A primer probe set and kit for fluorescent quantitative PCR for detecting influenza D virus and its lineages

By designing a specific fluorescent quantitative PCR primer probe set, the problem of the existing technology being unable to quickly and accurately identify the influenza D virus lineage was solved, and rapid and accurate detection of influenza D virus and its lineage was achieved, simplifying the operation process and improving detection efficiency.

CN117683939BActive Publication Date: 2025-09-26INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202311625105.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-30
Publication Date
2025-09-26
Estimated Expiration
2043-11-30

AI Technical Summary

Technical Problem

Existing methods for detecting influenza D viruses are unable to quickly and accurately identify the lineage of the virus. Existing technologies require PCR amplification of HEF gene fragments and sequencing analysis to determine the lineage, making the detection process complicated and time-consuming.

Method used

A specific fluorescent quantitative PCR primer and probe set, including IDV PB-F, IDV PB-R, IDV PB-Prob, IDV HEF-F, and IDV HEF-R, was designed to detect influenza D virus and its lineages. Combined with One Step PrimeScriptTM RT-PCR master mix and positive and negative standard plasmids, rapid and accurate detection and identification can be achieved.

Benefits of technology

It achieves the simultaneous detection of influenza D virus and its lineages in one reaction, simplifies the detection process, improves the sensitivity and accuracy of detection, reduces human operational errors, reduces costs, and ensures the safety and speed of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117683939B_ABST
    Figure CN117683939B_ABST
Patent Text Reader

Abstract

The present invention discloses a primer probe set and a kit for fluorescent quantitative PCR for detecting influenza D virus and its lineages. The primer probe set consists of a group of primer probes IDV PB-F, IDV PB-R, IDV PB-Prob for detecting influenza D virus, and a group of primer probes IDV HEF-F, IDV HEF-R, IDV HEF-Prob for identifying lineages. The primer probe set can realize differential diagnosis of five lineage strains of IDV in one reaction, which can not only confirm whether the influenza D virus is infected, but also reveal which lineage the detected strain belongs to, and is more efficient and accurate than single gene detection. The kit developed based on this has a good application prospect, and truly realizes a fully enclosed and pollution-free integrated reaction from "sample in" to "result out".
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the fields of bioengineering technology and public health, and in particular to a primer probe set and a kit for fluorescent quantitative PCR for detecting influenza D virus and its lineages. Background Art

[0002] Influenza is a zoonotic infectious disease caused by influenza viruses, which poses a serious threat to public health and the development of animal husbandry. Influenza viruses belong to the Orthomyxoviridae family, which includes four types of influenza viruses: influenza A, B, C, and D viruses (IAV, IBV, ICV, and IDV). IAV, IBV, and ICV are known to cause respiratory illness in humans. IDV is a newly discovered member of the Orthomyxoviridae family, first isolated in 2011 from a pig with severe respiratory symptoms in Oklahoma, USA. This novel virus has been detected in pigs, wild boars, and cattle in numerous countries and regions in the Americas, Europe, Africa, and Asia. IDV has a wider host range than ICV and has been detected in a variety of animal species, including cattle, pigs, and wild boars, as well as goats, sheep, horses, and camels. Animal models have also been established in mice, guinea pigs, and ferrets. Infection with IDV causes a mild respiratory illness in cattle and is associated with bovine respiratory syndrome, which has a significant economic impact on the cattle industry. Furthermore, antibodies specific to IDV have been detected in the sera of North American cattle. In humans, despite generally low seroprevalence, a recent study showed that 94%–97% of cattle-handling workers had specific antibodies to IDV, raising concerns about potential zoonotic transmission.

