An in vitro expression and purification method of a Pseudomonas - derived thioquinone oxidoreductase and its application
The expression and purification of Pseudoquinone oxidoreductase of Pseudomonas in E. coli was solved by genetic engineering technology, and its expression and purification problems were verified, and its conversion function on propylthiol was achieved, achieving the effect of reducing bacterial metabolic stress and alleviating sulfur stress.
Patent Information
- Application Number
- CN202311472755.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-07
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2043-11-07
AI Technical Summary
The prior art is difficult to effectively express and purify Pseudomonas-derived sulfone oxidoreductase, and its role in propylthiol metabolism has not been fully verified.
Through genetic engineering technology, the sqr gene of Pseudomonas was cloned into the pET28a vector and the protein was expressed in E. coli BL21. The sulfoquinone oxidoreductase was purified by Ni-NTA column to characterize its transformation function for propylthiol.
Successfully expressed and purified sulfur quinone oxidoreductase in vitro, proving that it has the ability to convert propylthiol, which is conducive to the application and transformation of thiol-degrading bacteria, reducing bacterial metabolic pressure and alleviating sulfur stress.
Smart Images

Figure CN117646015B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and specifically to a method for in vitro expression and purification of sulfide: quinone oxidoreductase derived from Pseudomonas and its application. Background Art
[0002] Sulfide: quinone oxidoreductase (SQR) belongs to the flavoprotein disulfide oxidoreductase family and is an enzyme that generates reactive sulfur species (RSS), which can promote the conversion of sulfide to persulfide by bacteria. SQRs can be classified into six types according to sequence differences and evolutionary classification. Among them, type II SQRs, which may have a detoxifying effect, are found in animal mitochondria and bacteria. In heterotrophic bacteria, sulfide: quinone oxidoreductase (SQR) and persulfide dioxygenase (PDO) act synergistically to convert sulfide, generating intermediate products SO3 2- and S2O3 2- .
[0003] Propanethiol (PT) is composed of a mercapto group and a propyl group and is a volatile organic sulfide (volatile organic sulfur compounds, VOSCs). It has a low olfactory threshold and an unpleasant odor, seriously polluting the atmospheric environment. Propanethiol can quickly harm the human body even at low concentrations, irritating the respiratory system and causing respiratory paralysis. Therefore, the research and development of treatment technologies for malodorous gases such as volatile organic sulfides including propanethiol have attracted global attention and emphasis. Pseudomonas putida S-1 is a strain isolated from activated sludge that can grow using propanethiol as the sole carbon source. The removal rate of 100 mg / m 3 PT is > 86% within 12 h. The transcriptional level of the sqr gene is significantly upregulated during the metabolism of PT by S-1, but its role in the metabolism of propanethiol remains to be verified. Therefore, the present invention provides a method for in vitro expression and purification of sulfide: quinone oxidoreductase derived from Pseudomonas and its application. By means of in vitro expression and separation and purification, a sulfide: quinone oxidoreductase is obtained and its function of converting propanethiol is characterized, which will be beneficial to the application and transformation of thiol-degrading bacteria. Summary of the Invention
[0004] Aiming at the deficiencies of the existing technology, the purpose of the present invention is to provide a method for in vitro expression and purification of sulfide: quinone oxidoreductase derived from Pseudomonas and its application, so as to solve the problems raised in the above background art. The present invention uses genetic engineering technology to express sulfide: quinone oxidoreductase (SQR) derived from Pseudomonas in vitro, and separates and purifies the protein, making it applicable to the conversion of propanethiol to reduce the metabolic pressure of bacteria and relieve sulfur stress.
