A SNP molecular marker related to calyx length of tomato fruit and application thereof
By developing SNP molecular markers related to the length of tomato sepals, and using PCR amplification and sequencing technologies, the problem of early prediction of sepal length in the breeding process was solved, enabling early and efficient breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGSU ACAD OF AGRI SCI
- Filing Date
- 2023-12-04
- Publication Date
- 2026-04-28
AI Technical Summary
The lack of molecular markers related to the length of tomato sepals in existing technologies leads to a long breeding process, making it difficult to predict the length of sepals in the early stages and affecting breeding efficiency.
To develop a SNP molecular marker associated with the length of tomato fruit sepals, PCR amplification and sequencing were performed using a specific primer combination, and the polymorphism of the SNP site was used to predict the length of the fruit sepals. A kit and method for predicting the length of tomato fruit sepals were provided.
It enables early prediction of tomato sepal length, shortens the breeding cycle, improves the efficiency of breeding long-sepal tomato varieties, and reduces field planting costs.
Smart Images
Figure CN117625830B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular breeding technology, and in particular to a SNP molecular marker related to the length of the sepals of tomato fruit and its application. Background Technology
[0002] Tomato (Solanum lycopersicum) is one of the world's most important vegetable and cash crops, playing a significant role in promoting agricultural development and increasing farmers' income. With the development of greenhouses and solar greenhouses, the cultivation area of tomatoes is constantly expanding. However, as people's living standards improve, in addition to a beautiful appearance and delicious taste, consumers are increasingly concerned about the freshness of tomatoes. The simplest evaluation criterion for consumers is whether the sepals are wilted. The sepals are closely related to the appearance of the fruit. Long and thick sepals not only reflect the freshness of the fruit, but tomatoes with flat-based sepals also increase their aesthetic appeal, thus stimulating consumers' desire to buy. Furthermore, flat sepals reduce mechanical damage during transportation, ensuring good appearance quality, and are therefore an important aspect of commercial quality. Therefore, cultivating tomato varieties with long sepals has a promising market prospect.
[0003] In tomato breeding, the selection of long-calyx varieties is mainly carried out by visually observing the length of the sepals after the fruit has fully expanded, which is time-consuming. The application of molecular marker-assisted selection breeding can effectively shorten the breeding cycle, but at present there are no molecular markers linked to the trait for the selection of long-calyx varieties. Therefore, it is urgent to carry out the development of molecular markers linked to the tomato sepal length trait. Summary of the Invention
[0004] The purpose of this invention is to provide a SNP molecular marker related to the length of tomato sepals and its application, in order to solve the problems existing in the prior art. This SNP molecular marker co-segregates with the phenotype of tomato sepal length. By detecting the polymorphism at the SNP site of this molecular marker, the difference in tomato sepal length can be identified, thereby enabling early prediction of tomato sepal length, shortening the breeding cycle, and improving the breeding efficiency of long-sepal tomato varieties.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides an SNP molecular marker related to the length of the sepals of tomato fruit. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. There is an SNP site at 29 bp of the SNP molecular marker, which is an A / T mutation.
[0007] The present invention also provides a PARMS primer combination for amplifying the above-mentioned SNP molecular marker, comprising two specific upstream primers with nucleotide sequences as shown in SEQ ID NO.2 and a universal downstream primer with nucleotide sequences as shown in SEQ ID NO.4.
[0008] The present invention also provides the application of the above-described PARMS primer combination in the preparation of a kit for predicting the length of tomato fruit sepals.
[0009] The present invention also provides a kit for predicting the length of the sepals of tomato fruit, comprising the above-described PARMS primer combination.
[0010] The present invention also provides the application of the above-mentioned SNP molecular markers in predicting the sepal length of tomato fruit.
[0011] The present invention also provides the application of the above-mentioned PARMS primer combination in predicting the sepal length of tomato fruit.