[0003] IDV is a single-stranded, negative-sense RNA virus with seven genomic segments predicted to encode nine proteins, including the hemagglutinin-esterase fusion (HE) glycoprotein, polymerases PB2, PB1, and P3, nucleoprotein, matrix proteins (M1 and CM2), and nonstructural proteins (NS1 and NEP). The IDV genome shares approximately 50% similarity with that of ICV. Compared to IAV and IBV, the IDV genome consists of seven single-stranded, negative-sense segments encoding nine proteins: the hemagglutinin-esterase fusion protein (HEF protein), polymerases PB2, PB1, and P3, nucleoprotein, matrix proteins M1 and CM2, and nonstructural proteins NS1 and NEP. PB1 is the most conserved genomic segment in IDV, while HEF is the most variable. HEF protein has strong immunogenicity and is often used to analyze the genetic evolution of the virus. Based on the sequence differences of HEF, IDV can be divided into five different genetic evolutionary lineages, namely D / OK, D / 660, D / Yama2016, D / Yama2019 and D / CA2019 ( Figure 1 In Europe and the Americas, the D / OK and D / 660 lineages are predominant; in Japan, the D / Yama2016 and D / Yama2019 lineages are predominant. Furthermore, the D / CA2019 lineage has only been reported in California, USA. Most IDV strains detected in China belong to the D / OK lineage, with one belonging to the D / Yama2019 lineage. To date, no strains belonging to the D / 660, D / Yama2016, or D / CA2019 lineages have been detected.

[0004] Currently, fluorescent quantitative PCR methods for detecting influenza D virus have been established in China and patents have been applied for, such as "Influenza D Virus Fluorescent Quantitative PCR Primer Pair and Kit (Patent Application Number: CN201810329755.4)", "A Fluorescent PCR Primer and Probe for Detecting Influenza D Virus and Detection Method (Patent Application Number: CN201611145967.4), and "A Fluorescent PCR Primer and Probe for Detecting Influenza D Virus and Detection Method (Patent Application Number: CN201611145967.4). These methods are based on primers and probes designed based on the PB1 or NS genomic fragments of the influenza virus (IDV). They cannot identify the lineage of the tested IDV. To determine its lineage, PCR amplification of the HEF gene fragment and sequencing analysis are required to determine the IDV lineage to which it belongs. With the discovery of new IDV lineages (D / Yama2019 and D / CA2019) and new infection hosts in recent years, it has become more urgent to establish more accurate detection and typing methods. Timely and rapid monitoring of the prevalence trends of IDV and its lineages in cattle, pigs and various animals is of great significance for the prevention and control of IDV. Summary of the Invention

[0005] The primary purpose of the present invention is to overcome the deficiencies of the prior art and provide a primer and probe set for detecting influenza virus type D and its lineages using fluorescent quantitative PCR.

[0006] Another object of the present invention is to provide a fluorescent quantitative PCR kit for detecting influenza virus type D and its lineages.

[0007] The object of the present invention is achieved through the following technical solutions:

[0008] A primer probe set for fluorescent quantitative PCR for detecting influenza D virus and its lineages, comprising a set of primer probes for detecting influenza D virus and a set of primer probes for identifying lineages, specifically as follows:

[0009] IDV PB-F: 5'-CGAAAGTGCAGACGTTAACAC-3' (SEQ ID No. 1);

[0010] IDV PB-R: 5'-TCACCCCCTATGATTCCAT-3' (SEQ ID No. 2);

[0011] IDV PB-Prob: 5'-FAM-CCTTGACCGGGCCAGAACCCAGT-BHQ1 -3' (SEQ ID No. 3);

[0012] IDV HEF-F: 5'-GAGGVCAGTTGACACCAAG-3' (SEQ ID No. 4);

[0013] IDV HEF-R: 5'-CAACAGATCCAAATCACACCA-3' (SEQ ID No. 5);

[0014] IDV HEF-Prob: 5'-CY5-CCAYAGCTTCTCTGTCTTTTGGGBCT-BHQ2-3' (SEQ ID No. 6).

[0015] The primer probes for detecting influenza D virus are IDV PB-F, IDV PB-R and IDV PB-Prob; the primer probes for identifying lineages are IDV HEF-F, IDV HEF-R and IDV HEF-Prob.

[0016] A fluorescent quantitative PCR kit for detecting influenza D virus and its lineages comprises the above-mentioned primer probe set.

[0017] The above kit also includes positive standard plasmid, negative standard plasmid, One Step PrimeScript TM RT-PCR master mix, at least one of real-time fluorescent RT-PCR reagents, ddH2O, and a storage medium.

[0018] The positive standard plasmid is a plasmid constructed by the DNA fragment with the sequence shown in SEQ ID No. 10 and the plasmid framework; preferably, it is a recombinant plasmid obtained by connecting the DNA fragment with the sequence shown in SEQ ID No. 10 and the pUC57 vector.

