Magnetic trapping probes, preparation methods, kits, and applications

Abstract

This application discloses a magnetic capture probe, its preparation method, kit, and applications. The preparation method includes mixing amino magnetic beads with glutaraldehyde and incubating to obtain aldehyde magnetic beads; mixing aldehyde magnetic beads with primers and incubating to obtain primer-modified magnetic beads; mixing primer-modified magnetic beads with a template, followed by high-temperature denaturation and low-temperature annealing, and then adding T4 DNA ligase to ligate gaps to obtain circular template-modified magnetic beads; and performing rolling circle amplification on the circular template-modified magnetic beads to obtain polynucleotide aptamer-modified magnetic beads, i.e., the magnetic capture probe. This application utilizes the specific recognition of Acinetobacter baumannii by polynucleotide aptamers, combined with magnetic separation technology of magnetic beads, to form a magnetic DNA capture probe based on polynucleotide aptamers, which can effectively achieve the capture, separation, and enrichment of Acinetobacter baumannii.

Description

Technical Field

[0001] This application relates to the field of biological probe technology, and in particular to a magnetic capture probe, its preparation method, kit, and application. Background Technology

[0002] Acinetobacter baumannii is one of the most common Gram-negative bacteria in clinical settings, widely present in hospital environments, and is one of the main pathogens causing infections in patients' lower respiratory tract, bloodstream, and wounds. The mortality rate from Acinetobacter baumannii infection in the ICU can reach 45%-60%. Since patients' bodily fluids may contain low numbers of Acinetobacter baumannii and low concentrations of Acinetobacter baumannii-specific biomarkers, developing efficient methods for capturing and enriching Acinetobacter baumannii from patient bodily fluid samples is extremely important for its detection.

[0003] Magnetic beads have been successfully used for the rapid capture of various pathogens. Currently, the magnetic beads on the market used for bacterial capture are mainly antibody-modified, which have the characteristics of high specificity. However, the antibody modification method is relatively complex and costly, which is not conducive to widespread use.

[0004] The information disclosed in this background section is intended only to enhance the understanding of the overall background of this application and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0005] The purpose of this application is to provide a magnetic capture probe, its preparation method, kit, and application, in order to solve the technical problem that the existing technology mainly uses antibody-modified magnetic beads for bacterial capture, but the antibody modification method is complex and costly, which is not conducive to widespread use. The application also provides a magnetic capture probe for rapidly enriching Acinetobacter baumannii.

[0006] To achieve the above objectives, one technical solution adopted in this application is:

[0007] A method for preparing a magnetic trapping probe is provided, comprising:

[0008] Amino magnetic beads were mixed with glutaraldehyde and incubated to obtain aldehyde magnetic beads;

[0009] The aldehyde magnetic beads were mixed with primers and incubated to obtain primer-modified magnetic beads, wherein the 5' end of the primers was modified with an amino group.

[0010] The primer-modified magnetic beads are mixed with a template and subjected to high-temperature denaturation followed by low-temperature annealing. This allows the primer-modified magnetic beads to recognize the template and form circular template-modified magnetic beads with gaps through complementary base pairing. T4 DNA ligase is then added for incubation to ligate the gaps, resulting in circular template-modified magnetic beads. The template comprises a target sequence and a specific sequence arranged sequentially, and the 5' end of the template is modified with a phosphate group. The target sequence is used to target Acinetobacter baumannii, and the specific sequence is at least partially complementary to the primer sequence.

[0011] The circular template-modified magnetic beads were subjected to rolling circle amplification to obtain polynucleotide aptamer-modified magnetic beads, i.e., magnetic capture probes;

[0012] The sequence of the primer is shown in SEQ ID NO.1, and the sequence of the template is shown in SEQ ID NO.2.

[0013] In one or more embodiments, in the step of mixing amino magnetic beads with glutaraldehyde and incubating to obtain aldehyde-based magnetic beads, the mass ratio of the amino magnetic beads to the glutaraldehyde is 1:(5-50), the incubation temperature is 10-30°C, and the incubation time is 0.8-6h.

[0014] In one or more embodiments, the step of mixing the aldehyde magnetic beads with primers and incubating to obtain primer-modified magnetic beads includes:

[0015] The aldehyde magnetic beads and primers were mixed and incubated to obtain the first intermediate product;

[0016] BSA solution was added to the first intermediate product, and the mixture was incubated to block the non-specific binding sites on the surface of the magnetic beads, thus obtaining the second intermediate product.

