A DNA nano-antisense drug targeting microRNA, its preparation method and application

Abstract

The application discloses a DNA nano antisense drug targeting microRNA, a preparation method and application thereof. The DNA nano antisense drug comprises a DNA nanostructure as a carrier, antisense peptide nucleic acid and selected aptamer, the DNA nanostructure wraps the antisense peptide nucleic acid, and exposes the selected aptamer, the antisense peptide nucleic acid is connected to the 3' end of a staple chain constituting the DNA nanostructure, and the selected aptamer is modified to the 5' end extended from another staple chain constituting the DNA nanostructure, and the antisense peptide nucleic acid can specifically recognize target microRNA in tumor cells. The DNA nano antisense drug has the advantages of simple preparation process, low price and harmless metabolic products, has strong specific binding effect on target microRNA and can promote cell apoptosis, and has great application value in the field of anticancer drug preparation.

Description

Technical Field

[0001] This invention relates to a DNA nano-antisense drug, and more particularly to the construction and application of a DNA nanoribbon based on antisense peptide nucleic acid (asPNA). Specifically, it involves constructing a novel DNA nano-antisense drug that targets microRNA, targeted by the AS1411 aptamer. The asPNA binds to the target microRNA in tumor cells and promotes apoptosis. This invention belongs to the field of nanomedicine technology. Background Technology

[0002] MicroRNAs (miRNAs, miRs) are a class of endogenous non-coding RNAs of approximately 19-24 nucleotides. They act as post-transcriptional repressors of target messenger RNAs (mRNAs), controlling gene expression and playing crucial regulatory roles in cell proliferation, apoptosis, and invasion. Abnormal expression patterns are associated with the pathogenesis of various diseases, including cancer. Esophageal cancer is the sixth leading cause of cancer-related deaths and the eighth most common cancer worldwide, with esophageal squamous cell carcinoma (ESCC) accounting for nearly 80% of all esophageal cancer cases globally. Studies have shown that various proto-oncogenetic miRNAs are closely related to the development and progression of ESCC. Specifically, overexpression of miR-21 in vivo is associated with lymph node metastasis or venous invasion of ESCC, and in vitro it can promote cell proliferation and ESCC invasion. In recent years, the use of simple, efficient, and non-invasive antisense oligonucleotide vectors to silence overexpressed proto-oncogenetic miRNAs for tumor therapy has been validated in clinical trials.

[0003] Silencing of proto-oncological miRNAs has been achieved through the use of various antisense oligonucleotides, including locked nucleic acids (LNAs), 2-O-methyl oligonucleotides, and antisense peptide nucleic acids (asPNAs). PNAs are synthesized by replacing the phosphodiester backbone of DNA with a charge-neutral N-(2-aminoethyl)glycine unit. Compared to other antisense oligonucleotides, PNAs exhibit higher specificity for miRNA binding and resistance to nuclease degradation. However, due to their electrically neutral backbone and molecular weight (3–6 kDa) exceeding the threshold for direct diffusion across the cell membrane, PNAs are essentially not absorbed by cells in vitro. Therefore, further increasing cellular uptake of PNAs has been a key issue hindering their widespread clinical application. To address this issue, direct coupling of one end of asPNA to positively charged cell-penetrating peptides (CPPs) or binding asPNA to novel biodegradable nanomaterial carriers has been applied to the efficient delivery of asPNAs. However, the application of CPPs is limited by their inherent toxicity and immunogenicity, difficulty in biochemical modification, and protease sensitivity. Furthermore, nanomaterials are limited by their potential biotoxicity and instability. Therefore, there is an urgent need to select alternative vectors for delivering asPNA without damaging normal mammalian cells.

[0004] DNA origami, as an excellent drug delivery carrier, possesses advantages such as high self-assembly precision, good biocompatibility, and good biodegradability, and has been successfully applied to oligonucleotide drug delivery. However, the traditional construction of DNA origami utilizes viral genomes as template strands, involving complex folding of hundreds of short strands. While this strategy has been widely used, its high cost, cumbersome design, and low carrying efficiency limit its clinical application as an oligonucleotide drug carrier. Therefore, DNA nanoribbon structures constructed using simple template strands based on DNA origami offer advantages such as low cost, controllable shape, high carrying efficiency, and high endocytosis efficiency, promoting their application in the construction of nano-assemblies, drug delivery, or disease treatment. Therefore, providing a simple, low-cost, and highly cell-targeting method for synthesizing asPNA antisense drugs based on DNA nanoribbons, and applying it to target specific miRNAs in esophageal cancer cells via asPNA to inhibit tumor cell proliferation and promote apoptosis, has significant practical implications. Summary of the Invention

[0005] The main objective of this invention is to provide a DNA nanoparticle antisense drug targeting microRNA, its preparation method, and its application, in order to overcome the shortcomings of the prior art.