[0019] The negative standard plasmid contains only the plasmid framework in the positive standard plasmid; preferably, it is a pUC57 plasmid.

[0020] The storage medium is an instruction manual, which records the testing procedures.

[0021] The detection procedure includes the following steps:

[0022] (1) Extracting RNA from the sample to be tested and using it as template RNA;

[0023] (2) performing a dual fluorescence RT-PCR reaction using the primers and probes;

[0024] (3) Based on the dual fluorescence RT-PCR amplification curve and the amplification results of the positive standard plasmid and the negative standard plasmid, determine whether the sample is type D influenza virus and determine the lineage to which the sample belongs.

[0025] The dual fluorescence RT-PCR reaction system described in step (2) is preferably as follows: One Step PrimeScript TM RT-PCR master mix 1×, Mg 2+ 2.5mM, IDV PB-F, IDV PB-R, IDV HEF-F, IDV HEF-R each 0.2μM, IDV PB-Prob and IDV HEF-Prob were 0.15μM and 0.2μM respectively.

[0026] The conditions of the dual fluorescence RT-PCR reaction described in step (2) are preferably as follows: reverse transcription at 42°C for 10 min; pre-denaturation at 95°C for 3 min; 40 cycles of 95°C for 10 s, 57°C for 10 s, and 60°C for 30 s; and collecting the fluorescence signal at 60°C for 30 s.

[0027] The beneficial effects of the present invention are as follows: after performing multiple sequence alignment based on the PB1 and HEF gene sequences of influenza D virus published in GenBank, a set of specific primers and probes are designed in the conserved region of the influenza D virus gene, and a simple detection method, rapid detection, and convenient quantitative detection are achieved through RT-PCR reaction. At the same time, sensitivity tests show that a nucleic acid sample with a minimum concentration of 1.0 copies / μL can be detected.

[0028] The primer pair is designed based on all D-type influenza PB1 sequences and HEF gene sequences on Gen Bank, and the middle conserved sequence is cut off. The primer pair of the present invention can be used to prepare a D-type influenza virus dual fluorescence RT-PCR detection kit, thereby detecting the viral content of D-type influenza virus (IDV). The kit comprises the primer pair as claimed in claim 1, a positive standard plasmid, a One Step PrimeScript TM RT-PCR master mix consists of real-time fluorescence RT-PCR reagent and ddH2O.

[0029] The advantages of the present invention are that it can achieve differential diagnosis of five lineages of IDV strains in a single reaction, which can not only confirm whether the patient is infected with the influenza D virus, but also reveal which lineage the detected strain belongs to. It is more efficient and accurate than single-gene detection. The present invention selects the amplification targets, namely the IDV PB1 gene and the IDV HEF gene sequences, analyzes the sequences, and designs, optimizes and screens them to obtain the optimal primers. This achieves independent amplification of the two targets with good sensitivity, specificity and repeatability, which has obvious advantages over existing technologies. Therefore, the kit developed based on this has a good application prospect. Furthermore, the IDV dual fluorescence RT-PCR kit of the present invention truly realizes a fully enclosed, pollution-free, integrated reaction from "sample in" to "result out". Manually, only the sample needs to be added to the reaction tube, and the remaining steps are completed automatically, which greatly reduces labor costs and time costs, reduces the impact of human operational errors, and avoids subjective result judgment. It does not generate aerosol pollution and also ensures the health of the test personnel. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a genetic evolution analysis diagram of influenza D virus based on the HEF gene; among the five IDV genealogies, D / OK, D / CA2019 and D / Yama2019 are marked in gray, and D / 660 and D / Yama2016 are marked in black.

[0031] Figure 2 This is a partial nucleic acid sequence alignment diagram of five lineages of the influenza D virus HEF gene in Example 1.

[0032] Figure 3 1 is a graph showing the optimization results of the reaction system and reaction conditions in Example 1; the amplification curves in the figure are dual fluorescence PCR amplification curves for the combination of primer sequence 1, sequence 2, and probe sequence 3, and primer sequence 7, sequence 8, and probe sequence 9, wherein the PB1 gene amplification curve in the FAM channel is gray; and the HEF gene amplification curve in the CY5 channel is black.