[0017] The second intermediate product was subjected to magnetic separation to remove the BSA solution, and then resuspended in deionized water to obtain primer-modified magnetic beads.

[0018] In one or more embodiments, in the step of mixing and incubating the aldehyde magnetic beads and primers to obtain a first intermediate product, the mass ratio of the aldehyde magnetic beads to the molar amount of the primers is (0.2–1) mg: 1 × 10⁻⁶ mg. -4 μmol, wherein the incubation is performed at 10–30°C for 0.8–6 h, or the incubation is performed at 3–5°C for 10–14 h;

[0019] In the step of adding BSA solution to the first intermediate product and continuing incubation to block non-specific binding sites on the surface of magnetic beads to obtain the second intermediate product, the incubation temperature is 10-30°C and the incubation time is 1-3 hours.

[0020] In one or more embodiments, during the step of mixing the primer-modified magnetic beads with the template and sequentially denaturing at high temperature and annealing at low temperature, the volume ratio of the primer-modified magnetic beads to the amount of the template is (0.2–1) mg: 1 × 10⁻⁶ mg. -4 μmol;

[0021] The sequential high-temperature denaturation and low-temperature annealing process specifically involves: heating to 95°C and holding for 2 minutes, then cooling to 65°C and holding for 2 minutes, then cooling to 20°C at a rate of 0.5°C / 30s and holding for 2 minutes, and finally cooling to 10°C and holding for 10 minutes.

[0022] In one or more embodiments, in the step of adding T4 DNA ligase to incubate and ligate the gap to obtain circular template modified magnetic beads, the volume ratio of the T4 DNA ligase to the mass ratio of the circular template modified magnetic beads with the gap is 5 μL: (0.8–1.2) mg, and the incubation is specifically carried out at 3–5 °C for 10–14 h, followed by incubation at 70–80 °C for 8–12 min.

[0023] In one or more embodiments, the step of performing rolling circle amplification on the magnetic beads modified with the ring template specifically includes:

[0024] The circular template-modified magnetic beads were subjected to rolling circle amplification using dNTPs as a substrate under the catalysis of phi29 DNA polymerase to obtain polynucleotide aptamer-modified magnetic beads. The mass ratio of the circular template-modified magnetic beads to the volume ratio of phi29 DNA polymerase was (0.2-1) mg: 2 μL. The rolling circle amplification reaction was incubated at 30-37°C for 6-10 h, followed by incubation at 70-80°C for 8-12 min.

[0025] To achieve the above objectives, another technical solution adopted in this application is:

[0026] A magnetic trapping probe prepared by the method described in any of the above embodiments is provided.

[0027] To achieve the above objectives, another technical solution adopted in this application is:

[0028] A reagent kit is provided, comprising:

[0029] Amino magnetic beads;

[0030] The primers have the sequence shown in SEQ ID NO.1, and the 5' end of the primers is modified with an amino group;

[0031] The template, as shown in SEQ ID NO.2, comprises a target sequence and a specific sequence arranged sequentially, and the 5' end of the template is modified with a phosphate group. The target sequence is used to target Acinetobacter baumannii, and the specific sequence is at least partially complementary to the sequence of the primer.

[0032] T4 DNA ligase;

[0033] phi29 DNA polymerase;

[0034] dNTPs.

[0035] To achieve the above objectives, another technical solution adopted in this application is:

[0036] The kit described in any of the above embodiments is provided for the enrichment of Acinetobacter baumannii.

[0037] The advantages of this application, which differ from existing technologies, are:

[0038] This application utilizes the specific recognition of Acinetobacter baumannii by polynucleotide aptamers and combines it with the magnetic separation technology of magnetic beads made of nanomaterials to form a magnetic DNA capture probe based on polynucleotide aptamers. This probe can effectively capture, separate and enrich Acinetobacter baumannii with a capture rate of 93.41%, effectively solving the problem of low abundance of Acinetobacter baumannii in patient body fluid samples and laying a good foundation for subsequent detection.

[0039] The magnetic capture probe of this application can capture and enrich Acinetobacter baumannii through simple magnetic separation. Compared with existing flow cytometry and other techniques that rely on expensive large-scale instruments and reagents, it effectively reduces costs and has high biocompatibility.