[0006] To achieve the aforementioned objectives, the technical solution adopted by this invention includes:

[0007] This invention provides a method for preparing a DNA nanoparticle antisense drug targeting microRNA, comprising:

[0008] (1) Provide antisense peptide nucleic acid;

[0009] (2) Provides a template strand and a staple strand for self-assembly to form a DNA nanostructure, wherein one staple strand is extended at the end with a sequence complementary to an antisense peptide nucleic acid, and the other staple strand is modified at the end with a selected aptamer;

[0010] (3) The mixed system containing antisense peptide nucleic acid, template strand and staple strand is annealed and then self-assembled into DNA nanostructures in one step. At the same time, the antisense peptide nucleic acid is encapsulated and the selected aptamer is exposed to obtain DNA nano-antisense drugs targeting microRNA.

[0011] The present invention also provides a DNA nanoparticle antisense drug targeting microRNA, the DNA nanoparticle antisense drug comprising a DNA nanostructure as a carrier, an antisense peptide nucleic acid, and a selected aptamer, wherein the DNA nanostructure encapsulates the antisense peptide nucleic acid while exposing the selected aptamer, the antisense peptide nucleic acid is attached to the 3' end of a staple chain constituting the DNA nanostructure, and the selected aptamer is modified to the 5' end of another staple chain extending from the DNA nanostructure, the antisense peptide nucleic acid being able to specifically recognize target microRNA in tumor cells, act on specific genes, and inhibit tumor cell proliferation and promote tumor cell apoptosis.

[0012] The present invention also provides the application of the aforementioned DNA nanoantisense drug targeting microRNA in the preparation of targeted drugs for tumor gene therapy.

[0013] Accordingly, embodiments of the present invention also provide a targeted drug for tumor gene therapy, which includes the aforementioned DNA nanoantisense drug targeting microRNA.

[0014] Compared with the prior art, the beneficial effects of the present invention include at least the following:

[0015] 1) The DNA nanostructures prepared by this invention do not introduce any complex synthesis and organic solvents, and can effectively protect antisense peptide nucleic acids from the influence of these complex factors. They have the advantages of low cost, easy preparation, controllable structure, and high biocompatibility.

[0016] 2) This invention achieves efficient carrier of antisense peptide nucleic acid antisense drugs through one-step self-assembly, and the loaded aptamers have high cell targeting efficiency.

[0017] 3) The DNA nanoparticle antisense drug prepared by this invention has the advantages of safe, fast and simple preparation process, high antisense peptide nucleic acid loading efficiency, good gene delivery effect and high gene silencing efficiency. It can carry antisense peptide nucleic acid antisense sequences that specifically target various disease-related microRNAs to achieve the purpose of gene regulation. It can be used to treat diseases, especially cancer, by tail vein injection. At the same time, the DNA nanoparticle antisense drug of this invention is easy to prepare, has harmless metabolites, and has a strong effect of specifically binding to target microRNA and promoting cell apoptosis. It has great application value in the field of anticancer drug preparation. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a schematic diagram illustrating the one-step preparation of DNA nanoribbons carrying the antisense drug asPNA and their entry into cells to target microRNA according to the present invention.

[0020] Figure 2A and Figure 2B These are, respectively, schematic diagrams of the DNA nanoribbon (DNR) formed under optimal conditions in a typical embodiment of the present invention, and atomic force microscopy characterization diagrams of DNA nanoribbons (DNR+asPNA) loaded with the antisense drug asPNA prepared in one step.