[0012] The present invention also provides a method for predicting the length of the sepals of a tomato fruit, comprising the following steps:
[0013] Genomic DNA was extracted from the tomato plants to be tested;
[0014] Using the genomic DNA as a template, the genotypes of the SNP sites of the above-mentioned SNP molecular markers were obtained by PCR amplification and sequencing. Based on the genotypes, the length of the sepals of the fruit of the tomato plant under test was predicted. The length of the sepals of the fruit of the TT genotype was greater than that of the AA genotype.
[0015] Furthermore, PCR amplification and sequencing were performed using the aforementioned PARMS primer combination to obtain the genotypes of the SNP sites of the aforementioned SNP molecular markers.
[0016] Furthermore, the PCR amplification reaction system is as follows: 5 μL of 2×PARMS master mix, 0.15 μL each of two 10 μM specific upstream primers, 0.4 μL of 10 μM universal downstream primer, and 100 ng of DNA template, with ddH2O added to bring the total volume to 10 μL.
[0017] Furthermore, the PCR amplification reaction program is as follows: 94℃ for 15 min; 94℃ for 20 s, 65-57℃ for 1 min, 10 cycles; 94℃ for 20 s, 57℃ for 1 min, 32 cycles.
[0018] The present invention discloses the following technical effects:
[0019] This invention discloses a SNP molecular marker associated with the length of tomato sepals. This SNP molecular marker co-segregates with the tomato sepal length phenotype. By detecting polymorphisms at the SNP sites of this molecular marker, differences in tomato sepal length can be identified. Compared to existing methods using visual observation, using this SNP molecular marker for marker-assisted selection breeding allows for early prediction of tomato sepal length, thereby reducing field planting costs, shortening the breeding cycle, and improving the efficiency of breeding long-sepaled tomato varieties. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 The results of GWAS analysis on the length of tomato fruit sepals are shown in the figure. The orange dots in the figure indicate the SNPs that are significantly associated with the length of tomato fruit sepals, detected at position 64383448bp on chromosome 1.
[0022] Figure 2 The sepal length values were defined for 32 short sepal samples and 32 long sepal samples. The sepal length values for the 32 short sepal samples ranged from 5.51 to 15.42 mm, while the sepal length values for the 32 long sepal samples ranged from 35.92 to 48.75 mm. Detailed Implementation
[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0026] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0027] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0028] Example 1
[0029] SNP mining associated with tomato fruit sepal length: Genome-wide association studies (GWAS) were performed on the genomic data of 294 germplasm resources (shown in Table 1, donated by Professor Huang Sanwen's team) and fruit sepal length. A SNP significantly associated with tomato sepal length was detected at position 64383448 bp on chromosome 1, as shown below. Figure 1 As shown.
[0030] Method for measuring the length of tomato fruit sepals: Use vernier calipers to measure 5 fruits of the same maturity from each plant. When measuring, lay the sepals flat and measure from the point where the sepals connect to the fruit stalk.
[0031] Table 1 294 germplasm resources
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039] Note: " / " represents missing, "BIG" represents large-fruited tomato, "CER" represents cherry tomato, and "PIM" represents currant tomato.
[0040] Example 2
[0041] 1. Screening of test materials
[0042] In addition, 32 short-sepaled materials and 32 long-sepaled materials were selected (both varieties other than the 294 germplasm resources in Example 1). The sepal length of the 32 short-sepaled materials ranged from 5.51 to 15.42 mm, and the sepal length of the 32 long-sepaled materials ranged from 35.92 to 48.75 mm. Figure 2 ).
[0043] 2. Material handling
[0044] Place a leaf 1 cm long and wide into a deep-well plate (1.2 mL for 96 wells); add 100 μL of 0.3 M sodium hydroxide and grind the sample at 50 Hz for 2 min (using a Shanghai Jingxin tissue homogenizer) (until the sample is completely ground); after grinding, centrifuge at 3000 rpm for 1 min and boil in a water bath for 2 min; then add 200 μL of 0.2 M Tris-HCl (pH 6.8-7.0) and mix well, and boil in a water bath again for 2 min; after the water bath, centrifuge at 3000 rpm for 1 min, take the supernatant, dilute it 20 times, and freeze at -20℃ as a template for subsequent PCR amplification.