[0040] The magnetic capture probe of this application utilizes DNA rolling circle amplification technology to prepare a multi-aptamer, which is then combined with magnetic nanomaterial beads to form a magnetic DNA capture probe. This avoids the complex design and synthesis of probes and simplifies the preparation method. Attached Figure Description

[0041] Figure 1 This is a schematic flowchart of one embodiment of the preparation method of the magnetic trapping probe of this application;

[0042] Figure 2 yes Figure 1 A flowchart of one embodiment corresponding to step S200;

[0043] Figure 3 This is a scanning electron microscope image of the magnetic trapping probe of Embodiment 1 of this application;

[0044] Figure 4These are macroscopic morphological images of the magnetic trapping probe in Example 2 of this application, where a is a macroscopic morphological image of the magnetic trapping probe prepared in Example 1 without a magnet, and b is a macroscopic morphological image of the magnetic trapping probe prepared in Example 1 under the action of a magnet.

[0045] Figure 5 These are comparison images of plate culture in Example 3 of this application, where a is an image after plate culture of the complex precipitate solution of magnetic capture probe and Acinetobacter baumannii, and b is an image after plate culture of the supernatant solution. Detailed Implementation

[0046] The specific embodiments of this application will be described in detail below with reference to the accompanying drawings, but it should be understood that the scope of protection of this application is not limited to the specific embodiments.

[0047] Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprises" shall be understood to include the stated elements or components without excluding other elements or other components.

[0048] Magnetic beads used for bacterial capture are mainly antibody-modified, which have the characteristics of high specificity. However, antibody modification methods are complex and costly, making them unsuitable for widespread application.

[0049] Nucleic acid aptamers are functional nucleic acids that can be used to specifically recognize pathogenic microorganisms. They have strong binding ability, are easy to synthesize and modify, and can be used to construct various bio-separation materials based on various nanotechnology.

[0050] To address the problems existing in antibody-modified magnetic beads in current technologies, the applicant has developed a novel magnetic bead capture probe. This magnetic bead capture probe uses amino magnetic beads as a carrier and modifies the surface with polynucleotide aptamers to prepare a highly specific, sensitive, and easy-to-operate magnetic capture probe for Acinetobacter baumannii, providing a new technical method for enriching Acinetobacter baumannii in patient body fluids.

[0051] Specifically, please refer to Figure 1 , Figure 1 This is a schematic flowchart illustrating one embodiment of the preparation method of the magnetic trapping probe of this application.

[0052] As shown in the figure, the preparation method of the magnetic trapping probe includes:

[0053] S100. Mix amino magnetic beads with glutaraldehyde and incubate to obtain aldehyde magnetic beads.

[0054] Among them, amino magnetic beads can be iron oxide magnetic beads with amino modification, and glutaraldehyde can be glutaraldehyde with a concentration of 5% to 50%.

[0055] In one embodiment, the mass ratio of amino magnetic beads to glutaraldehyde can be 1:(5-50).

[0056] In one embodiment, the incubation temperature can be 10–30°C, and the incubation time can be 0.8–6 hours.

[0057] Aldehyde-modified magnetite beads, also known as aldehyde-modified magnetite beads, can be generated through the reaction of amino groups with glutaraldehyde.

[0058] S200. Mix aldehyde magnetic beads with primers and incubate to obtain primer-modified magnetic beads.

[0059] The primer has an amino group modified at its 5' end.

[0060] By mixing and incubating aldehyde-modified magnetic beads with primers, the amino group at the 5' end of the primer reacts with the aldehyde group of the aldehyde-modified magnetic bead, allowing the magnetic bead to connect to the 5' end of the primer, thus obtaining primer-modified magnetic beads.

[0061] In one implementation, the primer sequence is as follows:

[0062] NH2-TTCTTACTAATTTAGCATGAATT (SEQ ID NO. 1).

[0063] In one implementation, please refer to Figure 2 , Figure 2 yes Figure 1 A flowchart of one embodiment corresponding to step S200.

[0064] The steps for incubating primer-modified magnetic beads may include:

[0065] S201. The aldehyde magnetic beads and primers are mixed and incubated to obtain the first intermediate product.

[0066] The mass ratio of aldehyde magnetic beads to primers was (0.2–1) mg: 1 × 10⁻⁶ mg. -4 μmol.

[0067] In one embodiment, the aldehyde magnetic beads and primers can be mixed and incubated at room temperature, specifically at 10–30°C for 0.8–6 hours.

[0068] In another embodiment, the aldehyde magnetic beads and primers can also be incubated at low temperature, specifically at 3–5°C for 10–14 hours.