[0021] Figure 3A and Figure 3B These are, respectively, biostability characterization diagrams of DNR+asPNA after incubation at 37°C for 0, 2, 4, 8, 12, 24, and 48 hours with freshly prepared RPMI-1640 medium containing 10% fetal bovine serum (FBS) in a typical embodiment of the present invention; and laser confocal microscopy images of the targeting properties of DNR+asPNA cells modified with Cy5.

[0022] Figure 4A , Figure 4B , Figure 4C These are, respectively, a cell proliferation activity diagram, an optical microscope image, and a corresponding miR-21 expression level analysis after gene inhibition using DNR+asPNA in a typical embodiment of the present invention, as well as a comparison diagram with the results of free asPNA and DNA nanoribbons carrying antisense drug antiDNA (DNR+antiDNA).

[0023] Figure 5 This is a typical embodiment of the present invention, showing the expression level analysis of the PDCD4 gene corresponding to miR-21 using DNR+asPNA, and a comparison of the results with those of free asPNA and DNR+antiDNA.

[0024] Figure 6 This is a cell apoptosis diagram using DNR+asPNA in a typical embodiment of the present invention, and a comparison diagram with the results of free asPNA and DNR+antiDNA. Detailed Implementation

[0025] In view of the many shortcomings of the existing technology, the inventors of this invention, through long-term research and extensive practice, have proposed the technical solution of this invention, which mainly involves the development of a method for preparing a DNA nanoparticle antisense drug targeting microRNA. The following will further explain and illustrate this technical solution, its implementation process, and its principles in conjunction with the accompanying drawings.

[0026] Please see Figure 1 As shown, one aspect of the present invention provides a method for preparing a DNA nanoparticle antisense drug targeting microRNA, comprising:

[0027] (1) Preparation of target antisense peptide nucleic acid (asPNA) oligomers;

[0028] (2) Design template strand and staple strand sequences for self-assembly to form DNA nanostructures, wherein one staple strand extends to the end of a sequence complementary to the antisense peptide nucleic acid (asPNA), and the other staple strand extends to the end of a selected aptamer sequence.

[0029] (3) A DNA nanostructure is formed by a one-step self-assembly reaction of a mixture of antisense peptide nucleic acid (asPNA), template strand and staple strand in a specific annealing process, while antisense peptide nucleic acid is encapsulated and selected aptamers are exposed, thus preparing a DNA nano-antisense drug carrying asPNA and targeted microRNA coupled with aptamers.

[0030] In some embodiments, during the preparation process of the present invention, step (1) includes: preparing the antisense peptide nucleic acid (asPNA) by solid-phase polypeptide synthesis technology.

[0031] In some embodiments, the nucleotide sequence of the synthesized antisense peptide nucleic acid (asPNA) is a complete complement of the proto-oncology microRNA (miRNA, miR). Its design and synthesis range can correspond to a variety of proto-oncology miRNAs, such as any one of miR-103, miR-106b, miR-151, miR-17, miR-181a, miR-21, miR-25, miR-93, etc., which are associated with esophageal cancer, but are not limited thereto.

[0032] In some embodiments, during the preparation process of this invention, the shape of the DNA nanostructure includes any one of rectangular sheets, triangular sheets, tubular, box-shaped, spherical, or linear shapes, but is not limited thereto. Further, the shape of the DNA nanostructure can preferably be a linear DNA nanoribbon structure.

[0033] The DNA nanoribbon structure prepared in this invention does not introduce any complex synthesis or organic solvents, effectively protecting asPNA from the influence of these complex factors. It has advantages such as low cost, ease of preparation, controllable structure, and high biocompatibility. Furthermore, the DNA nanoribbon structure can improve the cellular uptake rate of peptide nucleic acids, enabling them to exert better antisense drug efficacy.

[0034] DNA nanoribbon structures have a synergistic effect on cell targeting and promoting apoptosis. The aptamers in the DNA nanoribbon structure can improve cell targeting, and DNA nanoribbons can also increase the cell uptake rate of peptide nucleic acids and promote apoptosis.

[0035] Furthermore, the selected aptamers include, but are not limited to, the AS1411 aptamer sequence (having the sequence shown in SEQ ID NO: 6), mucin (MUC1), epithelial cell adhesion molecule (EPCAM) aptamer sequence, etc.