[0005] To achieve the above object, the present invention is realized by the following technical solutions: A method for in vitro expression and purification of a thiolquinone oxidoreductase derived from Pseudomonas, the in vitro expression and purification method uses the whole genome of Pseudomonas S-1 as a template, selects pET28a and Escherichia coli BL21 as the expression vector and expression host respectively, and mainly includes the following steps:
[0006] Step 1: Construct a recombinant expression vector: Design primers for amplifying the sqr gene, introduce a BamHⅠ restriction enzyme site at the 5' end of the forward primer, and introduce a HindⅢ restriction enzyme site at the 5' end of the reverse primer. After PCR amplifying the sqr gene, use the one-step cloning technology to recombine it with the linearized vector pET28a after enzyme digestion;
[0007] Step 2: Transform the expression vector into Escherichia coli BL21 by heat shock transformation. After expanding the culture, induce the expression of thiolquinone oxidoreductase SQR under low-temperature conditions;
[0008] Step 3: Collect the bacteria and break them by ultrasonic treatment. The supernatant soluble protein after centrifugation after breaking is purified by a Ni-NTA (Nickel-nitrilotriacetic acid) column to obtain SQR protein;
[0009] Step 4: BL21 / pET28a-sqr whole cell and cell lysate enzyme reaction determination experiment: GC-MS characterizes its PT conversion phenotype to prove that the SQR protein is successfully expressed and has the ability to convert propanethiol to a certain extent.
[0010] In the said Step 3, the separation and purification method of thiolquinone oxidoreductase SQR includes bacterial activation, induced expression, collection of bacteria, cell disruption, sample treatment, column equilibration, impurity washing, and target elution.
[0011] In the activation process, inoculate the constructed expression strain BL21 / pET28a-sqr into a liquid medium of LB_Kana (Kana concentration 50 μg / mL), and culture overnight at 37°C and 180 rpm; Induction: Transfer to a new LB_Kana (Kana concentration 50 μg / mL) medium for expanded culture, culture to the logarithmic phase under the same culture conditions, and add 0.5 mM IPTG to induce at 20°C and 180 rpm for 16 h.
[0012] Further, collect the bacteria: Under the condition of 4°C, collect all the bacteria at 8000 rpm for 10 min, wash the bacteria 2 times with sterile PBS, and resuspend the bacteria with 15 mL PBS; Disruption: Use an ultrasonic disruptor to disrupt the bacteria under the condition of 4°C, and the disruption time can be appropriately extended until it becomes clear. Centrifuge at 4°C and 12000 rpm for 20 min, and collect the supernatant.
[0013] The operation adjustment during the ultrasonic disruption is as follows: working for 3 s, pausing for 4 s, power 250 W, amplitude 40%, and the total working time is 10 min.
[0014] Furthermore, for sample treatment: before passing through the column, 10% glycerol is added to the sample, and the equilibration buffer Binding buffer is added according to a ratio of 1:1 based on the sample volume; Loading the column: Take a pre-activated Ni-NTA column, add the above sample to the column in batches, incubate for 5 min, then open the lid to allow it to completely flow through the column, and the purification temperature is at room temperature.
[0015] Loading and eluting the target protein: Wash away the miscellaneous proteins with Washing buffer; Elution: Elute the target protein with Elution buffer, and collect all the eluates in separate tubes. Aliquot the protein solution and store it at -80 °C.
[0016] An application of the expression and purification method as described above, wherein the mutant strain obtained by the expression and purification method is applied to the degradation of propanethiol, reducing the metabolic pressure of the bacterial cells and alleviating sulfur stress by converting propanethiol.
[0017] Advantages of the present invention:
[0018] 1. By means of in vitro expression and separation and purification methods, the present invention obtains a thioredoxin quinone reductase and characterizes its function of converting propanethiol, which will be beneficial to the application and transformation of thiol-degrading bacteria.