[0069] S202. Add BSA solution to the first intermediate product and continue incubation to block the non-specific binding sites on the surface of the magnetic beads, thereby obtaining the second intermediate product.

[0070] The concentration of the BSA solution can be 5%, which can block the non-specific binding sites on the surface of the magnetic beads.

[0071] In one embodiment, the incubation temperature can be 10–30°C, and the incubation time can be 1–3 hours.

[0072] S203. The second intermediate product is subjected to magnetic separation to remove the BSA solution, and then resuspended in deionized water to obtain primer-modified magnetic beads.

[0073] S300. Mix primer-modified magnetic beads with template, and then denature them at high temperature and anneal them at low temperature in sequence, so that the primer-modified magnetic beads can recognize the template and form circular template-modified magnetic beads with gaps through base complementary pairing. Then, add T4 DNA ligase to incubate and ligate the gaps to obtain circular template-modified magnetic beads.

[0074] The template includes a target sequence and a specific sequence arranged in sequence, and the 5' end of the template is modified with a phosphate group.

[0075] The targeting sequence is used to target Acinetobacter baumannii, and the specific sequence is at least partially complementary to the primer sequence.

[0076] After obtaining magnetic beads with primers on their surface, the template and primers can be ligated using the specific sequence of the template to obtain circular template-modified magnetic beads with notches. The notches are then ligated using T4 DNA ligase to obtain circular template-modified magnetic beads.

[0077] In one implementation, the sequence of templates is as follows:

[0078] Phosphate-TAGTAAGAAACAGTAGGAATGCAGAATTTGCAAGAATTTGGTTGACCATGTAAATTCATGCTAAAT (SEQ ID NO. 2).

[0079] In one embodiment, the mass ratio of primer-modified magnetic beads to template can be (0.2–1) mg: 1 × 10⁻⁶ mg. -4 μmol.

[0080] In one embodiment, the reaction system of primer-modified magnetic beads and template can specifically be: 2 μL template (100 μM), 20 μL primer-modified magnetic beads with a concentration of 50 mg / mL, 2 μL NaCl (800 mM) and 14 μL deionized water.

[0081] In one embodiment, the reaction process of high-temperature denaturation and low-temperature annealing can be specifically as follows: heating to 95°C and holding for 2 minutes, then cooling to 65°C and holding for 2 minutes, then cooling to 20°C at a cooling rate of 0.5°C / 30s and holding for 2 minutes, and then cooling to 10°C and holding for 10 minutes.

[0082] In one embodiment, the mass ratio of T4 DNA ligase volume to the notched circular template-modified magnetic beads is 5 μL: (0.2–1) mg, and the T4 DNA ligase can be incubated at 3–5 °C for 10–14 h, followed by incubation at 70–80 °C for 8–12 min.

[0083] In one embodiment, the reaction system of T4 DNA ligase and notched circular template modified magnetic beads can be: 5 μL T4 DNA ligase; 20 μL notched circular template modified magnetic beads with a concentration of 50 mg / mL; 60 μL T4 DNA ligase 10× Buffer; 515 μL deionized water.

[0084] S400. Rolling loop amplification is performed on magnetic beads modified with a circular template to obtain a magnetic trapping probe.

[0085] Rolling loop amplification is performed on magnetic beads modified with a circular template to prepare a multi-aptamer. The surface of the magnetic beads is then modified with the multi-aptamer to obtain multi-aptamer-modified magnetic beads, which are magnetic trapping probes.

[0086] This multi-aptamer contains a large number of targeting sequences for Acinetobacter baumannii, enabling the capture and isolation of Acinetobacter baumannii. At the same time, based on the magnetism of the magnetic beads, it can efficiently enrich Acinetobacter baumannii, which helps to detect Acinetobacter baumannii in subsequent samples. It solves the problem of low abundance of Acinetobacter baumannii in patient body fluid samples and lays a good foundation for subsequent detection.

[0087] In one embodiment, rolling circle amplification can specifically involve performing rolling circle amplification on magnetic beads modified with a circular template using phi29 DNA polymerase as a substrate to obtain a magnetic trapping probe.

[0088] In one embodiment, the mass ratio of the circular template-modified magnetic beads to the volume ratio of phi29 DNA polymerase can be (0.2–1) mg: 2 μL.