[0036] In some embodiments, the DNA nanostructure is self-assembled from two template strands S1 and S2 (i.e., the first template strand and the second template strand) and three staple strands (i.e., the first staple strand, the second staple strand, and the third staple strand). The first staple strand ST1 extends to a sequence complementary to the antisense peptide nucleic acid asPNA (which may be named ST1-PNA), and the third staple strand ST3 extends to a selected aptamer, such as the AS1411 aptamer sequence (which may be named ST3-AS1411).

[0037] Furthermore, the preparation method of the DNA nanoparticle antisense drug carrying asPNA is as follows: Two template strands S1 and S2, a staple strand extended with a sequence complementary to asPNA (ST1-PNA), a staple strand ST2, a staple strand extended with an AS1411 aptamer sequence (ST3-AS1411), and the asPNA strand are reacted in a specific molar ratio within a specific annealing procedure using a one-step reaction to obtain a DNA + asPNA nanoparticle antisense drug carrying asPNA and coupled with an aptamer. This invention achieves highly efficient asPNA antisense drug delivery through one-step self-assembly, and the loaded AS1411 aptamer exhibits highly efficient cell targeting.

[0038] In the preparation process of the present invention, the DNA nanoribbon template sequences are shown in Table 1. The first template strand S1 has the sequence shown in SEQ ID NO: 1, the second template strand S2 has the sequence shown in SEQ ID NO: 2, the first staple strand ST1-PNA has the sequence shown in SEQ ID NO: 3, the second staple strand ST2 has the sequence shown in SEQ ID NO: 4, and the third staple strand ST3 connected to the AS1411 aptamer has the sequence shown in SEQ ID NO: 5.

[0039] Furthermore, the antisense peptide nucleic acid is covalently linked to the 3' end of one staple chain constituting the DNA nanostructure, while the selected aptamer is coupled and modified to the 5' end of another staple chain constituting the DNA nanostructure.

[0040] Furthermore, the S1-Cy5 template chain sequence modified with the fluorescent group Cy5 is shown in Table 1 and is used in place of S1 for cell imaging.

[0041] Furthermore, the target miR-21 sequence is UAGCUUAUCAGACUGAUGUUGA, and the antisense peptide nucleic acid sequence targeting miR-21 is shown in SEQ ID NO.7.

[0042] Table 1: Sequences of DNA oligonucleotides and peptide nucleic acids a

[0043]

[0044]

[0045] a The underlined segment in ST1-PNA represents the segment complementary to asPNA; the underlined segment in ST3+AS1411 represents the AS1411 aptamer segment.

[0046] In some embodiments, the molar ratio of the antisense peptide nucleic acid asPNA, the template strand, and the staple strand is 1:1:1, and the antisense drug asPNA targeting microRNA is covalently linked to the 5' end of one staple strand constituting the DNA nanostructure.

[0047] In some embodiments, step (3) includes: mixing the template strand, staple strand and antisense peptide nucleic acid asPNA strand in a buffer solution in a certain proportion and annealing them; centrifuging the obtained product yields the DNA nano-antisense drug targeting microRNA.

[0048] In some embodiments, the annealing conditions include: first, reducing the annealing temperature from 95°C to 65°C at a rate of 0.2–0.5°C per second; then reducing the annealing temperature from 65°C to 20°C at a rate of 0.1–0.2°C per second; the entire annealing process takes 7–9 hours. This step aims to self-assemble single-stranded DNA into DNA nanostructures.

[0049] Furthermore, the buffer solution is 1×TAE / Mg 2+ Buffer solution.

[0050] Further, the centrifugation step includes: mixing the product obtained from the annealing treatment with 1×TAE / Mg 2+ The buffer solution was mixed and added to a 100 kDa centrifuge column, and then centrifuged to purify the DNA nanoparticle antisense drug.

[0051] In a more preferred embodiment, the method for preparing the DNA nanoparticle antisense drug specifically includes the following steps:

[0052] (1) Mix the DNA template strand, staple strand, and asPNA strand in a molar ratio of 1:1:1 in 1×TAE / Mg 2+ Annealing was performed in a buffer solution under the following conditions: the annealing temperature was reduced from 95°C to 65°C at a rate of 0.2–0.5°C per second; then the annealing temperature was reduced from 65°C to 20°C at a rate of 0.1–0.2°C per second; the entire annealing process took 7–9 hours to obtain a nanostructure of DNA nanoribbon carrying asPNA.