[0033] Figure 4 The figure is the amplification result of the dual fluorescence RT-PCR sensitivity test of Example 1; wherein, the gray amplification curve in the figure is the amplification of the PB1 gene in the FAM channel, and 1-9 are 1.0×10 9 copies / μL-1.0×10 0 copies / μL; the black amplification curve in the figure is the Cy5 channel amplification of HEF gene, from left to right are 1.0×10 9 copies / μL-1.0×10 0 copies / μL.

[0034] Figure 5 This is a standard thin line graph of the dual fluorescence RT-PCR sensitivity test in Example 1; the gray standard curve is the PB1 gene amplified by the FAM channel, and the black standard curve in the figure is the HEF gene amplified by the Cy5 channel.

[0035] Figure 6 This is a graph showing the specificity test results of dual fluorescence RT-PCR in Example 1; wherein the PB1 gene amplification curve of the FAM channel is gray, and the HEF gene amplification curve of the CY5 channel is black; in the figure, number 1 is an IDV-positive sample; 2 is influenza A (IAV); 3 is influenza B (IBV); 4 is swine influenza virus (SIV); 5 is porcine circovirus type 2 (PCV2); 6 is porcine circovirus type 3 (PCV3); 7 is classical swine fever virus (CSFV); 8 is pseudorabies virus (PRV); 9 is reproductive and respiratory syndrome virus (PRRSV); and 10 is a pUC57 vector plasmid.

[0036] Figure 7 1 is a graph showing the repeatability test results of the dual fluorescence RT-PCR of Example 1; the PB1 gene amplification curve of the FAM channel is gray; and the HEF gene amplification curve of the CY5 channel is black. DETAILED DESCRIPTION

[0037] The present invention will be further described in detail below by specific embodiments in conjunction with the accompanying drawings. However, it will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially.

[0038] Example 1, Establishment of a Dual Fluorescence PCR Method for Influenza D Virus

[0039] 1. Design and synthesis of amplification primers and probes

[0040] According to the PB1 and HEF gene sequences of all influenza D viruses published in GenBank (as of April 30, 2023), which are 110 and 153 strains respectively, the downloaded PB1 and HEF gene sequences were compared using the molecular biology software Mega7.0, as shown in the following example: Figure 2 As shown in the figure, a set of specific primers and probes were designed within the conserved region of the IDV PB1 gene. Similarly, a conserved region of the HEF gene was identified. The first base at the 3' end of one primer had consistent mutations across different lineages. Comparison revealed two sites that met the criteria. These primers and probes were designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The primers and probes were diluted with deionized water to a 10 pmol / μL solution and stored at -20°C until use. Primer sequences are shown in Table 1.

[0041] Table 1 Primer and probe sequences for dual fluorescence PCR detection of IDV

[0042]

[0043] 2. Preparation of Plasmid Standards

[0044] Based on the sequence in GenBank, the nucleic acid sequences of the amplified regions of the IDV PB1 and HEF genes were artificially synthesized in series (the specific sequence is shown in SEQ ID NO: 10) and cloned into the pUC57 vector. The recombinant plasmid was transformed into DH5α bacterial competent cells, and the recombinant plasmid was extracted and sequenced to verify it. It was used as a plasmid standard for dual fluorescence RT-PCR and was named pUC57-PB1-HEF. The plasmid concentration was measured by spectrophotometer, and the plasmid copy number was calculated according to the following formula: copy number (copies / μL) = (6.02 × 10 23 )×(concentration ng / μL×10- 9 / (number of DNA bases × 660).

[0045] Sequence 10:

[0046] .

[0047] 3. Optimal reaction system and optimal reaction conditions

[0048] The reaction system and conditions of the primer probe designed above were optimized, including the primer probe reaction concentration, Mg 2+ The concentration of the primer was screened in the range of 0.1-0.4μM, and the probe concentration was screened in the range of 0.1-0.4μM, with the increase of 0.05μM; Mg 2+ The concentration was screened in the range of 0.5-5mM, with an increment of 0.5mM. After multiple rounds of orthogonal experiments, a pair of high specificity and high amplification efficiency combinations were selected based on the obtained Ct values, differences in fluorescence increments, and changes in data. Ultimately, the optimal reaction mixture for the two sets of primers and probes was obtained: One-Step PrimeScript TM RT-PCR master mix (2×, Takara Biotechnology (Dalian) Co., Ltd.), the final concentrations of other components in the reaction system were Mg 2+The concentration of primers 1, 2, 4, and 5 was 0.2 μM each, and the concentrations of probes 3 and 6 were 0.15 μM and 0.2 μM, respectively. The optimal reaction conditions were 95°C for 10 seconds, 57°C for 10 seconds, and 60°C for 30 seconds, for 40 cycles, with fluorescence signal collection at 60°C for 30 seconds. The results of amplification with primers 7, 8, and 9 and with primers 1, 2, and 3 were as follows: Figure 3 The results showed that the Ct. value of HEF gene amplification was significantly greater than the Ct. value of PB1 gene amplification and the amplification curve was poor, so it was discarded.