[0089] Specifically, the reaction system for rolling circle amplification can be: 17.24 μL of circular template modified magnetic beads with a concentration of 50 mg / mL; 2 μL of phi29 DNA polymerase; 10 μL of phi29 DNA polymerase buffer; 10 μL of dNTPs; 1 μL of LBSA (20 mg / mL); and 59.26 μL of deionized water.

[0090] In one embodiment, the rolling circle amplification reaction process can be incubation at 30–37°C for 6–10 h, followed by incubation at 70–80°C for 8–12 min.

[0091] This application also provides a kit based on the above-described method for preparing magnetic capture probes, which can be applied to the capture and enrichment of Acinetobacter baumannii.

[0092] Specifically, the kit includes amino magnetic beads, primers, template, T4 DNA ligase, phi29 DNA polymerase, and dNTPs.

[0093] The primer has an amino group modified at its 5' end.

[0094] The template includes a target sequence and a specific sequence arranged in sequence, and the 5' end of the template is modified with a phosphate group. The target sequence is used to target Acinetobacter baumannii, and the specific sequence is at least partially complementary to the primer sequence.

[0095] In one implementation, the primer sequence is as follows:

[0096] NH2-TTCTTACTAATTTAGCATGAATT (SEQ ID NO. 1).

[0097] In one implementation, the sequence of templates is as follows:

[0098] Phosphate-TAGTAAGAAACAGTAGGAATGCAGAATTTGCAAGAATTTGGTTGACCATGTAAATTCATGCTAAAT (SEQ ID NO. 2).

[0099] The beneficial effects of this application will be further explained in detail below with reference to specific embodiments.

[0100] Example 1: Preparation of a magnetic trapping probe

[0101] 1) Mix 20 μL of amino magnetic beads with 50 mg / mL and 1 mL of 15% glutaraldehyde, and incubate at 25 °C for 1 h to obtain aldehyde magnetic beads;

[0102] 2) Mix 20 μL of aldehyde magnetic beads with 50 mg / mL and 2 μL of 100 μM primer solution, incubate at 25 °C for 3 h, then add 5% BSA solution and continue incubating at 25 °C for 1 h. After that, remove the BSA solution by magnetic separation, add deionized water to resuspend, and obtain primer-modified magnetic beads.

[0103] 3) The primer-modified magnetic beads were mixed with the template, and then denatured at high temperature and annealed at low temperature to obtain notched ring-shaped template-modified magnetic beads. The specific reaction system consisted of 2 μL template (100 μM), 20 μL primer-modified magnetic beads with a concentration of 50 mg / mL, 2 μL NaCl (800 mM), and 14 μL deionized water. The specific reaction procedure was as follows: 95℃, 2 min; 65℃, 2 min; cooling to 20℃ at a cooling rate of 0.5℃ / 30 s; 20℃, 2 min; 10℃, 10 min.

[0104] Add T4 DNA ligase to incubate and ligate the gaps to obtain circular template-modified magnetic beads; the specific reaction system is as follows: 20 μL of 50 mg / mL circular template-modified magnetic beads with gaps; 5 μL of T4 DNA ligase; 60 μL of T4 DNA ligase 10× Buffer; 515 μL of deionized water; the specific reaction procedure is as follows: mix and incubate overnight at 4℃; incubate at 75℃ for 10 min.

[0105] 4) Circular template-modified magnetic beads were amplified using dNTPs as a substrate by rolling circle amplification catalyzed by phi29 DNA polymerase to obtain magnetic capture probes. The specific reaction system was as follows: 17.24 μL of circular template-modified magnetic beads with a concentration of 50 mg / mL; 2 μL of phi29 DNA polymerase; 10 μL of phi29 DNA polymerase buffer; 10 μL of dNTPs; 1 μL of BSA (20 mg / mL); 59.26 μL of deionized water. The specific reaction procedure was as follows: incubation at 37℃ for 8 h; incubation at 75℃ for 10 min.

[0106] Example 2: Preparation of a magnetic trapping probe

[0107] 1) Mix 20 μL of amino magnetic beads with 50 mg / mL and 1 mL of 50% glutaraldehyde, and incubate at 10 °C for 6 h to obtain aldehyde magnetic beads;

[0108] 2) Mix 8 μL of aldehyde magnetic beads with 50 mg / mL and 2 μL of 100 μM primer solution, incubate at 30 °C for 0.8 h, then add 5% BSA solution and continue incubating at 20 °C for 3 h. After that, remove the BSA solution by magnetic separation, add deionized water to resuspend, and obtain primer-modified magnetic beads.