[0019] 2. The in vitro expression and purification method of the thioredoxin quinone reductase derived from Pseudomonas utilizes genetic engineering techniques to express the thioredoxin quinone reductase SQR derived from Pseudomonas in vitro, and separates and purifies this protein, enabling it to be applied to the conversion of propanethiol, reducing the metabolic pressure of the bacterial cells and alleviating sulfur stress. Description of the drawings
[0020] Figure 1 Shows the results of PCR amplification of the sqr gene and linearization of the plasmid pET28a by restriction enzymes;
[0021] Figure 2 Shows agarose gel electrophoresis and colony PCR screening of DH5α / pET28a-sqr transformants;
[0022] Figure 3 Shows agarose gel electrophoresis and colony PCR screening of BL21 / pET28a-sqr transformants;
[0023] Figure 4 Shows SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) identification of protein expression and purification;
[0024] Figure 5 For the whole-cell reaction of the sqr heterologous expression bacterium to convert propanethiol;
[0025] Figure 6 For the in vitro conversion of propanethiol by the cell lysate of the sqr heterologous expression bacterium. Specific embodiments
[0026] In order to make the technical means, creative features, achieved purposes and effects of the present invention easy to understand, the present invention will be further described below in conjunction with specific embodiments.
[0027] Please refer to Figures 1 to 6 , the present invention provides a technical solution: a method for in vitro expression and purification of a thiolquinone oxidoreductase derived from Pseudomonas and its application, and the specific steps are as follows:
[0028] (1) Construction of the heterologous expression strain BL21 / pET28a-sqr
[0029] (1.1) Cloning of the gene sqr fragment
[0030] Using the genomic DNA of Pseudomonas S-1 as a template to amplify the sqr gene fragment, the PCR program is pre-denaturation at 95°C for 3 min, (denaturation at 95°C for 15 s; annealing at 61°C for 15 s; extension at 72°C for 1 min) × 32 cycles, and finally a total extension at 72°C for 5 min, and incubation at 4°C. The primer sequences and amplification system are as follows:
[0031] Table 1 Primer sequences
[0032] Primer Name Sequence 5’—3’ klsF cagcaaatgggtcgcggatccATGAATACTTATAAATTAAGTTCGGATTTTT klsR ctcgagtgcggccgcaagcttTTAATGCTCCGACTCGCTTGC
[0033] Table 2 sqr gene amplification system
[0034] System Volume (50 μL) 2×PhantaMax Master Mix 25 Template DNA 1 klsF 2 klsR 2 <![CDATA[ddH2O]]> 20
[0035] The PCR product was identified by agarose gel electrophoresis (the results are shown in Figure 1) After that, the DNA fragment was purified and recovered from the PCR reaction solution using the Sangon Biotech PCR Product Purification Kit (No. #B518141). Specific steps: Add 5 volumes of Buffer B3 to the PCR reaction solution, mix well and transfer all of it to the adsorption column. Centrifuge at 8000×g for 30 s to discard the liquid in the collection tube. Add 500 μL of Washing Solution, centrifuge at 9000×g for 30 s to discard the liquid in the collection tube, and repeat this step. After centrifuging the empty adsorption column at 9000×g for 1 min, open the lid for 2 min to completely remove the residual ethanol. Insert the adsorption column into a new centrifuge tube, add 30 μL of Elution Buffer (preheated to 60 °C) to the center of the adsorption membrane, let it stand at room temperature for 2 min, centrifuge at 9000×g for 1 min, collect the liquid after centrifugation, and store it at -20 °C.