[0049] 4. Method sensitivity test

[0050] The concentration of the positive plasmid standard pUC57-PB1-HEF plasmid was measured by UV spectrophotometer, and the copy number of the target gene was converted according to Avogadro's constant. Then the plasmid standard pUC57-PB1-HEF was diluted to 1.0 and 10 1 to 10 8 The sensitivity of the established method was verified by performing double fluorescence RT-PCR amplification using the above reaction system and reaction conditions. The test results are shown in Figure 2. Figure 4 and Figure 5 The results showed that the PB1 and HEF genes were amplified well, and both could amplify positive standards with a concentration as low as 1.0 copies / μL. 0 ~1.0×10 8 There is a linear relationship between the copies / μL.

[0051] V. Method Specificity Test

[0052] Positive samples of influenza D (IDV), influenza A (IAV), influenza B (IBV), swine influenza virus (SIV), porcine circovirus type 2 (PCV2), and porcine circovirus type 3 (PCV3) isolated, identified, and preserved by the Institute of Animal Health, Guangdong Academy of Agricultural Sciences, as well as live attenuated vaccines of classical swine fever (CSF), pseudorabies (PRV), and porcine reproductive and respiratory syndrome (PRRS) purchased from the Guangdong Provincial Vaccine Supply Station, were used for specificity testing. Equal amounts of virus fluid were taken to extract viral RNA (or DNA), and RNA (or DNA) templates were added. Dual fluorescence quantitative RT-PCR amplification was performed according to the optimal reaction system and optimal reaction procedure described in the third part above. Sample influenza D RNA was used as a positive control to verify the specificity of the established method. The test results are as follows: Figure 6As shown, only influenza D-positive samples amplified positively, while other pathogen-positive samples amplified negatively. This result demonstrates the high specificity of the IDV Dual Fluorescence RT-PCR Kit, with no nonspecific reactions, and demonstrates excellent amplification of the positive standard. Therefore, this kit is safe for influenza D virus detection, ensuring its accuracy.

[0053] VI. Repeatability Test of the Method

[0054] The plasmid standard pUC57-PB1-HEF plasmid was diluted to 1.0×10 3 copies / μL, 1.0×10 4 copies / μL and 1.0×10 5 The results showed that the intra-batch reproducibility of the three gradients was very good, and the CV values ​​were all less than 5% (e.g. Figure 7 shown).

[0055] Example 2: Application of Dual Fluorescence PCR Method in Genotyping of Influenza D Virus

[0056] In order to apply the dual fluorescence PCR method to identify the genotypes of influenza D virus, primers were designed at the differential sites of each genotype. The optimization experiments of the position of the differential sites in the primers and the optimization of the PCR reaction program were carried out.

[0057] 1. Primer design optimization test

[0058] Nucleic acid sequences of the PB1 and HEF amplified regions of representative strains of the D / 660 (SEQ ID NO: 11), D / Yama2016 (SEQ ID NO: 12), D / Yama2019 (SEQ ID NO: 13), and D / CA2019 (SEQ ID NO: 14) lineages were synthesized and cloned into the pUC57 vector as positive standards for each lineage. The genotype differential sites were placed in the upstream primers, and four primers were designed to determine their positions. The upstream primer sequences were SEQ ID NO: 4 and SEQ ID NO: 15 to SEQ ID NO: 17. These four primers differed in that the mismatched base G (underlined) was located at the 1st, 2nd, 3rd, and 4th positions 3' of SEQ ID NO: 4, SEQ ID NO: 15, and SEQ ID NO: 16 and SEQ ID NO: 17, respectively.

