 0d: 39.02%; 2d drought: 37.98%; 4d drought: 28.28%; 6d drought: 19.35%; 8d drought: 10.50%.

[0101] Example 6: PEX family gene expression analysis in transgenic Arabidopsis thaliana

[0102] The parent gene PH02Gene45872 of the circular RNA belongs to the PEX (peroxisome-generate protein) family. To explore the specific regulatory process of the circular RNA on its parent gene, three genes from this family were selected for subsequent experiments. Primers for these genes were designed using Primer Premier 5 software, and 18S (18S ribosomal RNA) was used as an internal control gene. Its expression level was detected using real-time quantitative PCR. The primers used are as follows:

[0103] Arabidopsis-PEX2:

[0104] S:GCCAGGAATGCTTCTTCAATAC(SEQ ID NO.17)

[0105] A:GAGGCAACGCAGTACCAAATC(SEQ ID NO.18)

[0106] Arabidopsis thaliana-PEX7:

[0107] S:GCGTAACTGAATCCGTCTCGT(SEQ ID NO.19)

[0108] A:ATCTTCACTGAGCCGTCACCAA(SEQ ID NO.20)

[0109] Arabidopsis thaliana-PEX5:

[0110] S:AACCCAGGAAAGGCTCAAGGA(SEQ ID NO.21)

[0111] A:AACCACGGAAGAACTCTGACCC(SEQ ID NO.22)

[0112] Arabidopsis thaliana-18S:

[0113] S:ATCCAAGGAAGGCAGCAGG(SEQ ID NO.23)

[0114] A:GAAGGGACAAGCCGACCAA(SEQ ID NO.24)

[0115] In plants overexpressing PacircPEX, the expression levels of three genes in the PEX gene family—PEX2, PEX5, and PEX7—were all increased, with a particularly significant increase in PEX2 expression. This indicates that the circular RNA enhances the drought resistance of Arabidopsis thaliana by promoting high expression of PEX gene family genes and increasing peroxisome activity. Figure 8 ).

[0116] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for improving the drought resistance of plants, characterized in that, include: The circular RNA PacircPEX was overexpressed in a plant using genetic engineering methods; the cDNA nucleotide sequence of the circular RNA PacircPEX is shown in SEQ ID NO.2; the plant is Arabidopsis thaliana or Phyllostachys edulis.

2. The method according to claim 1, characterized in that, The overexpression is performed by introducing a vector containing cDNA of the circular RNA PacircPEX.

3. The method according to claim 1, characterized in that, The overexpression method involves increasing the copy number of the cDNA of the circular RNA PacircPEX on the plant chromosome.

4. The method according to claim 1, characterized in that, The overexpression is performed by operatively linking a strong promoter to the cDNA of the circular RNA PacircPEX.