[0036] (1.2) Extraction of expression plasmid pET28a (refer to the method of Sangon plasmid extraction kit)
[0037] Dip the glycerol tube-preserved BL21 / pET28a bacterial liquid, streak it on an LB solid plate containing 50 μg / mL kanamycin, and incubate it overnight in a 37 °C incubator. Pick a single colony and inoculate it into an LB liquid medium containing 50 μg / mL kanamycin, and culture it at 37 °C and 180 rpm for 12 - 16 h. Take 1 mL of the bacterial liquid, centrifuge at 8000×g for 2 min to discard the supernatant and collect the bacterial cells, and repeat this step 5 times. Add 250 μL of Buffer P1 to the bacterial cell precipitate to completely disperse the bacterial cells, add 250 μL of Buffer P2, gently invert and let it stand for 3 min, add 350 μL of Buffer P3, gently invert 5 - 10 times until well mixed. After mixing, centrifuge at 12000×g for 10 min, carefully transfer the supernatant to the adsorption column, and centrifuge at 9000×g for 30 s to discard the liquid in the collection tube. Add 500 μL of deproteinized solution Buffer DW1 to the adsorption column, centrifuge at 9000×g for 30 s to discard the liquid in the collection tube. Add 500 μL of Wash Solution to the adsorption column, centrifuge at 9000×g for 30 s to discard the liquid in the collection tube, and repeat this step. After centrifuging the empty adsorption column at 9000×g for 1 min, open the lid for 2 min to completely remove the residual ethanol. Insert the adsorption column into a new centrifuge tube, add 80 μL of Elution Buffer (preheated to 60 °C) to the center of the adsorption membrane, let it stand at room temperature for 2 min, centrifuge at 9000×g for 1 min, and the liquid collected after centrifugation is the plasmid, which is stored at -20 °C.
[0038] Table 3 Double digestion reaction system
[0039] System Volume (μL) Plasmid 1000 ng / c 10×QuickCut Buffer 2 QuickCut BamHⅠ 1 QuickCut HindⅢ 1 <![CDATA[ddH2O]]> to 20 μL
[0040] After incubation in a 37 °C water bath for 1 h, add 5 μL of 6× Loading Buffer to terminate the reaction. Identification by agarose gel electrophoresis (results are shown in Figure 1 ) and then use the Sangon PCR product purification kit to purify and recover the linearized fragment of the plasmid from the enzyme reaction solution. The specific steps are the same as those for the above-mentioned PCR product purification method.
[0041] (1.3) Construction of the recombinant vector pET28a-sqr: Add the following reactants as follows:
[0042] Table 4 One-step cloning system
[0043] System Volume (μL) Linearized Vector 107 ng / c sqr Fragment 67 ng / c 5×CEⅡ Buffer 4 ExnaseⅡ 2 <![CDATA[ddH2O]]> to 20 μL
[0044] After incubation in a 37 °C water bath for 30 min, immediately place it on ice and cool for 5 min.
[0045] (1.4) Heat shock transformation
[0046] In this example, take 10 μL of the above recombinant reaction solution and add it to 100 μL of DH5α competent cells. Gently flick to mix, let it stand on ice for 30 min, perform heat shock at 42 °C in a water bath for 90 s, immediately place it on ice and let it stand for 2 min, add 900 μL of SOC liquid medium [2% Tryptone, 0.5% Yeast Extract, 0.05% NaCl, 2.5 mM KCl, 10 mM MgCl2, 20 mM glucose], mix well and incubate at 37 °C, 180 rpm for 1.5 h. After recovery, centrifuge at 5000 rpm for 3 min, resuspend with 200 μL of sterile water, take 70 μL and spread it on LB_Kana (Kana concentration 50 μg / mL) solid medium, and incubate it upside down at 37 °C overnight.
[0047] (1.5) Colony PCR screening for positive transformants
[0048] Pick several single colonies and dissolve them in 10 μL of sterile water. Use them as templates for colony PCR identification respectively. The PCR program is pre-denaturation at 95 °C for 3 min, (denaturation at 95 °C for 15 s; annealing at 60 °C for 15 s; extension at 72 °C for 1 min) × 30 cycles, and finally extension at 72 °C for 5 min, and keep it at 4 °C. The primer sequences and amplification system are as follows:
[0049] Table 5 Primer sequences
[0050] Primer Name Sequence 5’—3’ zysF AGCCCCCGATTTAGAGCTTG zysR TTGATAGTAGTGCGCGTCGG
[0051] Table 6 Colony PCR system
[0052] System Volume (25 μL) 2×PhantaMax Master Mix 12.5 Template DNA 1 zysF 2 zysR 2 <![CDATA[ddH2O]]> 7.5
[0053] In this example, the PCR products were identified by agarose gel electrophoresis (the results are shown in Figure 2 ). After that, the positive transformants were inoculated into a liquid medium of LB_Kana (Kana concentration: 50 μg / mL) and cultured overnight at 37 °C and 180 rpm. Then, 1 mL of the bacterial liquid sample was sent for sequencing. The bacterial liquid with correct sequencing results was preserved in a glycerol tube at -80 °C.