[0109] 3) The primer-modified magnetic beads were mixed with the template, and then denatured at high temperature and annealed at low temperature to obtain notched ring-shaped template-modified magnetic beads. The specific reaction system consisted of 2 μL template (100 μM), 8 μL primer-modified magnetic beads with a concentration of 50 mg / mL, 2 μL NaCl (800 mM), and 26 μL deionized water. The specific reaction procedure was as follows: 95℃, 2 min; 65℃, 2 min; cooling to 20℃ at a cooling rate of 0.5℃ / 30 s; 20℃, 2 min; 10℃, 10 min.

[0110] T4 DNA ligase was added and the gap was ligated to obtain circular template-modified magnetic beads. The specific reaction system was as follows: 22 μL of 50 mg / mL circular template-modified magnetic beads with gaps; 5 μL of T4 DNA ligase; 60 μL of T4 DNA ligase 10× Buffer; 513 μL of deionized water. The specific reaction procedure was as follows: incubate overnight at 3℃; incubate at 80℃ for 8 min.

[0111] 4) Circular template-modified magnetic beads were amplified using dNTPs as a substrate by rolling circle amplification catalyzed by phi29 DNA polymerase to obtain magnetic capture probes. The specific reaction system was as follows: 5 μL of circular template-modified magnetic beads with a concentration of 50 mg / mL; 2 μL of phi29 DNA polymerase; 10 μL of phi29 DNA polymerase buffer; 10 μL of dNTPs; 1 μL of BSA (20 mg / mL); 71.5 μL of deionized water. The specific reaction procedure was as follows: incubation at 30℃ for 6 h; incubation at 80℃ for 8 min.

[0112] Example 3: Preparation of a magnetic trapping probe

[0113] 1) Mix 20 μL of amino magnetic beads with 50 mg / mL and 1 mL of 5% glutaraldehyde, and incubate at 30 °C for 0.8 h to obtain aldehyde magnetic beads;

[0114] 2) Mix 38 μL of aldehyde magnetic beads with a concentration of 50 mg / mL with 2 μL of 100 μM primer solution and incubate at 4 °C for 12 h. Then add 5% BSA solution and incubate at 30 °C for 2 h. After that, remove the BSA solution by magnetic separation and resuspend in deionized water to obtain primer-modified magnetic beads.

[0115] 3) The primer-modified magnetic beads were mixed with the template, and then denatured at high temperature and annealed at low temperature to obtain notched ring-shaped template-modified magnetic beads. The specific reaction system consisted of 2 μL template (100 μM), 36 μL primer-modified magnetic beads with a concentration of 50 mg / mL, 2 μL NaCl (800 mM), and 18 μL deionized water. The specific reaction procedure was as follows: 95℃, 2 min; 65℃, 2 min; cooling to 20℃ at a cooling rate of 0.5℃ / 30 s; 20℃, 2 min; 10℃, 10 min.

[0116] T4 DNA ligase was added and incubated to ligate the gap, resulting in circular template-modified magnetic beads. The specific reaction system was as follows: 18 μL of 50 mg / mL circular template-modified magnetic beads with gaps; 5 μL of T4 DNA ligase; 60 μL of T4 DNA ligase 10× Buffer; 517 μL of deionized water. The specific reaction procedure was as follows: incubation at 5℃ overnight; incubation at 70℃ for 12 min.

[0117] 4) Circular template-modified magnetic beads were amplified using dNTPs as a substrate by rolling circle amplification catalyzed by phi29 DNA polymerase to obtain magnetic capture probes. The specific reaction system was as follows: 18 μL of circular template-modified magnetic beads with a concentration of 50 mg / mL; 2 μL of phi29 DNA polymerase; 10 μL of phi29 DNA polymerase buffer; 10 μL of dNTPs; 1 μL of BSA (20 mg / mL); 58.5 μL of deionized water. The specific reaction procedure was as follows: incubation at 35℃ for 10 h; incubation at 70℃ for 12 min.

[0118] Example 1: Characterization Analysis

[0119] The sample prepared in Example 1 was placed on a silicon wafer, rapidly frozen in liquid nitrogen, and then placed in a vacuum freeze dryer overnight. The sample was then gold-plated and its scanning electron microscope image was captured. Figure 3 , Figure 3 This is a scanning electron microscope image of the magnetic trapping probe of Embodiment 1 of this application.