[0053] (2) The product obtained in step (1) is mixed with 1×TAE / Mg 2+ The buffer solution was mixed and added to a 100 kDa centrifuge column, and centrifuged (3000 g, 10 min, 3 times at 4 °C). Then, 1×TAE / Mg was used to analyze the mixture. 2+ Wash with buffer to remove assembled ssDNA. Finally, invert the inner tube of the ultrafiltration system into a new outer tube and centrifuge (1500g, 10 minutes, 4°C) to collect the purified DNA nanoparticle antisense drug for later use at 4°C.

[0054] Another aspect of the present invention provides a DNA nanoparticle antisense drug targeting microRNA prepared by the aforementioned preparation method.

[0055] Furthermore, the DNA nano-antisense drug consists of a DNA nanostructure as a carrier, an antisense peptide nucleic acid (asPNA), and a selected aptamer, wherein the DNA nanostructure encapsulates the antisense peptide nucleic acid while exposing the selected aptamer, thus possessing the ability to actively target tumors.

[0056] Furthermore, the DNA nanostructure is self-assembled from two template strands S1 and S2 and three staple strands ST1-PNA, ST2, and ST3-AS1411 sequences.

[0057] Furthermore, the antisense peptide nucleic acid is linked to the 3' end of one staple chain constituting the DNA nanostructure, while a selected aptamer (such as AS1411) is modified to the 5' end of another staple chain constituting the DNA nanostructure. Specifically, asPNA is linked to the 3' end of one staple chain constituting the DNA nanostructure through complementary base pairing.

[0058] The antisense peptide nucleic acid asPNA is a functional antisense drug that targets and inhibits microRNAs. It is formed by a one-step self-assembly of a DNA nanostructure using a DNA template strand, a staple strand, and an asPNA strand. During this process, asPNA is encapsulated, exposing the aptamer sequence, thus enabling active targeting of tumors. The asPNA loaded onto the DNA nanostructure can specifically recognize target microRNAs in tumor cells, act on specific genes, and inhibit tumor cell proliferation while promoting tumor cell apoptosis. This antisense drug has advantages such as a safe, rapid, and simple preparation process, high asPNA loading efficiency, good gene delivery effect, and high gene silencing efficiency.

[0059] The DNA nanoparticle antisense drug prepared by this invention can carry asPNA antisense sequences that specifically target various disease-related microRNAs, thereby achieving the purpose of gene regulation. It can be used to treat diseases, especially cancer, via tail vein injection.

[0060] Another aspect of the present invention provides the application of the aforementioned DNA nanoantisense drug targeting microRNA in the preparation of targeted drugs for tumor gene therapy.

[0061] Furthermore, the application includes the use of the aforementioned DNA nanoantisense drug targeting microRNA in tumor cell samples.

[0062] Accordingly, another aspect of the present invention provides a targeted drug for tumor gene therapy, comprising the aforementioned DNA nanoantisense drug targeting microRNA.

[0063] On the other hand, this invention provides a novel targeting complex for tumor gene therapy, addressing challenges in targeted biological therapy for tumors, particularly esophageal cancer. The DNA nanoribbon acts as a bridge, binding nucleic acids; the aptamer recognizes specific receptors on the surface of target cells; and the carried asPNA silences target microRNAs and regulates related genes. Therefore, this novel complex can target tumor cells and silence key genes, thereby achieving therapeutic effects on tumors.

[0064] In summary, this invention uses DNA nanostructures as carriers for the antisense drug asPNA, which has the advantages of simple preparation process and low cost compared to traditional DNA origami. At the same time, the DNA nano-antisense drug of this invention is easy to prepare, produces harmless metabolites, and has a strong effect of specifically binding to target microRNA and promoting cell apoptosis, making it of great application value in the field of anticancer drug preparation.

[0065] The technical solution of the present invention will be further explained below with reference to several preferred embodiments and accompanying drawings. However, the experimental conditions and setting parameters therein should not be regarded as limitations on the basic technical solution of the present invention. Furthermore, the scope of protection of the present invention is not limited to the following embodiments.