[0054] (1.6) Recombinant plasmid extraction and heat shock transformation
[0055] The remaining bacterial liquid was simultaneously subjected to plasmid extraction (using the same method as above). 10 μL of the positive clone plasmid was added to 100 μL of BL21(DE3) competent cells, gently flicked to mix evenly, left standing on ice for 30 min, heat shocked in a 42 °C water bath for 90 s, immediately placed on ice and left standing for 2 min, then 900 μL of SOC liquid medium was added, mixed evenly and recovered at 37 °C and 180 rpm for 1.5 h. After recovery, it was centrifuged at 5000 rpm for 3 min, resuspended with 200 μL of sterile water, and 70 μL was taken and spread on a solid medium of LB_Kana (Kana concentration: 50 μg / mL), and then inverted and cultured overnight at 37 °C.
[0056] (1.7) Screening and identification of BL21 / pET28a-sqr strains
[0057] Several single colonies were picked and dissolved in 10 μL of sterile water, and colony PCR identification was carried out using these as templates respectively. The PCR program was pre-denaturation at 95 °C for 3 min, (denaturation at 95 °C for 15 s; annealing at 60 °C for 15 s; extension at 72 °C for 1 min) × 30 cycles, and finally extension at 72 °C for 5 min, and kept at 4 °C. The primer sequences and amplification systems are shown in the above table. The PCR products were identified by agarose gel electrophoresis (the results are shown in Figure 3 ). After that, the positive transformants were inoculated into a liquid medium of LB_Kana (Kana concentration: 50 μg / mL) and cultured to the logarithmic phase at 37 °C and 180 rpm, and then preserved in an ultra-low temperature glycerol tube at -80 °C.
[0058] (2) Induction and purification of SQR protein
[0059] (2.1) Obtaining soluble protein SQR: Inoculate the constructed expression strain BL21 / pET28a-sqr into a liquid medium of LB_Kana (Kana concentration 50 μg / mL), culture overnight at 37 °C and 180 rpm, then transfer and expand the culture, culture to the logarithmic phase under the same culture conditions, add 0.5 mM IPTG and induce at low temperature of 20 °C and 180 rpm for 16 h. Under the condition of 4 °C, collect all the bacteria at 8000 rpm for 10 min, wash the bacteria twice with sterile PBS, and resuspend the bacteria in 15 mL PBS. Use an ultrasonic crusher to perform ultrasonic disruption at 4 °C (working for 3 s, pausing for 4 s, power 250 W, amplitude 40%, total working time 10 min), and the disruption time can be appropriately extended until it becomes clear. Centrifuge at 4 °C and 12000 rpm for 20 min, and collect the supernatant.
[0060] (2.2) Purifying SQR protein with a gravity column His-tag: (at room temperature)
[0061] S1. Sample treatment: Before passing through the column, add 10% glycerol to the sample to prevent protein hydrophobic aggregation and reduce non-specific adsorption during the treatment process. And add the equilibration buffer Binding buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 20 mM imidazole, pH ~ 7.2) according to a 1:1 ratio based on the sample volume.
[0062] S2. Take a pre-activated Ni-NTA column, add the above sample to the column in batches, incubate for 5 min, then open the lid to allow it to all flow through the column.
[0063] S3. Wash away the miscellaneous proteins with Washing buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 60 mM imidazole, pH ~ 7.2).
[0064] S4. Elute the target protein with Elution buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 500 mM imidazole, pH ~ 7.2), and collect all the eluates in separate tubes.
[0065] (2.3) Identifying protein expression and purification by SDS-PAGE: Take samples from the crude enzyme solution, the flow-through solution, and each tube of eluate, add protein loading buffer and mix evenly, denature the protein completely at 95 °C for 10 min, and load the samples for SDS-PAGE to identify the band results. Use a BCA protein detection kit to measure the protein concentration before and after purification.