[0120] like Figure 3 As shown, the surface of the magnetic beads is coated with multi-aptamers, and the surface of the magnetic beads has been successfully modified by multi-aptamers containing a large number of targeting sequences.

[0121] Example 2: Magnetic Verification

[0122] The magnetism of the magnetic trapping probe prepared in Example 1 was verified using a magnet, and the results were obtained. Figure 4 , Figure 4 These are macroscopic morphological images of the magnetic trapping probe in Example 2 of this application, where a is a macroscopic morphological image of the magnetic trapping probe prepared in Example 1 without a magnet, and b is a macroscopic morphological image of the magnetic trapping probe prepared in Example 1 under the action of a magnet.

[0123] like Figure 4 As shown in Figure a, without the application of an external magnetic field, the magnetic capture probe exhibits a uniformly dispersed state, which can be used for capturing Acinetobacter baumannii; as... Figure 4 As shown in b, under the action of an external magnetic field, the magnetic capture probe exhibits a significant magnetic-responsive aggregation phenomenon, which can achieve the enrichment of Acinetobacter baumannii.

[0124] Example 3: Verification of the enrichment effect of Acinetobacter baumannii

[0125] (1) Culture of Acinetobacter baumannii

[0126] Remove the cryovial containing Acinetobacter baumannii preserved using the "paper disc method" from the -80°C cryovial: Acinetobacter baumannii standard strain (ATCC19606, Ab). Immediately add 1 mL of LB liquid medium to the cryovial and incubate at 37°C for 30 minutes.

[0127] Gently touch the cryovial and observe if the culture medium becomes cloudy. Using a sterilized inoculation loop, take one loopful of bacterial culture and inoculate it into freshly prepared LB liquid medium. Incubate overnight at 37°C. Detect bacterial concentration using OD600. After serial dilution, inoculate onto plates and calculate the bacterial concentration corresponding to an OD600 of 1.0 (approximately 1-1.7 × 10⁻⁶). 9 (CFU / mL).

[0128] (2) Capture efficiency detection

[0129] Add 100 μL of the magnetic trapping probe prepared in Example 1 to a solution containing 10 4 After thoroughly mixing the CFU / mL Acinetobacter baumannii in 1 mL of Tris-HCl buffer (20 mM, pH 7.4), incubate on a shaker (200 rpm, 37 °C) for 1 hour.

[0130] After magnetic separation of the complex between the magnetic capture probe and Acinetobacter baumannii, the sample was resuspended in 1 mL of Tris-HCl buffer (20 mM, pH 7.4) to obtain a precipitate solution. Simultaneously, the supernatant was collected into a new EP tube, and Tris-HCl buffer (20 mM, pH 7.4) was added to a volume of 1 mL to obtain the supernatant solution.

[0131] The supernatant and precipitate solutions were thoroughly mixed separately. 100 μL of each solution was added dropwise to an LB agar plate. The plate was then spread evenly with a glass rod and incubated overnight at 37°C. Figure 5 , Figure 5 These are plate culture comparison images of Example 3 of this application, where a is an image after plate culture of the complex precipitation solution of the magnetic capture probe and Acinetobacter baumannii, and b is an image after plate culture of the supernatant solution.

[0132] like Figure 5 As shown, the number of bacteria remaining in the supernatant was relatively small, while the number of single bacterial colonies growing in the precipitate was relatively large. The number of bacteria growing in the plate was counted using ImageJ software, and the capture efficiency was calculated using the following formula: Capture efficiency (%) = Number of colonies in the precipitate / (Total number of colonies in the precipitate and supernatant) × 100%. This indicates that 100 μL of magnetic capture probe could capture 10...4 The capture efficiency of Acinetobacter baumannii at CFU / mL was 93.41%.

[0133] The foregoing description of specific exemplary embodiments of this application is for illustrative and explanatory purposes. These descriptions are not intended to limit this application to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of this application and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of this application, as well as various different choices and variations. The scope of this application is intended to be defined by the claims and their equivalents.