[0066] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0067] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0068] Example 1

[0069] I. Preparation of antisense peptide nucleic acid probes using solid-phase peptide synthesis technology

[0070] Antisense peptide nucleic acid was synthesized using solid-phase peptide synthesis technology. The carboxyl group of the first monomer of the target peptide was covalently linked to the amino group of a solid support (MBHA resin), immobilizing it onto the resin. Using this amino group as the starting point, it underwent acylation with the carboxyl group of an adjacent monomer to form a peptide bond. This process was then repeated, allowing the amino group of the resin peptide containing these two monomers to react with the carboxyl group of the next monomer, until the target peptide was formed, ending with an amino group. The target peptide was then cleaved from the resin, purified, lyophilized, and quantified to obtain the antisense peptide nucleic acid probe.

[0071] II. Synthesis and Characterization of DNA Nanoparticles Carrying asPNA

[0072] As shown in Table 1, all template chains S1 and S2, staple chains ST1-PNA, ST2 and ST3+AS1411, and the asPNA sequence were dispersed in a molar ratio of 1:1:1 in 1×TAE / Mg 2+ DNA nanoribbon structures (DNRs) were assembled in a buffer solution (0.04 M Tris, 0.0125 M magnesium acetate, 0.002 M EDTA, 0.02 M glacial acetic acid, pH 7.8) using an 8-hour annealing program (95 °C, 5 min; 95 °C - 65 °C, -0.5 °C / 1 s; 65 °C - 20 °C, -0.1 °C / 1 s; hold at 20 °C). After assembly, the DNRs were purified using a Millipore ultrafiltration tube (100 kDa MWCO, 3000 g rotation speed, 10 min, 3 times), and then purified with 1×TAE / Mg... 2+ Wash with buffer to remove unassembled single-stranded DNA, and finally dissolve in 1×PBS buffer at 4°C for later use. Figure 2A This is a schematic diagram of the folding of the DNA nanoribbon structure in this embodiment. Figure 2A (as shown in a and b) Figure 2A In DNR, with the aid of three types of 32-nt staple chains, two 48-nt template chains were folded into a rectangular unit, with each rectangle considered a periodic unit. Adjacent units were connected using the three types of staple chains to obtain a nanoribbon structure. Atomic force microscopy (AFM) imaging confirmed that this design could form rigid nanoribbons. Figure 2B As shown in c). When the asPNA probe was added, the nanoribbon morphology became bent ( Figure 2B As shown in d), the DNA nanostructure may not fully unfold due to the weakened adsorption force between the electrically neutral PNA carrier and the mica after being placed on the DNR, thus exhibiting a slightly bent shape. This indicates that asPNA can form DNA nano-antisense drugs carrying asPNA through base complementary pairing with the DNA template strand and staple strand in a one-step annealing assembly experiment.

[0073] III. Biostability of DNA Nanoparticles Antisense Drugs

[0074] DNR+asPNA samples were incubated with freshly prepared RPMI-1640 medium containing 10% fetal bovine serum (FBS) at 37°C for 0, 2, 4, 8, 12, 24, and 48 hours, and then characterized using 1.5% agarose gel electrophoresis to assess the biostability of DNR+asPNA. Figure 3AElectrophoresis results showed that after 2-8 hours of incubation (bands 2, 3, and 4), compared to the 0-hour sample without culture medium (band 1), shorter nanoribbons exhibited a gradual degradation trend. After 12 hours of incubation (band 5), longer nanoribbons also showed varying degrees of degradation. After 24 hours (band 6), over 65% of DNR remained undissociated. After 48 hours of incubation (band 7), DNR+asPNA further degraded. This protective dissociation mechanism may be due to the spatial effect of linear DNA origami, shielding the internal DNA strands from digestion in serum. This indicates that DNR+asPNA exhibits high stability with gradual degradation over time, a necessary condition for a potential imaging and delivery platform.