[0059] Sequence 11: cgaaagtgcagacgttaacaccccaataggatcaatgtcgatgggagaggcaattgaagccaaaatccttgaccgggccagaacccagtttgaaaatggaatcatagggggtgagaggccagttgacaccaatgttgtaataacatcggatccttattacttgggctcgaccatagctctctgtcttttgggtctaatggcgattgctgcttttgttggtgtgagttggatctgttg。

[0060] Sequence 12: cgaaagtgcagacgttaacaccccaataggatcaatgtcgatgggagaggcaattgaagccaaaatccttgaccgggccagaacccagtttgaaaatggaatcatagggggtgagaggccagttgacaccagtgttgtaataacatcggatccttattacttgggttcgaccacagctctctgtcttttgggtctggtggcgattgctgcttttgttggtgtgatttggatctgttg。

[0061] Sequence 13: cgaaagtgcagacgttaacaccccaataggatcaatgtcgatgggagaggcaattgaagccaaaatccttgaccgggccagaacccagtttgaaaatggaatcatagggggtgagaggccagttgacaccagtgttgtaacaacatcggatccttattacttgggttcgaccatagctctctgtcttttgggcctggtggcgattgctgcttttgttggtgtgatttggatctgttg。

[0062] Sequence 14: cgaaagtgcagacgttaacaccccaataggatcaatgtcgatgggagaggcaattgaagccaaaatccttgaccgggccagaacccagtttgaaaatggaatcatagggggtgaga ggccagttgacaccaacgttgtaataacatcggatccttattacttgggttcgaccatagctctctctgtcttttgggtctagtagcgattgctgcttttgttggtgtgatttggatctgttg.

[0063] Sequence 15: 5'-GAGGVCAGTTGACACCAA G G-3';

[0064] Sequence 16: 5'-GAGGVCAGTTGACACCAA G GT-3';

[0065] Sequence 17: 5'-GAGGVCAGTTGACACCAA G GTT-3'.

[0066] The four upstream primers were mixed with other components to form a reaction system. The positive plasmid standard of each lineage was diluted 10 times in a gradient to obtain a concentration of 1.0×10 3 Copies / μL were used as templates for dual fluorescence quantitative RT-PCR amplification according to the optimized reaction system and procedure described in Section 3 above. The results are shown in Table 2: Primer sequence 4 completely matched the HEF gene of the D / OK lineage, and the difference in Ct values ​​between the PB1 and HEF genes of the positive plasmid standard was less than 0.5. Primer sequence 4 had a mismatch with the first base 3' to the HEF gene amplification region of the D / Yama2019 and D / 660 lineages, and the difference in Ct values ​​between the PB1 and HEF genes was between 1 and 2. For the D / Yama2016 and D / CA2019 lineages, there were mismatches with the first and second bases 3' to the HEF gene amplification region of the primer sequence 4, and the difference in Ct values ​​between the PB1 and HEF genes was between 2.2 and 2.5. As can be seen, when the primer mismatch is located at the first position on the 3' end of the upstream primer (sequence 4), the HEF Ct.-PB Ct. amplification results in a significant difference. However, when the mismatch is located at the second, third, and fourth positions on the 3' end, the HEF Ct.-PB Ct. amplification differences are not significant, making it ineffective for distinguishing the five influenza D gene lineages. Therefore, primer sequence 4 was selected as the upstream primer. Therefore, the range of Ct. value differences between the PB1 and HEF genes can be well applied to influenza D virus monitoring.

[0067] Table 2. Dual fluorescence PCR amplification results of mismatched bases at different positions in the upstream primer sequence

[0068]

[0069] II. Application of Dual Fluorescence PCR Method for Influenza D Virus in Epidemiological Surveillance

[0070] Epidemiological surveillance of influenza D viruses requires two key considerations: the positive rate of IDV in collected samples and the rapid identification of the genetic lineages to which IDV-positive samples belong. Therefore, nasal swabs and blood samples were collected from cattle and pigs for dual fluorescence PCR testing. The D / OK and D / Yama2019 lineage samples listed in Table 3 represent the genetic lineages of influenza D viruses determined by our research team through sequencing analysis. The D / 660, D / Yama2016, and D / CA2019 samples were synthesized based on sequences 11, 12, and 14, respectively, and cloned into the pUC57 vector using recombinant plasmids. The results of dual fluorescence PCR amplification are shown in Table 3. The genetic lineages identified by dual fluorescence PCR are consistent with those identified by PCR-amplified HEF genes and sequencing, demonstrating that the established dual fluorescence PCR method can be used to rapidly identify the genetic lineages of influenza D viruses.