[0066] (3) Influence of SQR protein on the conversion of propanethiol
[0067] (3.1) Detection of the content of propanethiol by GC-MS
[0068] In this example, an HP-5MS capillary column was used, with helium as the carrier gas (flow rate: 0.8 mL / min), the inlet temperature was 230 °C, the column oven temperature was maintained at 150 °C for 2.5 min, and the split ratio was 20:1. The molecular ion m / z (mass-to-charge ratio) 76 was selected as the quantitative ion, and m / z 47 and 78 were used as qualitative reference ions. The ionization energy was 70 eV, and the temperatures of the mass spectrometry interface, ion source, and quadrupole were 270 °C, 230 °C, and 150 °C, respectively. The headspace gas was quantitatively analyzed for propanethiol using the single ion monitoring (SIM) mode.
[0069] (3.2) Determination of whole-cell enzyme reaction
[0070] BL21 / pET28a-sqr and BL21 / pET28a were respectively inoculated into liquid media of LB_Kana (Kana concentration: 50 μg / mL), cultured overnight at 37 °C and 180 rpm, transferred for enlarged culture, and cultured to the logarithmic phase under the same culture conditions. Then, 0.5 mM IPTG was added for low-temperature induction at 20 °C and 180 rpm for 16 h. At 4 °C, all the bacterial cells were collected by centrifugation at 8000 rpm for 10 min, washed twice with sterile PBS, and resuspended in PBS. Each group was diluted to an OD 600 value close to each other. 125 mg / L propanethiol (1.6 mM) was added, and the peak areas of propanethiol at the initial time and after 12 h were measured.
[0071] (3.3) Determination of cell lysate enzyme reaction
[0072] BL21 / pET28a-sqr and BL21 / pET28a were respectively inoculated into liquid media of LB_Kana (Kana concentration: 50 μg / mL), cultured overnight at 37 °C and 180 rpm, transferred for enlarged culture, and cultured to the logarithmic phase under the same culture conditions. Then, 0.5 mM IPTG was added for low-temperature induction at 20 °C and 180 rpm for 16 h. At 4 °C, all the bacterial cells were collected by centrifugation at 8000 rpm for 10 min, washed twice with sterile PBS, and resuspended in 15 mL PBS. Ultrasonic disruption was performed using an ultrasonic disruptor at 4 °C (working for 3 s, pausing for 4 s, power: 250 W, amplitude: 40%, total working time: 10 min), and the disruption time could be appropriately extended until clarification. Centrifugation was carried out at 4 °C and 12000 rpm for 20 min, and the supernatant was collected. 125 mg / L propanethiol was added, and the peak areas of propanethiol at the initial time and after 12 h of reaction were measured by GC-MS.
[0073] The illustrated results show that the expression of the SQR protein enables the recombinant BL21 to have the ability to metabolize propanethiol to a certain extent.
[0074] The foregoing has shown and described the basic principles, main features and advantages of the present invention. For a person skilled in the art, it is obvious that the present invention is not limited to the details of the above-described exemplary embodiments, and without departing from the spirit or basic characteristics of the present invention, the present invention can be implemented in other specific forms. Therefore, in any regard, the embodiments should be regarded as exemplary and non-limiting. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be embraced within the present invention. Any reference signs in the claims should not be construed as limiting the claims involved.