[0075] IV. Cell-targeting properties of DNA nano-antisense drugs

[0076] Take 5×10 4 KYSE150 esophageal squamous cell carcinoma cells were added to 35 mm confocal culture dishes and incubated for 12 hours. The cells were then co-incubated for 8 and 12 hours with DNR+asPNA modified with Cy5 fluorescent molecules at a final concentration of 400 nM, respectively. After washing twice with PBS to remove excess probe, the cells were fixed with 4% paraformaldehyde solution for 30 minutes, followed by incubation with 300 μL DAPI for 15 minutes. After washing three times with PBS, imaging was performed. The internalization process of DAPI and Cy5-labeled DNR+asPNA in the cell nucleus was imaged at 488 nm and 638 nm, respectively, using laser confocal fluorescence microscopy. The results are shown below. Figure 3B As shown, Cy5-DNR+asPNA folds into a G-quadruplex AS1411 aptamer at the ST3 end of the nanoribbon, which binds to nucleolin on the cell surface, facilitating DNR entry into the cell. After 8 hours of co-incubation with cells, confocal imaging showed a large area of ​​Cy5 fluorescence signal, indicating that the nanoribbon successfully entered the cell. After 12 hours, the fluorescence tended to be in a dispersed state, which may be related to the gradual dissociation of DNR+asPNA and its internalization and utilization by the cell.

[0077] V. Inhibition of Cell Proliferation and Targeting of miR-21 by DNA Nanoparticle Antisense Drugs

[0078] 3000 cells were added to 96-well plates and incubated for 12 hours. The cells were then co-incubated with 100 μL of medium containing asPNA, DNR, DNR+asPNA, and DNR+antiDNA drugs, respectively, with a final concentration of 400 nM. Each group was divided into 3 replicates, and blank wells (wells without cells or materials) and control wells (wells with cells but no materials) were set up. After incubation for 48 hours, cell proliferation activity was measured using CCK-8 reagent. Figure 4AThe results showed that, with prolonged exposure time, both free asPNA and DNR had little effect on the proliferation activity of KYSE150 cells. At higher doses, DNR+asPNA significantly enhanced the inhibitory effect on cell proliferation, demonstrating a marked advantage over the DNR+antiDNA control group. Furthermore, optical microscopy confirmed that, compared to other controls, DNR+asPNA exhibited a stronger inhibitory effect on the proliferation and invasion of KYSE150 cells. Figure 4B Then, after incubating the materials with the cells for 48 hours, the expression level of miR-21 in KYSE150 cells was detected by real-time quantitative PCR (RT-qPCR). Figure 4C The results showed that treatment of KYSE150 cells with DNR+asPNA significantly downregulated miR-21 gene expression by approximately 6-fold. However, asPNA treatment only reduced miR-21 gene expression by approximately 2-fold, and DNR+antiDNA treatment only reduced miR-21 levels by approximately 1.5-fold. These results confirm that DNR significantly increased cellular uptake of asPNA and the effectiveness of asPNA as an antisense drug targeting the proto-oncological miR-21 gene.

[0079] VI. Effects of DNA Nanoparticle Antisense Drugs on Apoptosis

[0080] miR-21 is a proto-oncogene miRNA. The miR-21 sequence binds to the 3' untranslated region 228-249 of the PDCD4 gene (e.g., ...). Figure 5 As shown in the diagram, negative regulation of PDCD4 in tumor cells inhibits apoptosis. Therefore, the inventors further investigated whether DNR+asPNA could regulate PDCD4 expression to trigger apoptosis. KYSE-150 cells were seeded in 12-well plates at a seeding density of 10-1. 5 / mL, then different materials (asPNA, DNR+antiDNA, DNR+asPNA) were added to a final concentration of 400 nM, with three replicates per group, and incubated for 48 hours. Intracellular PDCD4 protein levels were then detected using Western blotting. Figure 5 As shown, compared with asPNA or DNR+antiDNA, DNR+asPNA significantly increased PDCD4 protein levels, verifying the ability of asPNA to bind to the miR-21 gene target and regulate the PDCD4 protein. Further flow cytometry experiments were used to verify the apoptosis of KYSE150 esophageal cancer cells after co-incubation with different materials (asPNA, DNR+antiDNA, DNR+asPNA). Cells of the co-incubated materials were double-stained with Annexin V-FITC (labeled with fluorescein) and propidium iodide (PI), and the results were detected by flow cytometry within 1 hour. Figure 6 As shown, treatment of KYSE150 cells with DNA + asPNA induced 70% apoptosis, including early apoptotic cells in Q3 and late apoptotic cells in Q2. However, the apoptosis induced by asPNA was less than 25.6%, and the cell viability after treatment with DNR + antiDNA vector reached over 54.3%. These results validate that DNR transfecting target cells with antisense asPNA targeting miR-21 can regulate downstream target genes to trigger cancer cell apoptosis, demonstrating the feasibility of DNR-directly carrying antisense miR-21 asPNA oligonucleotide therapy to inhibit cell proliferation.