[0071] Table 3. Dual fluorescence PCR amplification results of IDV clinical samples and recombinant plasmid samples

[0072]

[0073] The foregoing description is merely a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the form disclosed herein and should not be construed as excluding other embodiments. Rather, the present invention can be used in various other combinations, modifications, and environments and can be modified within the scope of the concept described herein through the above teachings or techniques or knowledge in the relevant field. Modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention are intended to be protected by the appended claims.

Claims

1. A primer and probe set for fluorescent quantitative PCR for detecting influenza D virus and its lineages, characterized by: It consists of a set of primer probes for detecting influenza D virus and a set of primer probes for identifying lineages, as follows: IDV PB-F: 5'-CGAAAGTGCAGACGTTAACAC-3'; IDV PB-R: 5'-TCACCCCCTATGATTCCAT -3'; IDV PB-Prob: 5'-FAM-CCTTGACCGGGCCAGAACCCAGT−BHQ1 -3'; IDV HEF-F: 5'-GAGGVCAGTTGACACCAAG -3'; IDV HEF-R: 5'-CAACAGATCCAAATCACAACCA -3'; IDV HEF-Prob: 5'-CY5-CCAYAGCTTCTCTGTCTTTTGGGBCT-BHQ2-3'.

2. A kit for detecting influenza D virus and its lineages by fluorescent quantitative PCR, characterized in that: Comprising the primer probe set according to claim 1.

3. The kit for fluorescent quantitative PCR for detecting influenza D virus and its lineages according to claim 2, characterized in that: The kit further comprises at least one of a positive standard plasmid, a negative standard plasmid, a One Step PrimeScript™ RT-PCR master mix real-time fluorescent RT-PCR reagent, ddH2O, and a storage medium; The positive standard plasmid is a plasmid constructed from the DNA fragment shown in SEQ ID No. 10 and the plasmid framework; The negative standard plasmid only contains the plasmid framework in the positive standard plasmid.

4. The kit for fluorescent quantitative PCR for detecting influenza D virus and its lineages according to claim 3, characterized in that: The positive standard plasmid is a recombinant plasmid obtained by connecting the DNA fragment shown in SEQ ID No. 10 and the pUC57 vector; The negative standard plasmid is pUC57 plasmid.

5. The kit for fluorescent quantitative PCR for detecting influenza D virus and its lineages according to claim 3, characterized in that: The storage medium is an instruction manual, which records the testing procedures.

6. The kit for fluorescent quantitative PCR for detecting influenza D virus and its lineages according to claim 5, characterized in that: The detection procedure includes the following steps: (1) Extract RNA from the sample to be tested and use it as template RNA; (2) performing a dual fluorescence RT-PCR reaction using the primers and probes; (3) Based on the dual fluorescence RT-PCR amplification curve and the comparison of the amplification results of the positive standard plasmid and the negative standard plasmid, determine whether the sample is type D influenza virus and determine the lineage to which the sample belongs.

7. The kit for fluorescent quantitative PCR for detecting influenza D virus and its lineages according to claim 6, characterized in that: The dual fluorescence RT-PCR reaction system described in step (2) is as follows: One Step PrimeScript™ RT-PCR master mix 1×, Mg 2+ 2.5 mM, IDV PB-F, IDV PB-R, IDV HEF-F, IDV HEF-R each 0.2 μM, IDV PB-Prob and IDV HEF-Prob 0.15 μM and 0.2 μM, respectively; The conditions of the dual fluorescence RT-PCR reaction described in step (2) are as follows: reverse transcription at 42°C for 10 min; pre-denaturation at 95°C for 3 min; 40 cycles of 95°C for 10 s, 57°C for 10 s, and 60°C for 30 s; and collection of fluorescence signals at 60°C for 30 s.

Citation Information

Patent Citations

  • Fluorescent PCR primers and probes for detecting influenza D viruses and detection method

    CN106435036A

  • Primer pairs and kit for quantitative real-time PCR of influenza D virus

    CN108588276B

  • D / Yama2019 genetic evolution pedigree influenza delta virus reverse genetic manipulation system

    CN120210288A