[0075] In addition, it should be understood that although this specification is described according to embodiments, not every embodiment only contains an independent technical solution. This narrative manner of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. Application of an in vitro expression and purification method of a thiolquinone oxidoreductase derived from Pseudomonas with the ability to convert propanethiol, characterized in that: This in vitro expression and purification method uses the whole genome of Pseudomonas sp. S-1 as a template, selects pET28a and Escherichia coli BL21 as the expression vector and expression host respectively, and mainly includes the following steps: Step 1. Construction of a recombinant expression vector: Design primers for amplifying the sqr gene. Introduce a BamHⅠ restriction enzyme site at the 5' end of the forward primer and a HindⅢ restriction enzyme site at the 5' end of the reverse primer. After PCR amplifying the sqr gene, use the one-step cloning technique to recombine it with the linearized vector pET28a after digestion. The sequence of the forward primer klsF after introducing the restriction enzyme site is: 5'-cagcaaatgggtcgcggatccATGAATACTTATAAATTAAGTTCGGATTTTT-3', and the sequence of the reverse primer klsR is: 5'-ctcgagtgcggccgcaagcttTTAATGCTCCGACTCGCTTGC-3'; Step 2. Transform the expression vector into Escherichia coli BL21 by heat shock transformation. After expanded culture, induce the expression of sulfide quinone reductase SQR under low-temperature conditions; Step 3. Collect the bacterial cells and break them by ultrasonic treatment. The soluble protein in the supernatant after centrifugation of the broken cells is purified by Ni-NTA column to obtain SQR protein; Step 4. Enzyme reaction assay of BL21 / pET28a-sqr whole cells and cell lysates: Characterize its phenotype by GC-MS to prove that the SQR protein is successfully expressed and has the ability to convert propanethiol to a certain extent; The Escherichia coli mutant strain obtained by this expression and purification method is applied to the degradation of propanethiol, reducing the metabolic pressure of the bacterial cells and alleviating sulfur stress by converting propanethiol.
2. The application according to claim 1, characterized in that: In the said Step 3, the separation and purification method of sulfide quinone reductase SQR includes bacterial cell activation, induced expression, collection of bacterial cells, cell disruption, sample treatment, column equilibration, impurity washing, and target elution.
3. The application according to claim 2, characterized in that: In the activation process, inoculate the constructed expression strain BL21 / pET28a-sqr into the LB_Kana liquid medium with a kanamycin concentration of 50 μg / mL, and culture overnight at 37 °C and 180 rpm; Induction: Transfer to a new LB_Kana medium with a kanamycin concentration of 50 μg / mL for expanded culture. Culture to the logarithmic phase under the same culture conditions, add 0.5 mM IPTG (isopropyl β-D-thiogalactoside), and induce at 20 °C and 180 rpm for 16 h.
4. The application according to claim 2, characterized in that Collection of bacterial cells: Under the condition of 4 °C, collect all bacterial cells at 8000 rpm for 10 min, wash the bacteria 2 times with sterile PBS (phosphate-buffered saline), and resuspend the bacterial cells with 15 mL of PBS; Disruption: Use an ultrasonic disruptor to disrupt the cells under the condition of 4 °C. The disruption time can be appropriately extended until it becomes clear. Centrifuge at 4 °C and 12000 rpm for 20 min, and collect the supernatant.
5. The application according to claim 4, characterized in that The operation adjustment during the ultrasonic disruption process is: work for 3 s, pause for 4 s, power 250 W, amplitude 40%, and the total working time is 10 min.
6. The application according to claim 2, characterized in that Sample treatment: Before column chromatography, 10% glycerol was added to the sample, and the equilibration buffer Binding buffer was added in a 1:1 ratio according to the sample volume; Column loading: Take a pre-activated Ni-NTA column, add the above sample to the column in batches, incubate for 5 min, then open the lid to allow all of it to flow through the column. The purification temperature was at room temperature.
7. The application according to claim 2, characterized in that Washing: Wash away the miscellaneous proteins with Washingbuffer; Elution: Elute the target protein with Elutionbuffer. All eluents were collected in separate tubes, and the protein solution was aliquoted and stored at -80 °C.
Citation Information
Patent Citations
Construction method of Sul-de-Quinone Reductase gene vector and genetic engineering lactic acid bacteria strain of Sul-de-Quinone Reductase gene vector
CN102559732A
Sulfide quinone oxidoreductase intestinal tract directed expression vector and cell line thereof
CN102643853A