[0045] 3. Primer combination design for PARMS detection of SNP molecular markers
[0046] Based on the SNP loci obtained from the GWAS analysis results in Example 1, the position at 64383448 bp on chromosome 1 was located. One locus-specific primer and two SNP allele-specific primers (Allele T primer and Allele A primer) were designed. The Allele T primer ligates the FAM blue fluorescent adapter sequence, and the Allele A primer ligates the HEX green fluorescent adapter sequence. The primer sequences are shown in Table 2.
[0047] Table 2 Primer sequences
[0048]
[0049] Note: The underlined sequence is the fluorescent tag sequence.
[0050] The nucleotide sequence (SEQ ID NO.1) of the PCR amplification product is as follows:
[0051] ACTACAATCCTTAACATGTACTTCATACWTCCAAACAAGTCCTTTATCATATAGTC, where W is A or T.
[0052] 4. PCR reaction system and amplification procedure
[0053] The PCR reaction system is shown in Table 3:
[0054] Table 3 PCR reaction system
[0055]
[0056] The PCR reaction procedure is shown in Table 4 (ABI Gene Amp 9700 dual-head 384 PCR instrument):
[0057] Table 4 PCR reaction procedures
[0058]
[0059] 5. Genotyping results
[0060] After PCR, the fluorescence signal was read using a TECAN Infinite M1000 microplate reader, and then the converted fluorescence signal was analyzed using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to obtain a clear and intuitive genotyping map. The genotyping results were output according to the different colors (see Table 5). PARMS genotyping results for 32 short sepal materials showed that 29 materials had a HEX genotype, consistent with the material's A genotype. Two other materials had a deletion at this locus, resulting in a HEX genotype. One material did not show any results. PARMS genotyping results for 32 long sepal materials showed that 30 materials had a FAM genotype, consistent with the material's T genotype. Two other materials had a deletion at this locus, resulting in a HEX genotype. In summary, the PARMS results for 64 tested materials showed that the PCR genotyping results for 59 materials were consistent with the material's genotype, indicating that the molecular marker has a high accuracy rate.
[0061] Table 5. Comparison of genotypes and PARMS SNP typing results of 64 test materials
[0062]
[0063] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of a primer combination in the preparation of a kit for predicting the length of tomato fruit sepals, characterized in that, The primer combination includes two specific upstream primers with nucleotide sequences as shown in SEQ ID NO.2-3 and a universal downstream primer with nucleotide sequences as shown in SEQ ID NO.
4.
2. The application of a primer combination in predicting the length of tomato fruit sepals, characterized in that, The primer combination includes two specific upstream primers with nucleotide sequences as shown in SEQ ID NO.2-3 and a universal downstream primer with nucleotide sequences as shown in SEQ ID NO.
4.
3. A method for predicting the length of the sepals of a tomato fruit, characterized in that, Includes the following steps: Genomic DNA was extracted from the tomato plants to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer combination described in claim 1 to determine the genotype. Based on the genotype, the length of the sepals of the fruit of the tomato plant under test is predicted. The length of the sepals of the fruit of the TT genotype is greater than that of the AA genotype.
4. The method according to claim 3, characterized in that, The PCR amplification reaction system consisted of: 5 μL of 2×PARMSmaster mix, 0.15 μL each of two 10 μM specific upstream primers, 0.4 μL of 10 μM universal downstream primer, and 100 ng of DNA template, with ddH2O added to bring the total volume to 10 μL.
5. The method according to claim 3, characterized in that, The PCR amplification reaction program is as follows: 94℃ for 15 min; 94℃ for 20 s, 65-57℃ for 1 min, 10 cycles; 94℃ for 20 s, 57℃ for 1 min, 32 cycles.