Claims

1. A method for preparing a magnetic trapping probe, characterized in that, include: Amino magnetic beads were mixed with glutaraldehyde and incubated to obtain aldehyde magnetic beads; The aldehyde magnetic beads were mixed with primers and incubated to obtain primer-modified magnetic beads, wherein the 5' end of the primers was modified with an amino group. The primer-modified magnetic beads are mixed with a template and subjected to high-temperature denaturation followed by low-temperature annealing. This allows the primer-modified magnetic beads to recognize the template and form circular template-modified magnetic beads with gaps through complementary base pairing. T4 DNA ligase is then added for incubation to ligate the gaps, resulting in circular template-modified magnetic beads. The template comprises a target sequence and a specific sequence arranged sequentially, and the 5' end of the template is modified with a phosphate group. The target sequence is used to target Acinetobacter baumannii, and the specific sequence is at least partially complementary to the primer sequence. The circular template-modified magnetic beads were subjected to rolling circle amplification to obtain polynucleotide aptamer-modified magnetic beads, i.e., magnetic capture probes; The sequence of the primer is shown in SEQ ID NO. 1, and the sequence of the template is shown in SEQ ID NO. 2; In the step of mixing the primer-modified magnetic beads with the template and sequentially denaturing at high temperature and annealing at low temperature, the mass ratio of the primer-modified magnetic beads to the molar amount of the template is (0.2~1) mg: 1×10⁻⁶ mg. -4 μmol; The sequential high-temperature denaturation and low-temperature annealing specifically involve heating to 95°C. o The reaction was carried out at 65°C for 2 minutes, then cooled to 65°C. o The reaction was carried out at a temperature of C for 2 minutes, followed by a reaction at 0.5... o Cooled to 20°C at a cooling rate of 30°C / s. o The reaction was carried out at a constant temperature of 10°C for 2 minutes, then cooled to 10°C. o Keep the temperature at C for 10 min.

2. The preparation method according to claim 1, characterized in that, In the step of mixing amino magnetic beads with glutaraldehyde and incubating to obtain aldehyde-based magnetic beads, the mass ratio of the amino magnetic beads to the glutaraldehyde is 1:(5~50), and the incubation temperature is 10~30°C. o C, time is 0.8~6h.

3. The preparation method according to claim 1, characterized in that, The step of mixing the aldehyde magnetic beads with primers and incubating them to obtain primer-modified magnetic beads includes: The aldehyde magnetic beads and primers were mixed and incubated to obtain the first intermediate product; BSA solution was added to the first intermediate product, and the mixture was incubated to block the non-specific binding sites on the surface of the magnetic beads, thus obtaining the second intermediate product. The second intermediate product was subjected to magnetic separation to remove the BSA solution, and then resuspended in deionized water to obtain primer-modified magnetic beads.

4. The preparation method according to claim 3, characterized in that, In the step of mixing and incubating the aldehyde magnetic beads and primers to obtain the first intermediate product, the mass ratio of the aldehyde magnetic beads to the molar amount of the primers is (0.2~1) mg: 1×10⁻⁶ mg. -4 μmol, the incubation is at 10~30 μmol o Incubate at C for 0.8–6 h, or the incubation period is 3–5 h. o Incubate at C for 10-14 hours; In the step of adding BSA solution to the first intermediate product and continuing incubation to block non-specific binding sites on the surface of the magnetic beads to obtain the second intermediate product, the incubation temperature is 10~30℃. o C, incubation time is 1~3 hours.

5. The preparation method according to claim 1, characterized in that, In the step of adding T4 DNA ligase to incubate and ligate the gap to obtain circular template-modified magnetic beads, the volume ratio of the T4 DNA ligase to the mass ratio of the notched circular template-modified magnetic beads is 5 μL : (0.8~1.2) mg, and the incubation is specifically carried out at 3~5 days. o Incubate at C for 10-14 hours, then at 70-80°C. o Incubate at C for 8-12 minutes.

6. The preparation method according to claim 1, characterized in that, The specific steps for performing rolling circle amplification on the magnetic beads modified with the circular template are as follows: The circular template-modified magnetic beads were subjected to rolling circle amplification using dNTPs as a substrate under the catalysis of phi29 DNA polymerase to obtain polynucleotide aptamer-modified magnetic beads. The mass ratio of the circular template-modified magnetic beads to the volume ratio of phi29 DNA polymerase was (0.2~1) mg: 2 μL. The rolling circle amplification reaction was carried out at 30~37°C. o Incubate at C for 6-10 hours, then at 70-80°C. o Incubate at C for 8-12 minutes.

7. A magnetic trapping probe prepared by the method according to any one of claims 1 to 6.

8. The application of a magnetic capture probe prepared by the method according to any one of claims 1 to 6 in the enrichment of Acinetobacter baumannii.

Images