[0081] The above description is merely a few embodiments of this application and is not intended to limit this application in any way. Although this application discloses preferred embodiments as described above, it is not intended to limit this application. Any changes or modifications made by those skilled in the art without departing from the scope of the technical solution of this application using the disclosed technical content are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

Claims

1. A method for preparing a DNA nanoparticle antisense drug targeting microRNA, characterized in that, include: (1) Provide an antisense peptide nucleic acid, the sequence of which is shown in SEQ ID NO: 7; (2) Provides two template strands and three staple strands for self-assembly forming a DNA nanostructure, wherein the DNA nanostructure is self-assembled from a first template strand, a second template strand, a first staple strand, a second staple strand, and a third staple strand, wherein the first staple strand extends at its end with a sequence complementary to the antisense peptide nucleic acid, and the third staple strand is modified at its end with a selected aptamer, and the sequence of the first template strand is as shown in SEQ ID NO: 1, the sequence of the second template strand is as shown in SEQ ID NO: 2, the sequence of the first staple strand is as shown in SEQ ID NO: 3, the sequence of the second staple strand is as shown in SEQ ID NO: 4, the sequence of the third staple strand is as shown in SEQ ID NO: 5, the selected aptamer is AS1411, wherein the sequence of AS1411 is as shown in SEQ ID NO: 6; the molar ratio of the antisense peptide nucleic acid, the two template strands, and the three staple strands is 1:1:1; (3) Annealing is performed on a mixed system containing antisense peptide nucleic acid, template strand and staple strand, and DNA nanostructures are formed by one-step self-assembly. At the same time, antisense peptide nucleic acid is encapsulated and selected aptamers are exposed to obtain DNA nano-antisense drugs targeting microRNA.

2. The preparation method according to claim 1, characterized in that, Step (1) includes: preparing the antisense peptide nucleic acid by solid-phase polypeptide synthesis technology.

3. The preparation method according to claim 1, characterized in that: In step (3), the shape of the DNA nanostructure includes any one of rectangular sheets, triangular sheets, tubular, box-shaped, spherical or linear.

4. The preparation method according to claim 3, characterized in that: The DNA nanostructure is a linear DNA nanoribbon structure.

5. The preparation method according to claim 3, characterized in that: The first template chain is modified with the fluorescent group Cy5.

6. The preparation method according to claim 1, characterized in that, Step (3) includes: mixing the template strand, staple strand and antisense peptide nucleic acid in a buffer solution for annealing, and centrifuging the obtained product to obtain the DNA nano-antisense drug targeting microRNA.

7. The preparation method according to claim 6, characterized in that, The annealing process conditions include: first, reducing the annealing temperature from 95°C to 65°C at a rate of 0.2~0.5°C per second; then reducing the annealing temperature from 65°C to 20°C at a rate of 0.1~0.2°C per second; and the entire annealing process takes 7~9 hours.

8. The preparation method according to claim 6, characterized in that: The buffer solution is 1×TAE / Mg 2+ Buffer solution.

9. The preparation method according to claim 6, characterized in that, The centrifugation includes: mixing the product obtained from the annealing treatment with a buffer solution and adding it to a centrifuge column for centrifugal purification.

10. A DNA nanoparticle antisense drug targeting microRNA prepared by the preparation method of any one of claims 1-9, wherein the DNA nanoparticle antisense drug comprises a DNA nanostructure as a carrier, an antisense peptide nucleic acid, and a selected aptamer, wherein, The DNA nanostructure encapsulates an antisense peptide nucleic acid, exposing a selected aptamer. The antisense peptide nucleic acid is attached to the 3' end of one staple chain constituting the DNA nanostructure, while the selected aptamer is modified to the 5' end of another staple chain constituting the DNA nanostructure.

11. The use of the DNA nano-antisense drug targeting microRNA as described in claim 10 in the preparation of targeted drugs for tumor gene therapy.

12. A targeted drug for tumor gene therapy, characterized in that, Including the DNA nanoantisense drug targeting microRNA as described in claim 10.

Images